The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022963	Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal chromosome, complete genome	4728875	503048	564998	4728875	portal,integrase,holin,plate,head,lysis,capsid,terminase,tRNA,tail	Escherichia_phage(57.5%)	71	536264:536306	565863:565905
AYE21910.1|503048_503486_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AYE21911.1|503482_504472_+	acetyltransferase	NA	NA	NA	NA	NA
AYE21912.1|504486_504933_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
AYE21913.1|504929_505241_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
AYE21914.1|505326_506256_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYE21915.1|506473_506785_+	toxin HigB-2	NA	NA	NA	NA	NA
AYE25666.1|506821_507076_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE21916.1|507122_508052_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AYE21917.1|508048_508681_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
AYE21918.1|508677_509580_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
AYE21919.1|509592_512643_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	2.7e-06
AYE21920.1|512837_513674_+	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AYE21921.1|515144_516245_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AYE21922.1|516600_516924_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
AYE21923.1|516923_517583_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYE25667.1|517665_518232_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYE21924.1|518320_518635_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AYE21925.1|518631_519780_-	lactaldehyde reductase	NA	NA	NA	NA	NA
AYE21926.1|519906_520734_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
AYE21927.1|520876_522136_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
AYE21928.1|522132_523602_-	rhamnulokinase	NA	NA	NA	NA	NA
AYE21929.1|523889_524726_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
AYE21930.1|524878_525727_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
AYE21931.1|525723_526758_-	rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
AYE21932.1|527376_528060_+	hypothetical protein	NA	NA	NA	NA	NA
AYE21933.1|528217_529525_-	TRAP transporter large permease	NA	NA	NA	NA	NA
AYE21934.1|529517_530033_-	TRAP transporter small permease	NA	NA	NA	NA	NA
AYE21935.1|530051_531035_-	hypothetical protein	NA	NA	NA	NA	NA
AYE21936.1|531363_531984_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.4	7.1e-63
AYE21937.1|531990_532743_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYE21938.1|532754_533150_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AYE21939.1|533270_533474_+	hypothetical protein	NA	NA	NA	NA	NA
AYE21940.1|533521_534895_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
AYE21941.1|534891_535590_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AYE21942.1|535740_536241_+	stress adaptor protein CpxP	NA	NA	NA	NA	NA
536264:536306	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGTTTTTTTT	NA	NA	NA	NA
AYE21943.1|536426_537407_-|integrase	integrase	integrase	S4TP66	Salmonella_phage	99.7	8.0e-186
AYE21944.1|537476_537770_-	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	99.0	1.0e-48
AYE21945.1|537906_538179_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AYE21946.1|538348_538849_+	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AYE21947.1|538912_539137_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AYE21948.1|539438_539663_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	6.5e-35
AYE21949.1|539659_539935_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.9e-44
AYE21950.1|539924_542201_+	replication protein A	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
AYE21951.1|543283_544318_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	4.2e-201
AYE21952.1|544317_546090_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
AYE21953.1|546263_547118_+|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
AYE21954.1|547172_548246_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	1.1e-201
AYE21955.1|548249_548993_+|terminase	terminase	terminase	A0A0F7LBP7	Escherichia_phage	98.8	1.7e-124
AYE21956.1|549091_549601_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AYE21957.1|549600_549804_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AYE21958.1|549807_550089_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AYE21959.1|550088_550586_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AYE21960.1|550600_551026_+	protein lysA	NA	A0A0F7LDU9	Escherichia_phage	98.6	3.5e-61
AYE21961.1|551013_551439_+	protein lysB	NA	Q7Y4E2	Escherichia_virus	95.7	6.1e-66
AYE21962.1|551410_551584_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AYE21963.1|551546_552014_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
AYE21964.1|552006_552459_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
AYE21965.1|552525_553161_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	97.6	1.6e-110
AYE21966.1|553157_553505_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AYE21967.1|553509_554418_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
AYE21968.1|554410_555022_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.4e-116
AYE21969.1|555018_556203_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	78.5	1.0e-163
AYE21970.1|557741_558335_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
AYE21971.1|558394_559585_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
AYE21972.1|559597_560116_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AYE21973.1|560173_560449_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AYE25668.1|560481_560601_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AYE21974.1|560593_563041_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.4	0.0e+00
AYE21975.1|563055_563535_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	98.1	4.3e-84
AYE21976.1|563534_564698_+	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.0	4.1e-205
AYE21977.1|564743_564998_+	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
565863:565905	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGTTTTTTTT	NA	NA	NA	NA
>prophage 2
CP022963	Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal chromosome, complete genome	4728875	1840503	1849674	4728875	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYE23028.1|1840503_1841451_+	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	1.6e-10
AYE23029.1|1841434_1842166_+	ABC transporter permease	NA	NA	NA	NA	NA
AYE23030.1|1842146_1842254_-	hypothetical protein	NA	NA	NA	NA	NA
AYE23031.1|1842313_1843045_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	1.3e-100
AYE23032.1|1843267_1844953_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
AYE23033.1|1844949_1845669_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AYE23034.1|1845715_1846183_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
AYE23035.1|1846239_1846770_-	lipoprotein	NA	NA	NA	NA	NA
AYE23036.1|1846941_1847400_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
AYE23037.1|1847640_1849674_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	1.0e-54
>prophage 3
CP022963	Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal chromosome, complete genome	4728875	1916871	1927378	4728875		Enterobacteria_phage(37.5%)	10	NA	NA
AYE23086.1|1916871_1918275_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
AYE23087.1|1918452_1919346_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYE23088.1|1919722_1920808_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYE23089.1|1920807_1921707_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AYE23090.1|1921754_1922633_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AYE23091.1|1922633_1923185_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AYE23092.1|1923190_1924165_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AYE23093.1|1924180_1924954_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYE23094.1|1924958_1926038_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
AYE23095.1|1926064_1927378_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
CP022963	Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal chromosome, complete genome	4728875	2570212	2577146	4728875	integrase,tRNA	Escherichia_phage(33.33%)	10	2566101:2566113	2572559:2572571
2566101:2566113	attL	AAAAGCGAAAATG	NA	NA	NA	NA
AYE23684.1|2570212_2570647_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	1.2e-29
AYE23685.1|2570696_2571035_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AYE23686.1|2571027_2571180_-	multidrug transporter	NA	NA	NA	NA	NA
AYE23687.1|2571147_2571339_+|integrase	integrase	integrase	A0A0U2JGI6	Escherichia_phage	96.8	1.6e-29
AYE23688.1|2571390_2572326_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
AYE23689.1|2572369_2573743_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.6e-51
2572559:2572571	attR	CATTTTCGCTTTT	NA	NA	NA	NA
AYE23690.1|2574244_2575399_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.7	1.5e-10
AYE23691.1|2575649_2575829_-	hypothetical protein	NA	NA	NA	NA	NA
AYE23692.1|2575809_2576373_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AYE23693.1|2576630_2577146_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	6.6e-22
>prophage 5
CP022963	Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal chromosome, complete genome	4728875	2730218	2829696	4728875	portal,protease,integrase,holin,lysis,tRNA,tail	Enterobacteria_phage(28.0%)	106	2782291:2782320	2829832:2829861
AYE23833.1|2730218_2730914_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYE23834.1|2730971_2732882_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.4	1.1e-90
AYE23835.1|2733012_2733357_+	RidA family protein	NA	NA	NA	NA	NA
AYE23836.1|2733362_2733542_-	YoaH family protein	NA	NA	NA	NA	NA
AYE23837.1|2733622_2734987_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.5	3.6e-43
AYE23838.1|2734990_2735569_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AYE23839.1|2735832_2737197_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYE23840.1|2737334_2738936_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYE23841.1|2738957_2740517_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
AYE23842.1|2740504_2740840_-	hypothetical protein	NA	NA	NA	NA	NA
AYE23843.1|2740989_2741958_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYE23844.1|2742010_2742811_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYE23845.1|2742823_2743675_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AYE25748.1|2744547_2745168_+	hypothetical protein	NA	NA	NA	NA	NA
AYE23846.1|2745164_2745974_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AYE23847.1|2746039_2747785_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AYE23848.1|2748004_2748214_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AYE23849.1|2748226_2748370_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AYE23850.1|2749018_2749306_-	hypothetical protein	NA	NA	NA	NA	NA
AYE23851.1|2749376_2749520_-	PhoP regulon feedback inhibition membrane protein MgrB	NA	NA	NA	NA	NA
AYE23852.1|2749677_2749917_+	hypothetical protein	NA	NA	NA	NA	NA
AYE23853.1|2750128_2750920_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYE23854.1|2751095_2752469_+	MFS transporter	NA	NA	NA	NA	NA
AYE23855.1|2752516_2753398_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYE23856.1|2753590_2755639_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AYE23857.1|2755658_2756345_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYE23858.1|2756442_2757027_-	Free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AYE23859.1|2757068_2758352_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYE23860.1|2758320_2760954_+	MCE family protein	NA	NA	NA	NA	NA
AYE25749.1|2761031_2762471_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AYE23861.1|2762585_2762825_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AYE23862.1|2762935_2763127_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AYE23863.1|2763145_2763796_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
AYE23864.1|2764019_2764184_-	hypothetical protein	NA	NA	NA	NA	NA
AYE23865.1|2764469_2765192_-	guanine nucleotide exchange factor sopE2	NA	NA	NA	NA	NA
AYE23866.1|2765875_2766271_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
AYE23867.1|2766600_2767077_+	hypothetical protein	NA	NA	NA	NA	NA
AYE23868.1|2767448_2767868_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYE23869.1|2767999_2768194_-	hypothetical protein	NA	NA	NA	NA	NA
AYE23870.1|2768240_2768510_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
AYE23871.1|2768675_2768816_+	hypothetical protein	NA	NA	NA	NA	NA
AYE25750.1|2771136_2771337_-	hypothetical protein	NA	NA	NA	NA	NA
AYE23872.1|2771954_2772869_+	protein PagO	NA	NA	NA	NA	NA
AYE23873.1|2773001_2773160_+	hypothetical protein	NA	NA	NA	NA	NA
AYE23874.1|2773169_2773784_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AYE23875.1|2774536_2774803_-	hypothetical protein	NA	NA	NA	NA	NA
AYE23876.1|2774931_2775057_-	arsenic transporter	NA	NA	NA	NA	NA
AYE23877.1|2775625_2775826_+	phage virulence factor	NA	NA	NA	NA	NA
AYE23878.1|2778527_2779019_-	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	55.6	3.5e-41
AYE23879.1|2779073_2779262_+	hypothetical protein	NA	NA	NA	NA	NA
AYE23880.1|2779326_2779494_+	lytic enzyme	NA	NA	NA	NA	NA
AYE23881.1|2780336_2780624_-	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	9.9e-28
AYE23882.1|2780756_2781251_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	4.8e-22
2782291:2782320	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AYE23883.1|2783108_2783909_+	hypothetical protein	NA	NA	NA	NA	NA
AYE23884.1|2784388_2785111_+	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AYE23885.1|2785312_2785882_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	91.0	1.5e-96
AYE23886.1|2788132_2788375_-	hypothetical protein	NA	NA	NA	NA	NA
AYE23887.1|2788413_2789277_-|tail	phage tail protein	tail	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
AYE23888.1|2791836_2792541_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
AYE23889.1|2792444_2793176_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	1.0e-113
AYE23890.1|2793185_2793881_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AYE23891.1|2793970_2794504_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AYE23892.1|2794620_2795118_-	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
AYE23893.1|2795216_2795549_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
AYE25751.1|2795545_2798533_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	1.7e-266
AYE23894.1|2798612_2798942_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AYE23895.1|2798938_2799337_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.1	7.3e-29
AYE23896.1|2799382_2800132_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.2	3.1e-89
AYE23897.1|2800143_2800545_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.2	5.8e-42
AYE23898.1|2800541_2801108_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
AYE23899.1|2801088_2801388_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AYE23900.1|2801380_2801704_-	recombinase RecA	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AYE25753.1|2801794_2803876_-	peptidase S14	NA	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AYE25752.1|2803799_2805317_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.5	7.1e-173
AYE23901.1|2805343_2805550_-	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AYE23902.1|2805546_2807685_-	DNA packaging protein	NA	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AYE23903.1|2807641_2808175_-	DNA breaking-rejoining protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
AYE25755.1|2808382_2808862_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AYE23904.1|2808879_2809332_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AYE25754.1|2809315_2809645_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AYE23905.1|2809920_2810607_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AYE23906.1|2810967_2811417_+	hypothetical protein	NA	NA	NA	NA	NA
AYE25756.1|2811790_2812315_-	hypothetical protein	NA	NA	NA	NA	NA
AYE23907.1|2812411_2813101_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AYE23908.1|2813230_2813458_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AYE23909.1|2813454_2814054_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
AYE23910.1|2814117_2814423_-	hypothetical protein	NA	NA	NA	NA	NA
AYE23911.1|2814845_2815037_+	hypothetical protein	NA	NA	NA	NA	NA
AYE23912.1|2815054_2817034_-	hypothetical protein	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
AYE23913.1|2817430_2818561_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AYE23914.1|2818847_2819243_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
AYE23915.1|2819255_2819717_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.5	3.5e-67
AYE23916.1|2819709_2820708_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.1e-121
AYE23917.1|2820754_2821249_-	hypothetical protein	NA	NA	NA	NA	NA
AYE23918.1|2821235_2821490_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AYE23919.1|2821588_2821987_+	transcriptional regulator	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
AYE23920.1|2822389_2822656_+	hypothetical protein	NA	NA	NA	NA	NA
AYE23921.1|2822993_2823269_+	hypothetical protein	NA	NA	NA	NA	NA
AYE23922.1|2823272_2823479_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AYE23923.1|2823554_2823890_+	hypothetical protein	NA	NA	NA	NA	NA
AYE23924.1|2824030_2826721_+	exonuclease VIII	NA	Q9QF34	Lambdoid_phage	72.8	4.0e-118
AYE23925.1|2826713_2827544_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	1.1e-103
AYE23926.1|2827590_2827776_+	hypothetical protein	NA	NA	NA	NA	NA
AYE25757.1|2828066_2828303_+	hypothetical protein	NA	NA	NA	NA	NA
AYE23927.1|2828363_2828642_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
AYE23928.1|2828616_2829696_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2829832:2829861	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 6
CP022963	Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal chromosome, complete genome	4728875	3723181	3767558	4728875	portal,protease,integrase,coat,lysis,terminase,tail	Enterobacteria_phage(77.61%)	68	3723615:3723660	3765005:3765050
AYE24721.1|3723181_3723451_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	63.8	1.4e-20
3723615:3723660	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AYE24722.1|3723948_3724311_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AYE24723.1|3724307_3725240_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
AYE24724.1|3725229_3726687_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
AYE24725.1|3726745_3728749_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	99.9	0.0e+00
AYE24726.1|3728884_3729133_+	toxin-antitoxin system HicB family antitoxin	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
AYE24727.1|3729153_3729453_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	5.1e-51
AYE24728.1|3729585_3731562_-	DNA transfer protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
AYE24729.1|3731561_3732998_-	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
AYE24730.1|3733008_3733698_-	DNA transfer protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
AYE24731.1|3733700_3734156_-	hypothetical protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
AYE24732.1|3734155_3734857_-|tail	phage tail protein	tail	Q76H17	Enterobacteria_phage	100.0	1.7e-76
AYE24733.1|3734860_3736279_-	hypothetical protein	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
AYE24734.1|3736238_3736739_-	hypothetical protein	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
AYE24735.1|3736722_3737283_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
AYE24736.1|3737323_3738616_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
AYE24737.1|3738615_3739527_-	scaffolding protein	NA	Q76H22	Enterobacteria_phage	100.0	1.5e-162
AYE24738.1|3739540_3741718_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	99.9	0.0e+00
AYE24739.1|3741717_3743217_-|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
AYE24740.1|3743194_3743683_-	DNA-packaging protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
AYE24741.1|3743686_3744091_-	Decoration protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
AYE24742.1|3744090_3744480_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
AYE24743.1|3744483_3744726_-	hypothetical protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
AYE24744.1|3744948_3745479_-	hypothetical protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
AYE24745.1|3745432_3745657_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	88.7	3.6e-25
AYE24746.1|3745691_3746159_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
AYE25791.1|3746155_3746653_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
AYE24747.1|3746630_3746834_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
AYE24748.1|3746918_3747152_-	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	87.0	1.1e-21
AYE24749.1|3747264_3748038_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
AYE24750.1|3748034_3748214_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
AYE24751.1|3748194_3748398_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
AYE24752.1|3748394_3748619_-	protein ninY	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
AYE24753.1|3748615_3749227_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
AYE24754.1|3749219_3749396_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
AYE24755.1|3749388_3749730_-	protein ninX	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
AYE24756.1|3749732_3749909_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
AYE24757.1|3749875_3750049_-	protein ninD	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
AYE24758.1|3750045_3750501_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.7e-80
AYE24759.1|3750556_3750826_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
AYE24760.1|3750822_3752199_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
AYE24761.1|3752195_3753017_-	replication of DNA	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
AYE24762.1|3753199_3753481_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AYE24763.1|3753591_3753807_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
AYE24764.1|3753917_3754607_+	hypothetical protein	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
AYE24765.1|3754771_3755851_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
AYE24766.1|3755889_3756093_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
AYE24767.1|3756456_3756759_+	regulator	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
AYE24768.1|3756771_3757359_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
AYE24769.1|3757572_3757767_+	restriction endonuclease	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
AYE24770.1|3757850_3758495_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	6.5e-51
AYE24771.1|3758528_3758816_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
AYE24772.1|3759091_3759406_+	superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
AYE24773.1|3759490_3759649_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
AYE24774.1|3759629_3759818_+	protein kil	NA	I6S647	Salmonella_phage	100.0	3.7e-31
AYE24775.1|3759947_3760655_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
AYE24776.1|3760654_3760939_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AYE24777.1|3760985_3761279_+	RecBCD nuclease inhibitor	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
AYE24778.1|3761289_3761460_+	DUF2737 domain-containing protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
AYE24779.1|3761456_3761966_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
AYE24780.1|3761962_3762196_+	hypothetical protein	NA	NA	NA	NA	NA
AYE24781.1|3762182_3762827_+	hypothetical protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
AYE24782.1|3762826_3763111_+	DUF4752 domain-containing protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
AYE24783.1|3763103_3763388_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
AYE24784.1|3763599_3763950_+	DNA-binding protein	NA	Q76H29	Enterobacteria_phage	100.0	3.7e-61
AYE25792.1|3764321_3764990_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	100.0	8.0e-129
AYE24785.1|3765195_3766443_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.9	5.5e-99
3765005:3765050	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AYE24786.1|3766454_3767558_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
>prophage 1
CP022964	Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence	67685	0	2430	67685		Salmonella_phage(100.0%)	5	NA	NA
AYE25828.1|242_710_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	63.9	2.7e-38
AYE25829.1|817_1069_-	hypothetical protein	NA	NA	NA	NA	NA
AYE25830.1|1131_1539_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	96.4	1.8e-22
AYE25831.1|1566_1929_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	82.4	1.1e-47
AYE25904.1|2076_2430_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	100.0	3.7e-40
>prophage 2
CP022964	Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence	67685	7285	35878	67685	coat,transposase	uncultured_Caudovirales_phage(40.0%)	39	NA	NA
AYE25836.1|7285_7996_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.4	2.1e-95
AYE25837.1|8096_8420_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYE25838.1|8525_9659_+	permease	NA	NA	NA	NA	NA
AYE25839.1|10358_13346_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	1.7e-295
AYE25840.1|13388_14033_-	resolvase	NA	A0A1V0E035	Clostridioides_phage	28.3	9.8e-07
AYE25841.1|14413_15076_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
AYE25842.1|15175_15460_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AYE25843.1|15499_16590_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYE25844.1|16668_17694_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	44.1	6.6e-74
AYE25905.1|17737_17845_+	hypothetical protein	NA	NA	NA	NA	NA
AYE25845.1|17881_18085_-	hypothetical protein	NA	NA	NA	NA	NA
AYE25846.1|18199_19267_-	arsenical-resistance protein	NA	NA	NA	NA	NA
AYE25847.1|19263_19770_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	3.0e-27
AYE25848.1|19766_20534_-	FMN reductase	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	63.3	1.4e-76
AYE25849.1|20530_20863_-	transcriptional regulator	NA	NA	NA	NA	NA
AYE25850.1|21010_21748_+	resolvase	NA	NA	NA	NA	NA
AYE25851.1|21744_21969_+	hypothetical protein	NA	NA	NA	NA	NA
AYE25852.1|22179_23673_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYE25853.1|23703_23955_+	hypothetical protein	NA	NA	NA	NA	NA
AYE25854.1|23848_24151_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AYE25855.1|24237_25053_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AYE25856.1|25145_26235_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYE25857.1|26377_26653_+	hypothetical protein	NA	NA	NA	NA	NA
AYE25858.1|26676_27273_+	aminopeptidase	NA	NA	NA	NA	NA
AYE25906.1|27324_27681_-	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AYE25859.1|27817_28264_-	hypothetical protein	NA	NA	NA	NA	NA
AYE25860.1|28267_29110_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
AYE25861.1|29130_29970_-	replication initiation protein	NA	NA	NA	NA	NA
AYE25862.1|31204_31456_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AYE25863.1|31445_31727_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
AYE25864.1|31872_32196_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	46.1	9.2e-14
AYE25865.1|32240_32486_+	hypothetical protein	NA	NA	NA	NA	NA
AYE25866.1|32475_32718_+	hypothetical protein	NA	NA	NA	NA	NA
AYE25867.1|32782_33112_+	hypothetical protein	NA	NA	NA	NA	NA
AYE25868.1|33154_33334_+	hypothetical protein	NA	NA	NA	NA	NA
AYE25869.1|33355_33553_+	hypothetical protein	NA	NA	NA	NA	NA
AYE25870.1|33565_33838_+	hypothetical protein	NA	NA	NA	NA	NA
AYE25907.1|34163_34709_+	DNA distortion polypeptide 1	NA	NA	NA	NA	NA
AYE25871.1|34705_35878_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
>prophage 3
CP022964	Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence	67685	50883	51700	67685		Enterobacteria_phage(50.0%)	2	NA	NA
AYE25887.1|50883_51111_+	hypothetical protein	NA	A0A0E3JIZ4	Enterobacteria_phage	49.0	3.2e-13
AYE25888.1|51190_51700_+	hypothetical protein	NA	A0A0R6PHV6	Moraxella_phage	38.5	2.8e-17
>prophage 4
CP022964	Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence	67685	60502	67146	67685	transposase	Enterobacteria_phage(40.0%)	5	NA	NA
AYE25898.1|60502_60673_+	pilus assembly protein	NA	A0A2L1IV26	Escherichia_phage	83.9	2.6e-07
AYE25899.1|61398_62259_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYE25900.1|62441_62999_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AYE25901.1|64698_66276_-	chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
AYE25902.1|66585_67146_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
>prophage 1
CP022965	Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal2, complete sequence	86369	77585	85291	86369	transposase	Vibrio_phage(16.67%)	8	NA	NA
AYE25985.1|77585_78266_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	2.4e-27
AYE25986.1|78647_79004_-	hypothetical protein	NA	NA	NA	NA	NA
AYE25987.1|78996_79467_-	hypothetical protein	NA	NA	NA	NA	NA
AYE25988.1|79977_80400_+	protein SamA	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
AYE25989.1|80399_81674_+	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.2	8.6e-156
AYE25990.1|81755_82733_-	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	53.2	1.5e-83
AYE25991.1|82729_83935_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
AYE25992.1|84349_85291_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
