The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
AP017898	Sphingopyxis sp. FD7 DNA, complete genome	3695614	355745	407315	3695614	integrase,transposase	uncultured_virus(22.22%)	55	382400:382415	409036:409051
BBB11061.1|355745_356876_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	43.5	3.1e-40
BBB11062.1|357130_358027_+	pyrrolo-quinoline quinone	NA	NA	NA	NA	NA
BBB11063.1|358542_358755_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11064.1|358747_359986_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
BBB11065.1|359982_360834_-	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
BBB11066.1|360830_361673_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
BBB11067.1|361676_362984_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
BBB11068.1|363119_363872_-	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
BBB11069.1|363878_366347_-	conjugal transfer ATPase TrbE	NA	NA	NA	NA	NA
BBB11070.1|366340_366613_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
BBB11071.1|366609_366957_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
BBB11072.1|366959_367982_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
BBB11073.1|367978_368404_-	helix-turn-helix protein CopG	NA	NA	NA	NA	NA
BBB11074.1|368406_370452_-	conjugal transfer coupling protein TraG	NA	NA	NA	NA	NA
BBB11075.1|370776_371115_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11076.1|371111_371486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
BBB11077.1|371489_372500_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11078.1|372506_373187_+	peptidase C1A	NA	NA	NA	NA	NA
BBB11079.1|373158_373938_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11080.1|373904_374609_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
BBB11081.1|374605_375784_-	MazG nucleotide pyrophosphohydrolase	NA	A0A0A0V4I6	uncultured_virus	36.5	4.0e-06
BBB11082.1|376032_377997_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
BBB11083.1|378343_378505_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11084.1|378837_379158_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11085.1|379519_379747_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11086.1|379800_380304_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11087.1|380296_380764_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11088.1|380874_382683_-	ParB-like protein	NA	A0A1C9EHW0	Gordonia_phage	32.0	5.5e-07
382400:382415	attL	GCCTCGATGGCGGCGG	NA	NA	NA	NA
BBB11089.1|382768_383191_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11090.1|383187_383460_-	ardC antirestriction protein	NA	A0A1B1IWW8	uncultured_Mediterranean_phage	57.7	7.5e-09
BBB11091.1|383456_384359_-	N-terminus replication primase	NA	A0A1B1IWW8	uncultured_Mediterranean_phage	37.3	5.9e-42
BBB11092.1|384409_386617_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
BBB11093.1|386613_388401_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11094.1|388397_389747_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
BBB11095.1|389903_390713_-	ardC antirestriction protein	NA	A0A1V0EEV1	Caulobacter_phage	35.3	2.3e-37
BBB11096.1|391229_391670_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11097.1|391739_392381_-	transglycosylase SLT family protein	NA	A0A0H3V0Q1	Geobacillus_virus	42.5	8.0e-09
BBB11098.1|392368_392890_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
BBB11099.1|392882_393191_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11100.1|393221_394103_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11101.1|394108_394723_-	putative autoinducer synthesis protein	NA	NA	NA	NA	NA
BBB11102.1|394815_395562_-	transcriptional regulator LuxR family	NA	NA	NA	NA	NA
BBB11103.1|395648_395924_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
BBB11104.1|396457_397039_-	alpha-methylacyl-CoA racemase	NA	NA	NA	NA	NA
BBB11105.1|396922_397186_+	beta-hexosaminidase	NA	NA	NA	NA	NA
BBB11106.1|397378_397639_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11107.1|397683_398685_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
BBB11108.1|398849_399722_-	outer membrane protein	NA	NA	NA	NA	NA
BBB11109.1|399858_400137_+|transposase	transposase A	transposase	NA	NA	NA	NA
BBB11110.1|400181_401030_+|integrase	integrase	integrase	NA	NA	NA	NA
BBB11111.1|401061_401865_-	TonB-dependent receptor	NA	NA	NA	NA	NA
BBB11112.1|401929_403348_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11113.1|403470_404178_+	transcriptional regulator	NA	NA	NA	NA	NA
BBB11114.1|404397_405723_-	DNA integration/recombination/inversion protein	NA	Q7M297	Enterobacteria_phage	40.6	3.6e-72
BBB11115.1|406118_407315_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	38.2	6.6e-65
409036:409051	attR	GCCTCGATGGCGGCGG	NA	NA	NA	NA
>prophage 2
AP017898	Sphingopyxis sp. FD7 DNA, complete genome	3695614	448686	517532	3695614	protease,integrase,transposase	Bacillus_virus(22.22%)	60	441666:441682	490868:490884
441666:441682	attL	GATCGCGATGTCGGCGC	NA	NA	NA	NA
BBB11160.1|448686_449193_+|protease	metalloprotease ybeY	protease	NA	NA	NA	NA
BBB11161.1|449212_450157_+	magnesium and cobalt transporter	NA	NA	NA	NA	NA
BBB11162.1|450198_451356_+	group 1 glycosyl transferase	NA	NA	NA	NA	NA
BBB11163.1|451363_452683_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	37.8	1.8e-71
BBB11164.1|452747_453164_-	glutathione-dependent formaldehyde-activating protein	NA	NA	NA	NA	NA
BBB11165.1|453240_454974_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11166.1|454991_456209_+	group 1 glycosyl transferase	NA	NA	NA	NA	NA
BBB11167.1|456205_457153_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11168.1|457149_458166_-	glycosyl transferase family protein	NA	NA	NA	NA	NA
BBB11169.1|458293_460591_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	NA	NA	NA	NA
BBB11170.1|460657_461266_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11171.1|461427_462432_-	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
BBB11172.1|462756_464958_+	catalase/peroxidase	NA	NA	NA	NA	NA
BBB11173.1|465292_465859_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11174.1|465941_467189_-	aspartate kinase	NA	NA	NA	NA	NA
BBB11175.1|467346_468186_+	3-demethylubiquinone-9 3-methyltransferase	NA	NA	NA	NA	NA
BBB11176.1|468352_469060_-	glutathione S-transferase-like protein	NA	NA	NA	NA	NA
BBB11177.1|469176_469602_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11178.1|469699_474229_-	glutamate synthase	NA	NA	NA	NA	NA
BBB11179.1|474294_475440_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11180.1|475436_476879_-	glutamate synthase small subunit	NA	G3MA85	Bacillus_virus	24.9	7.5e-07
BBB11181.1|477037_477838_-	undecaprenyl pyrophosphate phosphatase	NA	NA	NA	NA	NA
BBB11182.1|477896_478835_-	3-beta hydroxysteroid dehydrogenase/isomerase	NA	NA	NA	NA	NA
BBB11183.1|478833_479058_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11184.1|479296_480532_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	49.5	2.4e-102
BBB11185.1|480528_480729_-	DNA binding domain-containing protein	NA	NA	NA	NA	NA
BBB11186.1|481120_481870_+	hypothetical protein	NA	A0A2R2Z336	Escherichia_phage	32.8	4.3e-14
BBB11187.1|481901_483923_+	ParB family chromosome partitioning protein	NA	NA	NA	NA	NA
BBB11188.1|484062_486315_+	hypothetical protein	NA	A0A076FMQ0	Aureococcus_anophage	27.7	8.1e-16
BBB11189.1|486419_487652_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
BBB11190.1|487648_489004_+	site-specific recombinase XerD	NA	NA	NA	NA	NA
BBB11191.1|489000_490005_+|integrase	integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	25.9	5.8e-06
BBB11192.1|490116_492189_+	hypothetical protein	NA	A0A076FMQ0	Aureococcus_anophage	31.1	2.4e-14
490868:490884	attR	GCGCCGACATCGCGATC	NA	NA	NA	NA
BBB11193.1|492453_492657_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11194.1|493433_494627_+	hypothetical protein	NA	A0A1V0DX75	Synechococcus_virus	42.3	4.8e-76
BBB11195.1|494684_495074_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11196.1|495284_495521_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11197.1|495597_496299_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11198.1|496331_496490_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11199.1|496817_497462_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11200.1|497473_497935_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11201.1|498006_498483_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11202.1|498593_499535_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11203.1|499595_500279_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11204.1|500349_500538_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11205.1|500945_502340_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11206.1|502356_506721_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11207.1|507119_508118_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
BBB11208.1|508114_509521_-	bacterial cytochrome ubiquinol oxidase superfamily	NA	NA	NA	NA	NA
BBB11209.1|509523_510018_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11210.1|510032_510818_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11211.1|510822_512403_-	oxidoreductase	NA	NA	NA	NA	NA
BBB11212.1|512426_512837_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11213.1|512833_513274_-	putative transporter component	NA	NA	NA	NA	NA
BBB11214.1|513270_514188_-	beta-lactamase domain-containing protein	NA	NA	NA	NA	NA
BBB11215.1|514295_514922_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
BBB11216.1|514918_515317_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
BBB11217.1|515376_515727_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11218.1|516360_516627_+|transposase	transposase IS3 family protein	transposase	NA	NA	NA	NA
BBB11219.1|516620_517532_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-45
>prophage 3
AP017898	Sphingopyxis sp. FD7 DNA, complete genome	3695614	559473	590100	3695614	protease,integrase,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(50.0%)	32	564269:564285	576421:576437
BBB11263.1|559473_560073_-|protease	type IV secretory protease	protease	NA	NA	NA	NA
BBB11264.1|560044_560938_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
BBB11265.1|560909_562025_-	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
BBB11266.1|562021_563965_-	hypothetical protein	NA	NA	NA	NA	NA
564269:564285	attL	CGCGCAAGGCGATCGGT	NA	NA	NA	NA
BBB11267.1|564307_564457_-	conjugal DNA transfer protein	NA	NA	NA	NA	NA
BBB11268.1|564490_565339_-|integrase	integrase	integrase	NA	NA	NA	NA
BBB11269.1|565383_565662_-|transposase	transposase A	transposase	NA	NA	NA	NA
BBB11270.1|565792_566314_+	transcriptional regulator TrmB	NA	NA	NA	NA	NA
BBB11271.1|566923_567904_-	Fis family transcriptional regulator	NA	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	24.0	3.2e-09
BBB11272.1|567900_568287_-|transposase	transposase IS3/IS911	transposase	NA	NA	NA	NA
BBB11273.1|568421_568691_+|transposase	transposase IS3/IS911	transposase	NA	NA	NA	NA
BBB11274.1|568867_569410_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
BBB11275.1|569502_569832_-	ferredoxin	NA	NA	NA	NA	NA
BBB11276.1|569858_571121_-	cytochrome P450	NA	NA	NA	NA	NA
BBB11277.1|571290_571512_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11278.1|571539_572052_+	regulatory protein GntR	NA	NA	NA	NA	NA
BBB11279.1|572096_573239_+	oxidoreductase	NA	NA	NA	NA	NA
BBB11280.1|573263_574454_+	nonspecific lipid-transfer protein	NA	NA	NA	NA	NA
BBB11281.1|574450_574912_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11282.1|574919_576140_+	acyl-CoA dehydrogenase domain-containing protein	NA	NA	NA	NA	NA
BBB11283.1|576139_577231_+	acyl-CoA dehydrogenase domain-containing protein	NA	NA	NA	NA	NA
576421:576437	attR	ACCGATCGCCTTGCGCG	NA	NA	NA	NA
BBB11284.1|577289_578903_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
BBB11285.1|578899_580534_+	monooxygenase	NA	NA	NA	NA	NA
BBB11286.1|580533_581529_+	hydrolase	NA	NA	NA	NA	NA
BBB11287.1|581718_582195_-	hypothetical protein	NA	S5VTD3	Leptospira_phage	31.6	7.7e-17
BBB11288.1|584435_584906_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
BBB11289.1|585030_586083_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
BBB11290.1|586095_586350_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11291.1|586455_587679_+	ferredoxin reductase component of carbazole 1,9a-dioxygenase	NA	NA	NA	NA	NA
BBB11292.1|587675_588296_-	putative transmembrane protein	NA	NA	NA	NA	NA
BBB11293.1|588407_589205_+	NUDIX hydrolase	NA	NA	NA	NA	NA
BBB11294.1|589278_590100_-|transposase	transposase IS5 family protein	transposase	NA	NA	NA	NA
>prophage 4
AP017898	Sphingopyxis sp. FD7 DNA, complete genome	3695614	937580	1043507	3695614	protease,integrase,tRNA,transposase	Leptospira_phage(11.11%)	101	1000765:1000824	1005144:1006067
BBB11616.1|937580_938537_+|tRNA	tRNA pseudouridine synthase B	tRNA	NA	NA	NA	NA
BBB11617.1|938561_938831_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
BBB11618.1|939094_941395_+	polynucleotide phosphorylase	NA	NA	NA	NA	NA
BBB11619.1|941592_941799_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11620.1|941692_942385_+	cyclophilin type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
BBB11621.1|942482_943277_+	DNA uptake lipoprotein	NA	NA	NA	NA	NA
BBB11622.1|943309_944980_+	DNA repair protein RecN	NA	NA	NA	NA	NA
BBB11623.1|944976_945663_+	N-acetyltransferase GCN5	NA	NA	NA	NA	NA
BBB11624.1|945673_947818_+	NAD-dependent DNA ligase	NA	A0A0K2QQN8	Ralstonia_phage	38.0	3.4e-112
BBB11625.1|947832_948267_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11626.1|948409_950413_+	TonB-dependent receptor	NA	NA	NA	NA	NA
BBB11627.1|950510_951275_+	molybdenum ABC transporter periplasmic molybdate-binding protein	NA	NA	NA	NA	NA
BBB11628.1|951274_951970_+	molybdate ABC transporter permease	NA	NA	NA	NA	NA
BBB11629.1|951959_952580_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	33.0	3.7e-19
BBB11630.1|952618_953491_+	phenylalanine-4-hydroxylase	NA	NA	NA	NA	NA
BBB11631.1|953494_954307_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11632.1|954369_955341_-	ribosomal L11 methyltransferase	NA	NA	NA	NA	NA
BBB11633.1|955341_956034_-	short-chain dehydrogenase/reductase SDR	NA	NA	NA	NA	NA
BBB11634.1|956181_957534_-	methyl-accepting chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	60.6	8.6e-13
BBB11635.1|957634_958102_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
BBB11636.1|958256_959372_+	alanine dehydrogenase	NA	NA	NA	NA	NA
BBB11637.1|959393_959627_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11638.1|959695_960292_-	ACP phosphodiesterase	NA	NA	NA	NA	NA
BBB11639.1|960406_961105_-	pirin domain-containing protein	NA	NA	NA	NA	NA
BBB11640.1|961239_962175_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
BBB11641.1|962371_963079_+	two component transcriptional regulator	NA	W8CYM9	Bacillus_phage	31.4	8.2e-23
BBB11642.1|963435_963855_-	50S ribosomal protein L17	NA	NA	NA	NA	NA
BBB11643.1|964018_965077_-	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
BBB11644.1|965180_965570_-	30S ribosomal protein S11	NA	NA	NA	NA	NA
BBB11645.1|965648_966017_-	30S ribosomal protein S13	NA	NA	NA	NA	NA
BBB11646.1|966224_967322_-	GTP-dependent nucleic acid-binding protein EngD	NA	NA	NA	NA	NA
BBB11647.1|967439_968093_+	allergen protein	NA	NA	NA	NA	NA
BBB11648.1|968104_969091_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
BBB11649.1|969516_970086_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
BBB11650.1|970232_970871_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
BBB11651.1|971197_971980_-	GumN protein	NA	NA	NA	NA	NA
BBB11652.1|972093_973059_-	GumN protein	NA	NA	NA	NA	NA
BBB11653.1|973264_974188_+|tRNA	glycyl-tRNA synthetase subunit alpha	tRNA	NA	NA	NA	NA
BBB11654.1|974336_976613_+|tRNA	glycine-tRNA ligase	tRNA	NA	NA	NA	NA
BBB11655.1|976819_979477_+	pyruvate,orthophosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	41.0	7.7e-90
BBB11656.1|982596_982863_+|transposase	transposase IS3 family protein	transposase	NA	NA	NA	NA
BBB11657.1|982856_983768_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-45
BBB11658.1|984665_984995_-	CRISPR-associated protein Cas2	NA	NA	NA	NA	NA
BBB11659.1|984991_985924_-	CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
BBB11660.1|985972_989185_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11661.1|989777_990014_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
BBB11662.1|990042_990906_-|integrase	integrase catalytic subunit	integrase	A0A0P0I4A4	Acinetobacter_phage	42.1	2.8e-49
BBB11663.1|990902_991217_-|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
BBB11664.1|991293_991791_+|integrase	phage integrase site specific recombinase	integrase	Q7Y5X7	Haemophilus_phage	49.2	2.4e-29
BBB11665.1|991984_993256_+|integrase	phage integrase	integrase	K7PGY1	Enterobacteria_phage	21.9	7.1e-09
BBB11666.1|993345_994002_-	lytic transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	46.9	2.2e-22
BBB11667.1|994126_995056_+	genomic island protein	NA	A0A0H5AWB1	Pseudomonas_phage	30.1	3.8e-12
BBB11668.1|995168_999338_+	methylase/helicase	NA	A0A076FMQ0	Aureococcus_anophage	32.7	1.8e-13
BBB11669.1|999391_999805_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11670.1|999801_1000530_+	RES domain-containing protein	NA	NA	NA	NA	NA
BBB11671.1|1000763_1001585_-|transposase	transposase IS5 family protein	transposase	NA	NA	NA	NA
1000765:1000824	attL	CATGCTCTTGCGATACGGCGGACGAAGAGCTGAATTGAGGCGATGAACAGCCACGCGGTT	NA	NA	NA	NA
BBB11672.1|1001664_1002066_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11673.1|1002282_1003497_-	restriction endonuclease	NA	NA	NA	NA	NA
BBB11674.1|1003530_1003722_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11675.1|1003908_1004757_-|integrase	integrase	integrase	NA	NA	NA	NA
BBB11676.1|1004801_1005020_-|transposase	transposase A	transposase	NA	NA	NA	NA
BBB11677.1|1004923_1005964_-|transposase	transposase IS5 family protein	transposase	NA	NA	NA	NA
BBB11678.1|1006043_1007888_-	hypothetical protein	NA	NA	NA	NA	NA
1005144:1006067	attR	CATGCTCTTGCGATACGGCGGACGAAGAGCTGAATTGAGGCGATGAACAGCCACGCGGTTGCCGATGCGATGGTCTGCTCGAAGTCTTTGGCGAGGCGGCGGTTGCGACCGAGCCACGCAAAGGTCCGCTCGACCACCCAGCGTCTGGGCAGGACCTCGAAGCCCTTGGCATGGTCGGATCGCTTGATGATCTCGACCGTCCACTTCCCGATCTTGCGCAGCGCCTGGCGAAGCTTGTCGCCAGCATAGCCGCCATCGGCGAAGATGTGCCTGAGCCAAGGGTGACGGCGGATGATCTCGGCCAGAACAAACGGCGCGCCATCGCGATCCTGCACGTCAGCGGTGTGGATCACGGCATGAACGAGATTGCCCTCGGTGTCGGTCACGATGTGTCGCTTGCGGCCCTTGATCTTCTTGCCTGCGTCATAGCCGCAAGGCCCGCCGCTTTCCGTGGTTTTCACGCTTTGGCTGTCGATGACCCCAGCGCTCGGAGAAGCCTCGCGCCCGAGGGCTTCCCGCCCGATCAGCAGCAGGGCGTGATTGAGCGAGAGCCACAGACCATTGTCGCGCCACAGATAGAACCAGCGCCGCACCGTCGAGACCGGAGGAAAGCAGGGCGGCAACATCCGCCAGGGCAGCCCACCGCGCAGCAGATACAGGATCGCCTCGATGATCCGCCGCAGCGGCCATTTGCGCGGTCGCCCTACACAGCAAGGGCCCGGAAGTAACGGCTCCAGCACGGCCCATTCCGCATCGGTCAAATCGCTTGGCAAAGCCAGGTCGGCACGGGCATACTGCGCCCGGGTGGTGTCGGTCCACATCGTTGAACTCCCGAAGTTTGTTGCAAAACCCCGTGAATCAGCGACTTGGGCTCGCGTCAAGCTAACCCGCTGGCACCACTCAACTTAATTTCGGATCAGGCTC	NA	NA	NA	NA
BBB11679.1|1008159_1008468_-	UvrD/REP helicase	NA	NA	NA	NA	NA
BBB11680.1|1008589_1009720_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	43.5	3.1e-40
BBB11681.1|1009814_1010573_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
BBB11682.1|1010665_1011745_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
BBB11683.1|1012189_1013056_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	28.4	1.0e-11
BBB11684.1|1013076_1013361_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB11685.1|1013499_1014711_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.8	2.5e-96
BBB11686.1|1015011_1015263_+	putative phage repressor	NA	NA	NA	NA	NA
BBB11687.1|1015671_1016061_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
BBB11688.1|1016057_1016261_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11689.1|1016257_1018603_-	copper-transporting P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.2	4.7e-83
BBB11690.1|1018667_1019600_-	copper resistance D	NA	NA	NA	NA	NA
BBB11691.1|1019604_1019988_-	copper resistance protein CopC	NA	NA	NA	NA	NA
BBB11692.1|1020126_1020405_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11693.1|1020401_1020842_+	heavy metal resistance protein	NA	NA	NA	NA	NA
BBB11694.1|1020838_1021408_+	FecI-like sigma-24 factor	NA	NA	NA	NA	NA
BBB11695.1|1021595_1023224_+	copper-resistance protein CopA	NA	NA	NA	NA	NA
BBB11696.1|1023220_1024276_+	copper resistance B	NA	NA	NA	NA	NA
BBB11697.1|1024342_1024699_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11698.1|1024695_1024896_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11699.1|1025022_1025451_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11700.1|1026323_1027430_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
BBB11701.1|1027426_1029337_-	peptidoglycan glycosyltransferase	NA	NA	NA	NA	NA
BBB11702.1|1029347_1029869_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11703.1|1029865_1030771_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
BBB11704.1|1030788_1031835_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
BBB11705.1|1032031_1033843_+	DNA mismatch repair protein	NA	A0A1B2LRQ5	Wolbachia_phage	37.0	1.8e-98
BBB11706.1|1033844_1034375_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11707.1|1034371_1035937_-	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
BBB11708.1|1036016_1036727_-	glutaredoxin	NA	NA	NA	NA	NA
BBB11709.1|1036795_1037197_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
BBB11710.1|1037342_1038131_-	inositol monophosphatase	NA	NA	NA	NA	NA
BBB11711.1|1038138_1039482_-	C69 family peptidase	NA	NA	NA	NA	NA
BBB11712.1|1039636_1039957_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11713.1|1040243_1040846_-	hypothetical protein	NA	NA	NA	NA	NA
BBB11714.1|1040989_1041505_-	ubiquinone biosynthesis protein COQ7	NA	NA	NA	NA	NA
BBB11715.1|1041501_1041981_-	disulfide bond formation protein	NA	NA	NA	NA	NA
BBB11716.1|1042118_1043507_-|protease	carboxyl-terminal protease	protease	A0A0R6PIZ1	Moraxella_phage	26.6	3.0e-21
>prophage 5
AP017898	Sphingopyxis sp. FD7 DNA, complete genome	3695614	1207393	1246809	3695614	integrase,tRNA,transposase	Acinetobacter_phage(25.0%)	35	1207359:1207393	1246810:1246844
1207359:1207393	attL	GTGACCGGCCCCCACCGAGTGGTCCGGGCTATATG	NA	NA	NA	NA
BBB11867.1|1207393_1208242_-|integrase	integrase	integrase	NA	NA	NA	NA
BBB11868.1|1208286_1208505_-|transposase	transposase A	transposase	NA	NA	NA	NA
BBB11869.1|1208408_1209449_-|transposase	transposase IS5 family protein	transposase	NA	NA	NA	NA
BBB11870.1|1209616_1211554_+	propionyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
BBB11871.1|1211789_1212557_-	cyclase family protein	NA	NA	NA	NA	NA
BBB11872.1|1212750_1214394_+	major facilitator superfamily transporter	NA	NA	NA	NA	NA
BBB11873.1|1214439_1215486_+	alanine racemase	NA	NA	NA	NA	NA
BBB11874.1|1215542_1218302_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	23.3	3.4e-16
BBB11875.1|1218329_1218569_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11876.1|1218638_1219769_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	43.5	3.1e-40
BBB11877.1|1219827_1220046_-	TonB-dependent receptor	NA	NA	NA	NA	NA
BBB11878.1|1220569_1221103_+	polyhydroxyalkonate synthesis repressor PhaR	NA	NA	NA	NA	NA
BBB11879.1|1221143_1222670_+|tRNA	prolyl-tRNA synthetase	tRNA	A0A2K9L3R9	Tupanvirus	37.0	8.9e-75
BBB11880.1|1222842_1225143_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	29.8	3.3e-49
BBB11881.1|1225240_1226023_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
BBB11882.1|1226141_1226534_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11883.1|1226541_1226997_-	universal stress protein UspA	NA	NA	NA	NA	NA
BBB11884.1|1227155_1228466_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
BBB11885.1|1228467_1228995_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11886.1|1228987_1230385_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
BBB11887.1|1230485_1231808_+	amidohydrolase	NA	NA	NA	NA	NA
BBB11888.1|1231948_1232731_-	protein tyrosine/serine phosphatase	NA	NA	NA	NA	NA
BBB11889.1|1232733_1233537_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
BBB11890.1|1233588_1234728_+	acyl-CoA dehydrogenase-like protein	NA	NA	NA	NA	NA
BBB11891.1|1234724_1235441_+	acyl-CoA dehydrogenase-like protein	NA	NA	NA	NA	NA
BBB11892.1|1235545_1236703_-	acyl-CoA transferase	NA	NA	NA	NA	NA
BBB11893.1|1236787_1238125_+	hypothetical protein	NA	NA	NA	NA	NA
BBB11894.1|1238125_1239391_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
BBB11895.1|1239479_1240262_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
BBB11896.1|1240273_1241479_-	acyl-CoA dehydrogenase-like protein	NA	NA	NA	NA	NA
BBB11897.1|1241475_1242570_-	acyl-CoA dehydrogenase-like protein	NA	NA	NA	NA	NA
BBB11898.1|1242919_1243900_+	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
BBB11899.1|1244010_1245111_+	flavin reductase-like	NA	NA	NA	NA	NA
BBB11900.1|1245637_1245916_+|transposase	transposase A	transposase	NA	NA	NA	NA
BBB11901.1|1245960_1246809_+|integrase	integrase	integrase	NA	NA	NA	NA
1246810:1246844	attR	CATATAGCCCGGACCACTCGGTGGGGGCCGGTCAC	NA	NA	NA	NA
>prophage 6
AP017898	Sphingopyxis sp. FD7 DNA, complete genome	3695614	1492051	1627253	3695614	protease,integrase,tRNA,transposase	Acidithiobacillus_phage(10.34%)	124	1488950:1488965	1627287:1627313
1488950:1488965	attL	GGCGGCGATCACCGGC	NA	NA	NA	NA
BBB12142.1|1492051_1492327_-|transposase	transposase	transposase	NA	NA	NA	NA
1488950:1488965	attL	GGCGGCGATCACCGGC	NA	NA	NA	NA
BBB12143.1|1492323_1492659_-|integrase	integrase	integrase	NA	NA	NA	NA
BBB12144.1|1492664_1493528_-|integrase	integrase catalytic subunit	integrase	A0A0P0I4A4	Acinetobacter_phage	42.1	2.8e-49
BBB12145.1|1493524_1493839_-|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
BBB12146.1|1493929_1494139_+|transposase	transposase	transposase	NA	NA	NA	NA
BBB12147.1|1494484_1495504_-	ribokinase-like domain-containing protein	NA	NA	NA	NA	NA
BBB12148.1|1495503_1496289_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
BBB12149.1|1496308_1497055_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
BBB12150.1|1497137_1498040_-	esterase	NA	NA	NA	NA	NA
BBB12151.1|1498056_1500822_-	putative TonB dependent receptor protein	NA	NA	NA	NA	NA
BBB12152.1|1501030_1501876_-	lipolytic protein G-D-S-L family	NA	NA	NA	NA	NA
BBB12153.1|1501875_1502628_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
BBB12154.1|1502641_1503925_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
BBB12155.1|1503921_1506096_-	alginate lyase	NA	NA	NA	NA	NA
BBB12156.1|1506092_1508318_-	poly(beta-D-mannuronate) lyase	NA	NA	NA	NA	NA
BBB12157.1|1508416_1511449_-	TonB-dependent receptor	NA	NA	NA	NA	NA
BBB12158.1|1511977_1512298_+|integrase	integrase	integrase	NA	NA	NA	NA
BBB12159.1|1512317_1512509_-|transposase	transposase IS4	transposase	NA	NA	NA	NA
BBB12160.1|1512529_1512928_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB12161.1|1513056_1513278_+	GlcG protein	NA	NA	NA	NA	NA
BBB12162.1|1513307_1514219_-|transposase	transposase IS1477	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-45
BBB12163.1|1514212_1514479_-|transposase	transposase IS3 family protein	transposase	NA	NA	NA	NA
BBB12164.1|1515210_1516248_-	2-oxoglutarate ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
BBB12165.1|1516244_1518110_-	pyruvate flavodoxin/ferredoxin oxidoreductase-like protein	NA	NA	NA	NA	NA
1516953:1516968	attR	GGCGGCGATCACCGGC	NA	NA	NA	NA
BBB12166.1|1518294_1519242_+	alpha/beta hydrolase fold protein	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	28.0	1.2e-24
1516953:1516968	attR	GGCGGCGATCACCGGC	NA	NA	NA	NA
BBB12167.1|1519238_1519715_+	NUDIX hydrolase	NA	NA	NA	NA	NA
BBB12168.1|1519826_1520471_-	uracil-DNA glycosylase superfamily protein	NA	NA	NA	NA	NA
BBB12169.1|1520524_1521034_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase	NA	NA	NA	NA	NA
BBB12170.1|1521213_1522236_+	NAD-dependent epimerase	NA	A0A0F7L843	uncultured_marine_virus	22.6	1.0e-10
BBB12171.1|1522239_1522887_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12172.1|1522888_1523410_-	ECF subfamily RNA polymerase sigma-24 factor	NA	NA	NA	NA	NA
BBB12173.1|1523406_1523865_-	DoxX protein	NA	NA	NA	NA	NA
BBB12174.1|1523861_1524566_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12175.1|1524558_1525419_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12176.1|1525423_1525729_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12177.1|1526039_1527056_+	UDP-glucose 4-epimerase	NA	A0A2K9L5H6	Tupanvirus	44.5	3.7e-77
BBB12178.1|1527103_1527730_-	transmembrane protein	NA	NA	NA	NA	NA
BBB12179.1|1527902_1528118_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12180.1|1528117_1532341_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12181.1|1532340_1534614_-	surface antigen	NA	NA	NA	NA	NA
BBB12182.1|1534809_1535979_-	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	55.3	8.8e-115
BBB12183.1|1536065_1537529_-	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	31.5	5.6e-42
BBB12184.1|1537788_1539429_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12185.1|1539629_1540556_-	UDP-glucuronic acid decarboxylase 1	NA	A0A2K9KZK0	Tupanvirus	46.2	4.3e-80
BBB12186.1|1540794_1542204_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12187.1|1542197_1543595_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12188.1|1543606_1544974_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12189.1|1545019_1545778_+	glycosyl transferase family protein	NA	NA	NA	NA	NA
BBB12190.1|1545792_1546680_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12191.1|1546726_1548235_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
BBB12192.1|1548248_1549751_-	DegT/DnrJ/EryC1/StrS aminotransferase	NA	NA	NA	NA	NA
BBB12193.1|1549747_1550401_-	putative serine O-acetyltransferase	NA	NA	NA	NA	NA
BBB12194.1|1550411_1551554_-	UDP-N-acetylglucosamine 2-epimerase	NA	NA	NA	NA	NA
BBB12195.1|1551550_1552603_-	N-acylneuraminate-9-phosphate synthase	NA	NA	NA	NA	NA
BBB12196.1|1552596_1553391_-	short-chain dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	26.8	3.2e-07
BBB12197.1|1553390_1554038_-	acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
BBB12198.1|1554079_1554874_-	oxidoreductase-like protein	NA	NA	NA	NA	NA
BBB12199.1|1555071_1557321_-	N-acylneuraminate-9-phosphate synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	32.9	1.1e-28
BBB12200.1|1557317_1558004_-	acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
BBB12201.1|1558003_1559257_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12202.1|1559300_1561517_-	protein-tyrosine kinase	NA	NA	NA	NA	NA
BBB12203.1|1561703_1563092_-	O-antigen polymerase	NA	NA	NA	NA	NA
BBB12204.1|1563096_1565049_-	polysaccharide biosynthesis protein CapD	NA	NA	NA	NA	NA
BBB12205.1|1565106_1565658_-	sugar transferase	NA	NA	NA	NA	NA
BBB12206.1|1565666_1566599_-	NAD-dependent epimerase	NA	NA	NA	NA	NA
BBB12207.1|1566652_1567426_-	polysaccharide export protein	NA	NA	NA	NA	NA
BBB12208.1|1567611_1568319_-	metallophosphoesterase	NA	A0A0N9SH20	Staphylococcus_phage	27.9	3.4e-13
BBB12209.1|1568605_1569727_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A1V0SAG5	Catovirus	27.3	9.3e-21
BBB12210.1|1569716_1571012_+	UDP-glucose/GDP-mannose dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	25.7	9.4e-25
BBB12211.1|1571057_1571864_+	phosphomannose isomerase-like protein	NA	NA	NA	NA	NA
BBB12212.1|1571886_1572960_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	25.5	3.2e-18
BBB12213.1|1573013_1573580_+|protease	ATP-dependent protease peptidase subunit	protease	NA	NA	NA	NA
BBB12214.1|1573586_1574687_+	D-amino acid oxidase	NA	NA	NA	NA	NA
BBB12215.1|1574751_1576053_+|protease	ATP-dependent protease ATP-binding subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.2	2.9e-34
BBB12216.1|1576324_1577182_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
BBB12217.1|1577303_1578239_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12218.1|1578204_1579209_+|tRNA	tRNA(Ile)-lysidine synthetase-like protein	tRNA	NA	NA	NA	NA
BBB12219.1|1579291_1581235_+|protease	ATP-dependent metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	43.5	7.0e-117
BBB12220.1|1581342_1581666_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12221.1|1581799_1582405_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12222.1|1582456_1582801_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
BBB12223.1|1582936_1584127_+	phospholipase D/transphosphatidylase	NA	NA	NA	NA	NA
BBB12224.1|1584313_1584952_-	type 12 methyltransferase	NA	NA	NA	NA	NA
BBB12225.1|1585097_1586417_+	major facilitator superfamily transporter	NA	NA	NA	NA	NA
BBB12226.1|1586474_1588796_-	ATPase	NA	H8ZJI5	Ostreococcus_tauri_virus	43.0	3.4e-49
BBB12227.1|1588966_1589818_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
BBB12228.1|1590039_1590168_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
BBB12229.1|1590157_1590472_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12230.1|1590572_1591550_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
BBB12231.1|1592029_1593724_-	resolvase	NA	K4ICM1	Acidithiobacillus_phage	49.0	1.0e-87
BBB12232.1|1593720_1594149_-	hypothetical protein	NA	K4I3X1	Acidithiobacillus_phage	34.8	1.5e-11
BBB12233.1|1594148_1594634_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12234.1|1594775_1595081_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12235.1|1595297_1595564_+|transposase	transposase IS3 family protein	transposase	NA	NA	NA	NA
BBB12236.1|1595557_1596469_+|transposase	transposase IS1477	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-45
BBB12237.1|1596547_1601479_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12238.1|1601678_1602515_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12239.1|1602877_1603957_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
BBB12240.1|1604049_1604352_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12241.1|1604505_1605156_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12242.1|1606035_1606335_-|transposase	transposase mutator type	transposase	A0A220NQR7	Corynebacterium_phage	51.2	8.2e-17
BBB12243.1|1606317_1606518_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12244.1|1606574_1607876_+|integrase	integrase catalytic subunit	integrase	U5N3F9	Enterobacteria_phage	32.7	3.8e-42
BBB12245.1|1607872_1608718_+	IstB ATP binding domain-containing protein	NA	U5N3V8	Enterobacteria_phage	51.4	2.6e-52
BBB12246.1|1608772_1609558_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	50.7	3.0e-66
BBB12247.1|1609674_1613085_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12248.1|1613502_1613949_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12249.1|1613952_1615491_+	DNA-cytosine methyltransferase	NA	G3CB01	Aeropyrum_pernix_spindle-shaped_virus	28.0	1.6e-18
BBB12250.1|1615618_1615840_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12251.1|1615949_1617731_+	DNA-apyrimidinic site lyase	NA	NA	NA	NA	NA
BBB12252.1|1617714_1618479_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12253.1|1618511_1619186_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12254.1|1619212_1619491_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12255.1|1619568_1619787_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12256.1|1619909_1620116_+	XRE family transcriptional regulator	NA	A0A0K2CP57	Brevibacillus_phage	46.9	5.0e-05
BBB12257.1|1620122_1620518_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12258.1|1620514_1620994_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12259.1|1620990_1622319_-	adenine methyltransferase	NA	K4HZA5	Acidithiobacillus_phage	40.6	5.2e-71
BBB12260.1|1623088_1623538_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12261.1|1623622_1624444_+|transposase	transposase IS5 family protein	transposase	NA	NA	NA	NA
BBB12262.1|1624647_1624860_-|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
BBB12263.1|1624946_1626158_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.8	2.5e-96
BBB12264.1|1626186_1626942_-|integrase	integrase catalytic region	integrase	A0A0P0I4A4	Acinetobacter_phage	42.6	3.2e-41
BBB12265.1|1626938_1627253_-|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
1627287:1627313	attR	GGTGTCCGCGCAACCGGGGGAAGATCA	NA	NA	NA	NA
>prophage 7
AP017898	Sphingopyxis sp. FD7 DNA, complete genome	3695614	1732501	1788824	3695614	protease,integrase,transposase	Acinetobacter_phage(40.0%)	54	1729253:1729268	1746062:1746077
1729253:1729268	attL	CCTGCGCCTCCAGCCG	NA	NA	NA	NA
BBB12373.1|1732501_1733365_-|integrase	integrase catalytic subunit	integrase	A0A0P0I4A4	Acinetobacter_phage	42.1	2.8e-49
BBB12374.1|1733361_1733676_-|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
BBB12375.1|1733861_1734092_+|integrase	integrase catalytic subunit	integrase	NA	NA	NA	NA
BBB12376.1|1734200_1734695_+|integrase	integrase catalytic subunit	integrase	NA	NA	NA	NA
BBB12377.1|1734724_1735420_-	beta-lactamase-like protein	NA	A0A1X9I5D3	Streptococcus_phage	27.1	2.3e-17
BBB12378.1|1735513_1735819_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12379.1|1735831_1736389_-|protease	aspartyl protease-like protein	protease	NA	NA	NA	NA
BBB12380.1|1736424_1737060_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12381.1|1737071_1737779_-	glycine cleavage T protein	NA	NA	NA	NA	NA
BBB12382.1|1737865_1738888_+	dihydroorotase	NA	NA	NA	NA	NA
BBB12383.1|1739017_1739935_-	rarD protein	NA	NA	NA	NA	NA
BBB12384.1|1739955_1740177_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12385.1|1740360_1740759_+	17 kDa surface antigen	NA	NA	NA	NA	NA
BBB12386.1|1740919_1741471_+	acetyltransferase	NA	NA	NA	NA	NA
BBB12387.1|1741467_1741908_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12388.1|1741994_1742744_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12389.1|1742821_1743004_-	CsbD family protein	NA	NA	NA	NA	NA
BBB12390.1|1743237_1744884_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12391.1|1744896_1745670_-	thiamine biosynthesis protein	NA	NA	NA	NA	NA
BBB12392.1|1745671_1745872_-	sulfur carrier protein	NA	NA	NA	NA	NA
BBB12393.1|1745953_1746394_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
1746062:1746077	attR	CGGCTGGAGGCGCAGG	NA	NA	NA	NA
BBB12394.1|1746461_1746950_+	acetyl-CoA carboxylase	NA	NA	NA	NA	NA
BBB12395.1|1746959_1748321_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
BBB12396.1|1748425_1749784_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12397.1|1749964_1750663_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
BBB12398.1|1750665_1751097_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
BBB12399.1|1751349_1752294_-	palmitoyl-CoA hydrolase	NA	NA	NA	NA	NA
BBB12400.1|1752355_1752892_-	transcription antitermination protein NusG	NA	A0A068C9G5	Rhizobium_phage	28.7	5.4e-11
BBB12401.1|1752927_1753125_-	protein translocation complex subunit SecE	NA	NA	NA	NA	NA
BBB12402.1|1753282_1754527_-	Na+/melibiose symporter-like protein	NA	NA	NA	NA	NA
BBB12403.1|1754687_1755332_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
BBB12404.1|1755445_1756600_+	secretion protein HlyD	NA	NA	NA	NA	NA
BBB12405.1|1756606_1759771_+	hydrophobe/amphiphile efflux protein	NA	S5VTK5	Leptospira_phage	21.6	1.6e-54
BBB12406.1|1759763_1761179_+	RND-family efflux transporter	NA	NA	NA	NA	NA
BBB12407.1|1761175_1762282_+	DNA alkylation repair enzyme-like protein	NA	NA	NA	NA	NA
BBB12408.1|1762344_1764414_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
BBB12409.1|1764471_1765383_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12410.1|1765439_1768568_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.6	4.7e-14
BBB12411.1|1768598_1769939_-	C4-dicarboxylate transporter DctA	NA	NA	NA	NA	NA
BBB12412.1|1770158_1771955_+	sensor signal transduction histidine kinase	NA	NA	NA	NA	NA
BBB12413.1|1771951_1773289_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
BBB12414.1|1773429_1774611_-	peptidase M19	NA	NA	NA	NA	NA
BBB12415.1|1774871_1776566_+	N-acyl-D-amino-acid deacylase	NA	NA	NA	NA	NA
BBB12416.1|1776585_1777335_+	regulatory protein LuxR	NA	NA	NA	NA	NA
BBB12417.1|1777384_1778515_+	acyl-CoA dehydrogenase domain-containing protein	NA	NA	NA	NA	NA
BBB12418.1|1778655_1779672_-	acyl-CoA dehydrogenase domain protein	NA	NA	NA	NA	NA
BBB12419.1|1779903_1780815_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12420.1|1780956_1781841_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
BBB12421.1|1781978_1783142_+	succinyl-CoA:(R)-citramalate CoA-transferase	NA	NA	NA	NA	NA
BBB12422.1|1783227_1783734_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12423.1|1783815_1786221_+	putative TonB-dependent receptor	NA	NA	NA	NA	NA
BBB12424.1|1786317_1787613_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
BBB12425.1|1787629_1788025_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12426.1|1788176_1788824_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
AP017898	Sphingopyxis sp. FD7 DNA, complete genome	3695614	2262159	2312063	3695614	integrase,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(16.67%)	53	2253875:2253892	2301920:2301937
2253875:2253892	attL	GCGCTGCTCGCGCATTGC	NA	NA	NA	NA
BBB12883.1|2262159_2263416_+|integrase	integrase family protein	integrase	T1S9J3	Salmonella_phage	47.9	1.4e-110
BBB12884.1|2263912_2265019_-	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
BBB12885.1|2265158_2265545_+|transposase	transposase IS3/IS911	transposase	NA	NA	NA	NA
BBB12886.1|2265541_2266522_+	Fis family transcriptional regulator	NA	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	24.0	3.2e-09
BBB12887.1|2266596_2267133_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12888.1|2267228_2267714_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12889.1|2267653_2268004_+|transposase	transposase IS3/IS911	transposase	NA	NA	NA	NA
BBB12890.1|2268003_2268801_+|transposase	putative transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.9	9.8e-33
BBB12891.1|2268979_2269681_-	IstB ATP binding domain-containing protein	NA	A0A059NT77	Lactococcus_phage	38.2	1.7e-33
BBB12892.1|2269694_2271209_-|transposase	IstA-like transposase	transposase	NA	NA	NA	NA
BBB12893.1|2271324_2272122_-|transposase	putative transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.9	9.8e-33
BBB12894.1|2272121_2272472_-|transposase	transposase IS3/IS911	transposase	NA	NA	NA	NA
BBB12895.1|2272376_2273156_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12896.1|2273218_2274196_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12897.1|2274230_2275181_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12898.1|2275213_2276437_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12899.1|2277821_2278106_+|transposase	transposase	transposase	NA	NA	NA	NA
BBB12900.1|2278126_2278993_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	28.4	1.0e-11
BBB12901.1|2279126_2279606_+	DEAD/DEAH box helicase domain protein	NA	NA	NA	NA	NA
BBB12902.1|2279737_2280145_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12903.1|2280141_2282130_-	conjugal transfer coupling protein TraG	NA	NA	NA	NA	NA
BBB12904.1|2282345_2282543_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12905.1|2282542_2282833_+	putative ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
BBB12906.1|2282825_2284121_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12907.1|2284010_2284367_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12908.1|2284812_2285514_-	lytic transglycosylase catalytic subunit	NA	A0A0H3V0Q1	Geobacillus_virus	42.0	9.3e-11
BBB12909.1|2285517_2285847_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12910.1|2285850_2286429_-	conjugal transfer protein	NA	NA	NA	NA	NA
BBB12911.1|2286425_2286965_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12912.1|2287111_2288005_-	replication protein A	NA	NA	NA	NA	NA
BBB12913.1|2288013_2288286_-	phage transcriptional regulator AlpA	NA	NA	NA	NA	NA
BBB12914.1|2288417_2288972_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12915.1|2289123_2290203_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
BBB12916.1|2290651_2290918_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12917.1|2291136_2291364_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
BBB12918.1|2291413_2291770_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12919.1|2292346_2292862_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12920.1|2292894_2293059_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12921.1|2293368_2293749_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12922.1|2293798_2294779_-	Fis family transcriptional regulator	NA	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	24.0	3.2e-09
BBB12923.1|2294775_2295162_-|transposase	transposase IS3/IS911	transposase	NA	NA	NA	NA
BBB12924.1|2295264_2296314_-	hypothetical protein	NA	A0A2I7R8M6	Vibrio_phage	38.7	5.3e-10
BBB12925.1|2296315_2300656_-	methylase	NA	A0A076FMQ0	Aureococcus_anophage	23.6	4.1e-32
BBB12926.1|2300701_2300917_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12927.1|2300903_2301422_-	hypothetical protein	NA	NA	NA	NA	NA
BBB12928.1|2301490_2303587_-	plasmid stabilization protein	NA	NA	NA	NA	NA
2301920:2301937	attR	GCAATGCGCGAGCAGCGC	NA	NA	NA	NA
BBB12929.1|2303714_2304908_-	hypothetical protein	NA	A0A1V0DX75	Synechococcus_virus	44.6	1.5e-77
BBB12930.1|2305473_2306637_+	Fic/DOC family protein	NA	NA	NA	NA	NA
BBB12931.1|2306633_2307980_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12932.1|2307976_2310358_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12933.1|2310504_2310834_+	hypothetical protein	NA	NA	NA	NA	NA
BBB12934.1|2310891_2311758_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	28.4	1.0e-11
BBB12935.1|2311778_2312063_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
AP017898	Sphingopyxis sp. FD7 DNA, complete genome	3695614	2440313	2496730	3695614	holin,protease,transposase	uncultured_Mediterranean_phage(16.67%)	53	NA	NA
BBB13061.1|2440313_2440730_+|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	50.0	1.1e-16
BBB13062.1|2440745_2441276_-	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
BBB13063.1|2441379_2442105_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
BBB13064.1|2442098_2442704_+	DSBA oxidoreductase	NA	NA	NA	NA	NA
BBB13065.1|2442866_2444150_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
BBB13066.1|2444136_2445417_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13067.1|2445463_2446423_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13068.1|2446419_2447430_-	threonine aldolase	NA	NA	NA	NA	NA
BBB13069.1|2447515_2447701_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13070.1|2447893_2449111_-	argininosuccinate synthase	NA	NA	NA	NA	NA
BBB13071.1|2449360_2450149_+	outer membrane transport energization protein TonB	NA	NA	NA	NA	NA
BBB13072.1|2450224_2452303_+	dipeptidyl-peptidase 7	NA	NA	NA	NA	NA
BBB13073.1|2452332_2452770_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13074.1|2452801_2454049_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2I2L5L3	Orpheovirus	33.0	3.7e-42
BBB13075.1|2454087_2454843_-	oxidoreductase	NA	NA	NA	NA	NA
BBB13076.1|2454953_2455808_-	thiosulfate reductase cytochrome subunit B	NA	NA	NA	NA	NA
BBB13077.1|2455838_2457548_-	AMP-dependent synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	5.7e-30
BBB13078.1|2457625_2458501_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
BBB13079.1|2458487_2459558_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13080.1|2459740_2460073_+	N-acetyltransferase GCN5	NA	NA	NA	NA	NA
BBB13081.1|2460069_2460831_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13082.1|2460951_2462358_+	anion transporter	NA	NA	NA	NA	NA
BBB13083.1|2462428_2463721_+	methionine gamma-lyase	NA	NA	NA	NA	NA
BBB13084.1|2463921_2464641_-	HAD family hydrolase	NA	NA	NA	NA	NA
BBB13085.1|2464742_2465849_+	ABC-type transport system permease component LinK	NA	NA	NA	NA	NA
BBB13086.1|2465848_2466727_+	ABC transporter	NA	A0A2R8FG22	Brazilian_cedratvirus	29.5	2.8e-12
BBB13087.1|2466726_2467668_+	mammalian cell entry domain-containing protein	NA	NA	NA	NA	NA
BBB13088.1|2467676_2468282_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13089.1|2468365_2469295_+	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
BBB13090.1|2469407_2469728_+	small multidrug resistance protein	NA	NA	NA	NA	NA
BBB13091.1|2469921_2472516_-	aminopeptidase N	NA	NA	NA	NA	NA
BBB13092.1|2472562_2473354_+	NAD-dependent epimerase	NA	NA	NA	NA	NA
BBB13093.1|2473479_2474301_+|transposase	transposase IS5 family protein	transposase	NA	NA	NA	NA
BBB13094.1|2474821_2475130_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB13095.1|2475171_2475603_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB13096.1|2476245_2476467_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13097.1|2476461_2477727_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13098.1|2477799_2481213_-	acriflavin resistance protein	NA	NA	NA	NA	NA
BBB13099.1|2481388_2482210_+|transposase	transposase IS5 family protein	transposase	NA	NA	NA	NA
BBB13100.1|2482400_2483588_-	secretion protein HlyD	NA	NA	NA	NA	NA
BBB13101.1|2483865_2484138_-	transglycosylase-associated protein	NA	NA	NA	NA	NA
BBB13102.1|2484259_2484526_-	transglycosylase-associated protein	NA	NA	NA	NA	NA
BBB13103.1|2484861_2485215_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13104.1|2485493_2485769_+	hypothetical protein	NA	K4NX81	Burkholderia_phage	35.2	2.3e-05
BBB13105.1|2485728_2486019_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
BBB13106.1|2486158_2487148_-	quinolinate synthetase	NA	NA	NA	NA	NA
BBB13107.1|2487363_2489952_-	PAS/PAC sensor-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	4.5e-18
BBB13108.1|2490155_2491187_+	fatty acid desaturase	NA	NA	NA	NA	NA
BBB13109.1|2491550_2492339_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
BBB13110.1|2492335_2493112_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
BBB13111.1|2493451_2493724_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13112.1|2493733_2494639_+	cation transporter	NA	NA	NA	NA	NA
BBB13113.1|2494729_2496730_+|holin	glucose-methanol-choline oxidoreductase	holin	NA	NA	NA	NA
>prophage 10
AP017898	Sphingopyxis sp. FD7 DNA, complete genome	3695614	2826125	2872664	3695614	portal,tail,terminase,head,capsid	Bacillus_phage(13.33%)	51	NA	NA
BBB13463.1|2826125_2828168_+|portal	portal protein	portal	J9RWN4	Pseudomonas_phage	50.0	1.0e-94
BBB13464.1|2828160_2828832_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13465.1|2828828_2829176_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13466.1|2829172_2830402_+|head	head morphogenesis protein SPP1 gp7	head	A0A0M4UTA3	Ralstonia_phage	36.9	7.0e-30
BBB13467.1|2830702_2831548_+	adenine-specific DNA methyltransferase	NA	A0A219VHB5	Ochrobactrum_phage	58.6	1.2e-84
BBB13468.1|2831811_2832051_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13469.1|2832050_2832374_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13470.1|2832370_2833240_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13471.1|2833245_2834451_-	group 1 glycosyl transferase	NA	NA	NA	NA	NA
BBB13472.1|2834517_2834682_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13473.1|2834674_2836057_+	wzy family polymerase exosortase system type 1 protein	NA	NA	NA	NA	NA
BBB13474.1|2836210_2837401_+	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
BBB13475.1|2837494_2837953_+	MaoC-like dehydratase	NA	NA	NA	NA	NA
BBB13476.1|2838007_2839189_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
BBB13477.1|2839188_2839773_+	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
BBB13478.1|2839790_2840081_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
BBB13479.1|2840150_2840621_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
BBB13480.1|2840817_2841213_+	glyoxalase	NA	NA	NA	NA	NA
BBB13481.1|2841395_2842388_-	mandelate racemase	NA	NA	NA	NA	NA
BBB13482.1|2842400_2842808_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13483.1|2843014_2845174_+	prolyl oligopeptidase	NA	A0A1V0SHT0	Klosneuvirus	32.4	7.0e-65
BBB13484.1|2845175_2845661_+	GAF domain-containing protein	NA	NA	NA	NA	NA
BBB13485.1|2845982_2846777_+	17 kDa surface antigen	NA	NA	NA	NA	NA
BBB13486.1|2846997_2847537_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13487.1|2847699_2849550_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
BBB13488.1|2849699_2850134_+	type IV pilus assembly PilZ	NA	NA	NA	NA	NA
BBB13489.1|2850166_2851387_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
BBB13490.1|2851562_2853356_+	ABC transporter	NA	W8CYL7	Bacillus_phage	29.7	1.9e-52
BBB13491.1|2853402_2853939_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13492.1|2853960_2854386_-	biopolymer transport protein ExbD/TolR	NA	NA	NA	NA	NA
BBB13493.1|2854628_2855726_-	OmpA/MotB protein	NA	NA	NA	NA	NA
BBB13494.1|2855877_2856330_-	hypothetical protein	NA	M4QP18	Tetraselmis_viridis_virus	41.3	1.2e-14
BBB13495.1|2856339_2858517_-	hypothetical protein	NA	K4JQL7	Caulobacter_virus	37.6	1.1e-30
BBB13496.1|2858518_2858887_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13497.1|2858921_2859755_-	phage protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	35.1	3.9e-32
BBB13498.1|2859748_2862073_-	hypothetical protein	NA	W6ASE7	Acinetobacter_phage	33.3	2.2e-48
BBB13499.1|2862247_2862820_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13500.1|2862812_2863034_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13501.1|2863251_2863560_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13502.1|2863574_2863982_-|tail	phage major tail protein TP901-1	tail	NA	NA	NA	NA
BBB13503.1|2864029_2864365_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13504.1|2864384_2864777_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13505.1|2864773_2865319_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13506.1|2865318_2865603_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13507.1|2865767_2867255_-	hypothetical protein	NA	G5DMH7	Enterobacter_virus	37.4	7.2e-21
BBB13508.1|2867378_2868548_-|capsid	phage major capsid protein HK97	capsid	Q8W627	Enterobacteria_phage	49.0	4.3e-85
BBB13509.1|2868563_2869067_-|head	peptidase U35 phage prohead HK97	head	A0A2H4JAI0	uncultured_Caudovirales_phage	36.0	8.7e-11
BBB13510.1|2869258_2869585_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	50.0	1.3e-10
BBB13511.1|2869696_2870803_-|portal	phage portal protein HK97	portal	A0A0K1LLE7	Bacillus_phage	34.8	1.3e-46
BBB13512.1|2870878_2871178_-	excinuclease ABC subunit C	NA	NA	NA	NA	NA
BBB13513.1|2871365_2872664_-|terminase	terminase-like family protein	terminase	A0A0K1LMR9	Caulobacter_phage	37.2	2.2e-66
>prophage 11
AP017898	Sphingopyxis sp. FD7 DNA, complete genome	3695614	2990497	3004397	3695614	tail,terminase	Vibrio_phage(22.22%)	16	NA	NA
BBB13642.1|2990497_2991358_+|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	44.2	2.6e-47
BBB13643.1|2991341_2992940_+|terminase	phage terminase large subunit	terminase	Q775B9	Bordetella_phage	51.2	3.6e-151
BBB13644.1|2992936_2993101_+	acetamidase	NA	NA	NA	NA	NA
BBB13645.1|2993163_2993349_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13646.1|2993350_2994979_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	33.3	1.1e-75
BBB13647.1|2994975_2995287_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13648.1|2995255_2996134_+	hypothetical protein	NA	Q2A089	Sodalis_phage	29.3	2.7e-07
BBB13649.1|2996151_2997168_+	hypothetical protein	NA	A0A2I7QL96	Vibrio_phage	51.2	7.0e-92
BBB13650.1|2997221_2997668_+	hypothetical protein	NA	A0A2I7RHV3	Vibrio_phage	45.8	1.6e-24
BBB13651.1|2997669_2998167_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13652.1|2998269_2998902_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13653.1|2998901_2999549_+	hypothetical protein	NA	A0A1B1IW99	uncultured_Mediterranean_phage	33.3	8.6e-19
BBB13654.1|2999548_3001366_+	hypothetical protein	NA	A0A221SAL7	Ralstonia_phage	23.5	1.0e-24
BBB13655.1|3001358_3001823_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13656.1|3001815_3002310_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13657.1|3002309_3004397_+	hypothetical protein	NA	A0A097PAR3	Delftia_phage	27.5	1.9e-11
>prophage 12
AP017898	Sphingopyxis sp. FD7 DNA, complete genome	3695614	3229082	3273015	3695614	protease,integrase,tRNA,transposase	Orpheovirus(25.0%)	36	3220490:3220507	3283262:3283279
3220490:3220507	attL	GCGCGCCGAGGTTGCCGA	NA	NA	NA	NA
BBB13899.1|3229082_3231470_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
BBB13900.1|3231466_3232567_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	30.9	3.2e-26
BBB13901.1|3232704_3233607_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
BBB13902.1|3234030_3237297_-	DNA polymerase III subunit alpha	NA	R4TMT6	Streptomyces_phage	26.8	3.7e-78
BBB13903.1|3237293_3238844_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13904.1|3238734_3239535_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13905.1|3239796_3240432_-	glutathione S-transferase-like protein	NA	NA	NA	NA	NA
BBB13906.1|3240535_3241297_+	molybdopterin binding domain-containing protein	NA	NA	NA	NA	NA
BBB13907.1|3241269_3242547_-	major facilitator superfamily transporter	NA	NA	NA	NA	NA
BBB13908.1|3242954_3244157_+	cellulase	NA	NA	NA	NA	NA
BBB13909.1|3244180_3245170_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
BBB13910.1|3245357_3247865_+	beta-glucosidase	NA	NA	NA	NA	NA
BBB13911.1|3247887_3250515_+	putative TonB dependent receptor	NA	NA	NA	NA	NA
BBB13912.1|3250861_3251533_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13913.1|3251596_3251929_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13914.1|3252554_3253682_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
BBB13915.1|3254056_3255136_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
BBB13916.1|3255262_3256114_-	prepilin-type N-terminal cleavage/methylation domain protein	NA	NA	NA	NA	NA
BBB13917.1|3256088_3256343_-	glucitol operon activator protein GutM	NA	NA	NA	NA	NA
BBB13918.1|3256431_3256803_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13919.1|3256827_3257151_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13920.1|3257385_3258504_+	filamentation induced by cAMP protein Fic	NA	NA	NA	NA	NA
BBB13921.1|3258872_3259091_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13922.1|3259087_3259381_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13923.1|3259902_3261054_-|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
BBB13924.1|3261359_3261617_+	acid phosphatase	NA	NA	NA	NA	NA
BBB13925.1|3261694_3261898_-	hypothetical protein	NA	NA	NA	NA	NA
BBB13926.1|3262192_3264835_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13927.1|3265361_3265799_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13928.1|3265764_3267216_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13929.1|3267621_3268710_-|protease	type II transmembrane serine protease-1	protease	NA	NA	NA	NA
BBB13930.1|3268982_3270062_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
BBB13931.1|3270600_3270786_+	hypothetical protein	NA	NA	NA	NA	NA
BBB13932.1|3270789_3271707_+	cytosine-specific DNA-methyltransferase	NA	M4QPY5	Micromonas_pusilla_virus	44.5	1.7e-33
BBB13933.1|3271651_3272632_-	Fis family transcriptional regulator	NA	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	24.0	3.2e-09
BBB13934.1|3272628_3273015_-|transposase	transposase IS3/IS911	transposase	NA	NA	NA	NA
3283262:3283279	attR	TCGGCAACCTCGGCGCGC	NA	NA	NA	NA
>prophage 13
AP017898	Sphingopyxis sp. FD7 DNA, complete genome	3695614	3419328	3466258	3695614	integrase,transposase	Enterobacteria_phage(18.18%)	46	3430339:3430356	3468355:3468372
BBB14069.1|3419328_3420546_+|integrase	integrase catalytic subunit	integrase	U5N3F9	Enterobacteria_phage	32.8	2.3e-41
BBB14070.1|3420542_3421388_+	IstB ATP binding domain-containing protein	NA	U5N3V8	Enterobacteria_phage	51.4	2.6e-52
BBB14071.1|3421467_3421926_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14072.1|3422030_3422297_+|transposase	transposase IS3 family protein	transposase	NA	NA	NA	NA
BBB14073.1|3422290_3423202_+|transposase	transposase IS1477	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-45
BBB14074.1|3423231_3423630_-	glutaredoxin	NA	NA	NA	NA	NA
BBB14075.1|3423707_3424115_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
BBB14076.1|3424815_3426876_+	TonB-dependent receptor	NA	NA	NA	NA	NA
BBB14077.1|3427183_3428461_-	type II site-specific deoxyribonuclease	NA	NA	NA	NA	NA
BBB14078.1|3428646_3429276_-	cytochrome c family protein	NA	NA	NA	NA	NA
BBB14079.1|3429504_3429981_-	hypothetical protein	NA	NA	NA	NA	NA
BBB14080.1|3430033_3432355_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.2	3.7e-88
3430339:3430356	attL	CGGCGGCGGCGAGCGCGG	NA	NA	NA	NA
BBB14081.1|3432521_3433199_-	type 12 methyltransferase	NA	NA	NA	NA	NA
BBB14082.1|3433336_3434026_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
BBB14083.1|3434058_3435027_-	copper resistance D	NA	NA	NA	NA	NA
BBB14084.1|3435033_3435429_-	copper resistance protein CopC	NA	NA	NA	NA	NA
BBB14085.1|3435560_3435827_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14086.1|3435829_3436267_+	heavy metal resistance protein	NA	NA	NA	NA	NA
BBB14087.1|3436263_3436848_+	ECF subfamily RNA polymerase sigma-24 factor	NA	NA	NA	NA	NA
BBB14088.1|3437021_3438803_+	copper-resistance protein CopA	NA	NA	NA	NA	NA
BBB14089.1|3438799_3440011_+	copper resistance B	NA	NA	NA	NA	NA
BBB14090.1|3440049_3440493_+	conserved domain protein	NA	NA	NA	NA	NA
BBB14091.1|3440494_3441019_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14092.1|3441045_3441393_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14093.1|3441685_3444106_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.5	4.5e-12
BBB14094.1|3444142_3445048_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
BBB14095.1|3445103_3446174_+	extracellular solute-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	36.5	3.0e-53
BBB14096.1|3446170_3448363_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
BBB14097.1|3448352_3449600_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
BBB14098.1|3449596_3450349_+	general L-amino acid transport system ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	1.3e-31
BBB14099.1|3450634_3453340_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	7.2e-35
BBB14100.1|3453351_3454056_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14101.1|3454052_3454787_+	PepSY-associated TM helix family protein	NA	NA	NA	NA	NA
BBB14102.1|3454793_3455594_-	histidine utilization repressor	NA	NA	NA	NA	NA
BBB14103.1|3455657_3456983_-	hypothetical protein	NA	NA	NA	NA	NA
BBB14104.1|3457145_3457901_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	65.9	1.5e-75
BBB14105.1|3457906_3458971_-	arsenical-resistance protein	NA	NA	NA	NA	NA
BBB14106.1|3458980_3459409_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	53.6	2.0e-32
BBB14107.1|3459422_3459752_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
BBB14108.1|3459846_3460272_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14109.1|3460298_3461567_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
BBB14110.1|3461954_3463601_+	modification methylase	NA	O37396	Paramecium_bursaria_Chlorella_virus	30.9	5.4e-09
BBB14111.1|3463597_3463852_-	hypothetical protein	NA	NA	NA	NA	NA
BBB14112.1|3464095_3464917_+|transposase	transposase IS5 family protein	transposase	NA	NA	NA	NA
BBB14113.1|3464939_3465776_-	hypothetical protein	NA	NA	NA	NA	NA
BBB14114.1|3465979_3466258_+|transposase	transposase A	transposase	NA	NA	NA	NA
3468355:3468372	attR	CCGCGCTCGCCGCCGCCG	NA	NA	NA	NA
>prophage 1
AP017899	Sphingopyxis sp. FD7 plasmid pSFD01 DNA, complete sequence	242612	6875	53696	242612	transposase	Escherichia_phage(26.67%)	52	NA	NA
BBB14325.1|6875_7640_+|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	67.8	3.8e-90
BBB14326.1|7900_9823_+	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	27.8	3.7e-25
BBB14327.1|9855_10191_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14328.1|10206_10407_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14329.1|10420_10918_-	hypothetical protein	NA	NA	NA	NA	NA
BBB14330.1|10982_12269_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14331.1|12313_12949_+	hypothetical protein	NA	A0A1X9SH15	Bradyrhizobium_phage	39.6	2.4e-29
BBB14332.1|12945_14037_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14333.1|14149_15346_+	ATPase	NA	NA	NA	NA	NA
BBB14334.1|15320_16805_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14335.1|16746_18270_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14336.1|18269_19169_+	hypothetical protein	NA	G9BWC3	Planktothrix_phage	32.9	6.7e-22
BBB14337.1|19161_19533_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14338.1|19723_20068_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14339.1|20225_20726_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14340.1|20890_21388_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14341.1|21399_22083_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14342.1|22079_22391_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14343.1|22383_22641_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14344.1|22808_23309_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14345.1|23478_23754_+	TniB protein	NA	NA	NA	NA	NA
BBB14346.1|23850_24204_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14347.1|24145_24589_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14348.1|25047_25383_+	single-stranded DNA-binding protein	NA	A0A0S2SY36	Pseudomonas_phage	32.7	3.5e-08
BBB14349.1|25445_25712_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14350.1|25744_26773_-	hypothetical protein	NA	NA	NA	NA	NA
BBB14351.1|28133_28898_+|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	67.8	3.8e-90
BBB14352.1|29343_30522_-	acyl-CoA dehydrogenase domain protein	NA	NA	NA	NA	NA
BBB14353.1|30552_31410_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
BBB14354.1|31406_32171_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
BBB14355.1|32174_33446_-	4-hydroxyacetophenone monooxygenase	NA	NA	NA	NA	NA
BBB14356.1|33515_34163_-	flavin-binding monooxygenase-like family protein	NA	NA	NA	NA	NA
BBB14357.1|34464_37062_+	TonB-dependent receptor	NA	NA	NA	NA	NA
BBB14358.1|37137_39207_+	putative quinohemoprotein alcohol dehydrogenase	NA	NA	NA	NA	NA
BBB14359.1|39203_40616_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
BBB14360.1|40726_40912_-	transcriptional regulator TetR family	NA	NA	NA	NA	NA
BBB14361.1|40924_41167_-	transcriptional regulator TetR family	NA	NA	NA	NA	NA
BBB14362.1|41264_42245_-	Fis family transcriptional regulator	NA	Q6J1X2	Lactobacillus_phage	28.1	7.9e-08
BBB14363.1|42241_42631_-|transposase	transposase IS3/IS911	transposase	NA	NA	NA	NA
BBB14364.1|42683_43616_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	55.6	9.6e-88
BBB14365.1|43655_44420_-|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	67.8	3.8e-90
BBB14366.1|44602_45625_+	putative fatty-acid-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.2	9.0e-31
BBB14367.1|45621_46422_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14368.1|46418_47345_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14369.1|47348_48125_+	cyclase protein	NA	NA	NA	NA	NA
BBB14370.1|48139_48805_-	hypothetical protein	NA	NA	NA	NA	NA
BBB14371.1|48815_49592_-	3-oxoacyl-(acyl-carrier-protein) reductase	NA	W8CYX9	Bacillus_phage	37.0	2.3e-10
BBB14372.1|49724_50054_+	cyclohexanone monooxygenase	NA	NA	NA	NA	NA
BBB14373.1|50141_50912_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	34.9	6.8e-31
BBB14374.1|50901_51828_-|transposase	transposase	transposase	U5N3F9	Enterobacteria_phage	28.7	3.7e-07
BBB14375.1|51892_52897_+|transposase	transposase	transposase	A0A1S7J231	Thermus_phage	27.9	6.6e-10
BBB14376.1|53120_53696_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	25.7	5.5e-09
>prophage 2
AP017899	Sphingopyxis sp. FD7 plasmid pSFD01 DNA, complete sequence	242612	94786	186390	242612	transposase,protease,integrase	Enterobacteria_phage(20.0%)	82	117083:117097	167590:167606
BBB14415.1|94786_95557_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	34.9	6.8e-31
BBB14416.1|95546_96473_-|transposase	transposase	transposase	U5N3F9	Enterobacteria_phage	28.7	3.7e-07
BBB14417.1|96537_97542_+|transposase	transposase	transposase	A0A1S7J231	Thermus_phage	27.9	6.6e-10
BBB14418.1|97765_98341_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	25.7	5.5e-09
BBB14419.1|98475_98760_-	hypothetical protein	NA	NA	NA	NA	NA
BBB14420.1|98850_100344_+	methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
BBB14421.1|100366_100786_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
BBB14422.1|101166_102153_-	cre recombinase protein	NA	NA	NA	NA	NA
BBB14423.1|102465_102984_-	deoxyribonuclease I	NA	NA	NA	NA	NA
BBB14424.1|103270_104098_-	replication protein B	NA	NA	NA	NA	NA
BBB14425.1|104337_105540_-	replication protein A	NA	A0A1I9KF58	Aeromonas_phage	34.7	3.4e-45
BBB14426.1|105709_106861_-	replication initiator protein	NA	NA	NA	NA	NA
BBB14427.1|107502_107769_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14428.1|107883_112101_+	hypothetical protein	NA	V5LQJ6	Emiliania_huxleyi_virus	23.5	4.1e-21
BBB14429.1|112181_112481_+	plasmid maintenance system killer protein	NA	NA	NA	NA	NA
BBB14430.1|112480_112783_+	XRE family plasmid maintenance system antidote protein	NA	NA	NA	NA	NA
BBB14431.1|113011_113647_+|integrase	integrase family protein	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	35.1	1.7e-11
BBB14432.1|115064_117158_+	putative transcriptional regulator	NA	G8DH78	Emiliania_huxleyi_virus	25.8	3.9e-28
117083:117097	attL	CGACAGCGAGGCCGA	NA	NA	NA	NA
BBB14433.1|117241_118192_+	antirestriction protein	NA	A0A1V0EEV1	Caulobacter_phage	46.8	3.0e-68
117083:117097	attL	CGACAGCGAGGCCGA	NA	NA	NA	NA
BBB14434.1|118160_118553_+	glutamate synthase	NA	NA	NA	NA	NA
BBB14435.1|118600_119242_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14436.1|119254_119878_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14437.1|119894_120095_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14438.1|120189_120444_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14439.1|120440_120707_+	addiction module toxin	NA	NA	NA	NA	NA
BBB14440.1|120721_121063_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14441.1|121086_121584_-	hypothetical protein	NA	NA	NA	NA	NA
BBB14442.1|121651_122938_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14443.1|123078_123621_+	hypothetical protein	NA	A0A1X9SH15	Bradyrhizobium_phage	35.8	2.2e-20
BBB14444.1|123723_124248_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14445.1|124273_125119_-	IstB ATP binding domain-containing protein	NA	U5N3V8	Enterobacteria_phage	51.4	2.6e-52
BBB14446.1|125115_126333_-|integrase	integrase catalytic subunit	integrase	U5N3F9	Enterobacteria_phage	32.8	2.3e-41
BBB14447.1|126445_127708_+	hypothetical protein	NA	NA	NA	NA	NA
127480:127494	attR	CGACAGCGAGGCCGA	NA	NA	NA	NA
BBB14448.1|127767_128094_+	hypothetical protein	NA	NA	NA	NA	NA
127480:127494	attR	CGACAGCGAGGCCGA	NA	NA	NA	NA
BBB14449.1|128482_129634_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB14450.1|129863_130214_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14451.1|130417_130918_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14452.1|131105_131621_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14453.1|131614_131986_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14454.1|132061_132364_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14455.1|132344_132722_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14456.1|133075_133555_+	single-stranded DNA-binding protein	NA	A0A0S2SY36	Pseudomonas_phage	31.8	7.3e-07
BBB14457.1|133999_134206_-	hypothetical protein	NA	NA	NA	NA	NA
BBB14458.1|134429_134825_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
BBB14459.1|135210_135972_-	transcriptional regulator LuxR family	NA	NA	NA	NA	NA
BBB14460.1|136286_138845_-	prolyl oligopeptidase family protein	NA	NA	NA	NA	NA
BBB14461.1|139026_139512_-	hypothetical protein	NA	NA	NA	NA	NA
BBB14462.1|140223_141216_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14463.1|141555_142122_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14464.1|142552_142804_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14465.1|142851_143076_-	hypothetical protein	NA	NA	NA	NA	NA
BBB14466.1|143625_143919_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14467.1|143911_146308_+	type IV secretory pathway	NA	NA	NA	NA	NA
BBB14468.1|146401_149425_+	conjugative relaxase domain protein	NA	NA	NA	NA	NA
BBB14469.1|149435_149867_+|protease	trypsin-like protein serine protease	protease	NA	NA	NA	NA
BBB14470.1|149856_150066_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14471.1|150121_150271_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14472.1|150893_151193_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
BBB14473.1|151194_152553_+	transcriptional regulator	NA	NA	NA	NA	NA
BBB14474.1|152552_153065_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14475.1|153149_154883_+	DNA (Cytosine-5-)-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	30.6	3.1e-39
BBB14476.1|154884_157551_+	type III restriction enzyme	NA	NA	NA	NA	NA
BBB14477.1|157963_160612_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14478.1|160611_163803_+	ATP-dependent exodeoxyribonuclease subunit A	NA	A7KV33	Bacillus_phage	46.7	1.6e-01
BBB14479.1|163834_164683_-|integrase	integrase	integrase	S5WIU1	Leptospira_phage	38.4	4.8e-38
BBB14480.1|164727_165006_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB14481.1|165208_165994_-	SDR-family protein	NA	NA	NA	NA	NA
BBB14482.1|165990_166542_-	resolvase	NA	A0A1S6L009	Salmonella_phage	56.6	3.5e-45
BBB14483.1|166681_169639_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	43.9	2.2e-234
BBB14484.1|169733_170849_+|transposase	transposase	transposase	NA	NA	NA	NA
BBB14485.1|171712_172825_+	FAD-dependent pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
BBB14486.1|172839_173049_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14487.1|173049_173655_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
BBB14488.1|173654_173846_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14489.1|173903_176057_+	pyridine nucleotide-disulfide oxidoreductase dimerisation subunit	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	7.0e-41
BBB14490.1|176669_177095_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14491.1|177091_177478_-	hypothetical protein	NA	NA	NA	NA	NA
BBB14492.1|177640_180676_+	TonB-dependent receptor	NA	NA	NA	NA	NA
BBB14493.1|180691_181957_+	Na+ dependent nucleoside transporter-like protein	NA	NA	NA	NA	NA
BBB14494.1|181961_182582_+	CDP-alcohol phosphatidyltransferase	NA	NA	NA	NA	NA
BBB14495.1|182583_183189_+	hypothetical protein	NA	NA	NA	NA	NA
BBB14496.1|183384_186390_-|transposase	transposase Tn3 family protein	transposase	Q1MVP5	Enterobacteria_phage	46.9	4.5e-256
