The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031933	Lactobacillus sp. HBUAS52074 chromosome, complete genome	2714974	1500606	1505863	2714974		Lactobacillus_phage(50.0%)	8	NA	NA
AYE38421.1|1500606_1501071_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	53.9	2.2e-40
AYE38422.1|1501074_1501803_-	phage antirepressor Ant	NA	A9D9L9	Lactobacillus_prophage	49.2	5.0e-60
AYE38423.1|1501909_1502344_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	38.5	2.7e-16
AYE38424.1|1502340_1502661_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38425.1|1502674_1503454_-	AAA family ATPase	NA	E9LUM7	Lactobacillus_phage	29.5	4.6e-19
AYE38426.1|1503465_1504221_-	DnaD domain protein	NA	NA	NA	NA	NA
AYE38427.1|1504233_1505076_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	49.6	2.4e-66
AYE38428.1|1505014_1505863_-	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	53.0	1.1e-58
>prophage 2
CP031933	Lactobacillus sp. HBUAS52074 chromosome, complete genome	2714974	1553507	1563507	2714974		Prochlorococcus_phage(33.33%)	10	NA	NA
AYE38471.1|1553507_1555049_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	45.8	1.8e-70
AYE38472.1|1555045_1555630_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.1	1.8e-31
AYE38473.1|1555626_1556646_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.6	4.3e-65
AYE38474.1|1556657_1558064_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	29.3	1.3e-48
AYE38475.1|1558048_1560259_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	1.6e-141
AYE38476.1|1560258_1560933_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYE38477.1|1560932_1561181_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYE39493.1|1561190_1561898_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
AYE38478.1|1561901_1563032_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AYE38479.1|1563024_1563507_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.9	2.6e-20
>prophage 3
CP031933	Lactobacillus sp. HBUAS52074 chromosome, complete genome	2714974	1797452	1866159	2714974	head,terminase,integrase,holin,protease,tail,portal,capsid	Lactobacillus_phage(44.12%)	77	1794512:1794531	1843216:1843235
1794512:1794531	attL	GTAGCAATTTTTGCCATTGG	NA	NA	NA	NA
AYE38675.1|1797452_1797887_-|holin	holin	holin	A0A097BY69	Enterococcus_phage	36.7	2.4e-17
AYE38676.1|1797925_1798066_-	XkdX family protein	NA	NA	NA	NA	NA
AYE38677.1|1798133_1798415_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38678.1|1798446_1798935_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38679.1|1798947_1800159_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38680.1|1800148_1801174_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38681.1|1801174_1801831_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38682.1|1801835_1802162_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38683.1|1802161_1803082_-	hypothetical protein	NA	A0A0M7RDS2	Lactobacillus_phage	33.1	4.5e-13
AYE38684.1|1803074_1804388_-	hypothetical protein	NA	A0A059T5E5	Listeria_phage	30.1	1.2e-19
AYE38685.1|1804384_1805242_-|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	27.8	3.5e-20
AYE38686.1|1805234_1810310_-|tail	phage tail tape measure protein	tail	Q9AZS0	Lactococcus_phage	40.0	1.6e-115
AYE38687.1|1810540_1810954_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38688.1|1810977_1811613_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38689.1|1811613_1811979_-	DUF806 family protein	NA	NA	NA	NA	NA
AYE38690.1|1811980_1812415_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38691.1|1812401_1812755_-|head,tail	head-tail adaptor protein	head,tail	F8J1B7	Lactobacillus_phage	32.2	2.0e-09
AYE38692.1|1812732_1813086_-|head,tail	phage gp6-like head-tail connector protein	head,tail	F8HGT2	Streptococcus_phage	44.2	6.7e-10
AYE38693.1|1813088_1814324_-|capsid	phage major capsid protein	capsid	B4XYP6	Lactobacillus_phage	44.0	6.1e-82
AYE38694.1|1814292_1814967_-|head,protease	HK97 family phage prohead protease	head,protease	B8R651	Lactobacillus_phage	46.7	8.9e-35
AYE38695.1|1814881_1815916_-|portal	phage portal protein	portal	A0A286QMI7	Streptococcus_phage	38.6	3.9e-58
AYE38696.1|1816111_1816306_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38697.1|1816318_1818193_-|terminase	terminase large subunit	terminase	A0A286QQH3	Streptococcus_phage	49.9	3.9e-165
AYE38698.1|1818196_1818685_-|terminase	phage terminase small subunit P27 family	terminase	E3W8E9	Leuconostoc_phage	34.4	1.4e-10
AYE38699.1|1818781_1819291_-	HNH endonuclease	NA	A0A2I6QQZ5	Streptococcus_phage	40.9	2.6e-23
AYE38700.1|1820121_1820574_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38701.1|1820657_1820852_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38702.1|1820863_1821085_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38703.1|1821077_1821455_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38704.1|1821447_1821927_-	DUF1642 domain-containing protein	NA	NA	NA	NA	NA
AYE38705.1|1821939_1822404_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38706.1|1822407_1822833_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38707.1|1822829_1823297_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38708.1|1823362_1823701_-	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	64.8	6.2e-37
AYE38709.1|1823941_1825201_-	helicase	NA	A0A0A1EL11	Lactobacillus_phage	57.8	5.9e-133
AYE38710.1|1825197_1825995_-	DNA primase	NA	A0A2P0ZLB0	Lactobacillus_phage	55.6	2.9e-77
AYE38711.1|1826064_1826571_-	DUF669 domain-containing protein	NA	A0A1B0Y6E2	Lactobacillus_phage	40.8	2.8e-33
AYE38712.1|1826573_1827338_-	NTP-binding protein	NA	A0A1B0YEB5	Lactobacillus_phage	62.1	6.4e-82
AYE38713.1|1827334_1828588_-	DEAD/DEAH box helicase	NA	A0A0A1ENT0	Lactobacillus_phage	64.3	2.8e-151
AYE38714.1|1828709_1829189_-	hypothetical protein	NA	R4IBM0	Listeria_phage	46.5	1.1e-26
AYE38715.1|1829167_1829512_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38716.1|1829756_1830011_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38717.1|1830174_1830375_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38718.1|1830540_1830801_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38719.1|1830862_1831063_+	hypothetical protein	NA	NA	NA	NA	NA
AYE38720.1|1831031_1831262_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38721.1|1831298_1832093_-	hypothetical protein	NA	Q9T1J2	Lactobacillus_phage	69.0	8.8e-50
AYE38722.1|1832111_1832315_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYE38723.1|1832374_1832827_+	hypothetical protein	NA	NA	NA	NA	NA
AYE38724.1|1832929_1833238_+	hypothetical protein	NA	NA	NA	NA	NA
AYE38725.1|1833218_1833473_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38726.1|1833728_1834064_+	XRE family transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	48.6	1.0e-23
AYE38727.1|1834067_1834466_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	37.0	4.2e-16
AYE38728.1|1834527_1835196_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AYE38729.1|1835452_1836073_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38730.1|1836211_1837405_+|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	37.8	5.6e-56
AYE38731.1|1838986_1839574_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	51.0	2.5e-49
AYE38732.1|1839993_1840767_-	ABC transporter permease	NA	NA	NA	NA	NA
AYE38733.1|1840785_1841721_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	5.7e-24
AYE38734.1|1841796_1842381_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYE38735.1|1842960_1844352_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
1843216:1843235	attR	GTAGCAATTTTTGCCATTGG	NA	NA	NA	NA
AYE38736.1|1844739_1846461_+	hypothetical protein	NA	NA	NA	NA	NA
AYE38737.1|1846593_1847523_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	36.8	6.0e-50
AYE38738.1|1847522_1848557_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	53.1	3.2e-92
AYE38739.1|1848543_1849458_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.3	7.9e-10
AYE38740.1|1850075_1852100_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AYE38741.1|1852152_1855011_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	2.9e-308
AYE38742.1|1855013_1857023_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
AYE38743.1|1857167_1858412_-	MFS transporter	NA	NA	NA	NA	NA
AYE38744.1|1858427_1859717_-	alkaline phosphatase family protein	NA	A0A1V0QG10	Shearwaterpox_virus	23.3	4.1e-12
AYE38745.1|1860108_1861827_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	51.0	2.4e-169
AYE38746.1|1861962_1862214_-	XRE family transcriptional regulator	NA	G3MBD2	Bacillus_virus	50.0	8.4e-07
AYE38747.1|1862398_1863340_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.5	1.0e-81
AYE38748.1|1863404_1864220_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AYE38749.1|1864219_1865179_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AYE38750.1|1865144_1865336_-	hypothetical protein	NA	NA	NA	NA	NA
AYE38751.1|1865793_1866159_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 4
CP031933	Lactobacillus sp. HBUAS52074 chromosome, complete genome	2714974	2667215	2673891	2714974		Enterococcus_phage(50.0%)	8	NA	NA
AYE39531.1|2667215_2667779_-	NlpC/P60 family protein	NA	A0A0A8WIF2	Clostridium_phage	40.9	2.0e-16
AYE39405.1|2668136_2668694_-	guanylate kinase	NA	A0A212Q4J6	Cowpox_virus	33.1	5.7e-11
AYE39406.1|2668778_2668988_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AYE39407.1|2669189_2669816_-	hypothetical protein	NA	NA	NA	NA	NA
AYE39408.1|2670085_2670316_+	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	43.4	8.8e-11
AYE39409.1|2670317_2670692_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	35.0	1.3e-11
AYE39410.1|2670672_2672850_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	59.4	1.6e-250
AYE39411.1|2672865_2673891_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	66.1	1.2e-120
