The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022916	Klebsiella pneumoniae strain ST307PT04 chromosome, complete genome	5328896	444828	514388	5328896	terminase,portal,tRNA,tail,integrase,protease,head,capsid	uncultured_Caudovirales_phage(61.11%)	77	462615:462632	478610:478627
AYC81892.1|444828_445776_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AYC81893.1|445790_446300_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.5	4.4e-18
AYC81894.1|446428_447553_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AYC81895.1|447524_447998_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AYC81896.1|448024_448567_+	hypothetical protein	NA	NA	NA	NA	NA
AYC81897.1|448571_449144_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AYC81898.1|449147_449966_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AYC81899.1|449962_450220_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AYC81900.1|450195_450750_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AYC81901.1|450952_451135_+	hypothetical protein	NA	NA	NA	NA	NA
AYC81902.1|456528_456756_+	hypothetical protein	NA	NA	NA	NA	NA
AYC81903.1|456724_456946_-	hypothetical protein	NA	NA	NA	NA	NA
AYC81904.1|457238_460349_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AYC81905.1|460361_461501_-	MexX family efflux pump subunit	NA	NA	NA	NA	NA
AYC81906.1|461879_462533_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
462615:462632	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AYC81907.1|462805_464032_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AYC81908.1|464124_465066_+	hypothetical protein	NA	NA	NA	NA	NA
AYC81909.1|465247_465532_+	transcriptional regulator	NA	NA	NA	NA	NA
AYC81910.1|465542_466322_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AYC81911.1|466445_466640_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AYC86296.1|466863_467043_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
AYC81912.1|467035_467224_+	hypothetical protein	NA	NA	NA	NA	NA
AYC81913.1|467216_467531_+	hypothetical protein	NA	NA	NA	NA	NA
AYC81914.1|467527_467896_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AYC81915.1|467892_468258_+	hypothetical protein	NA	NA	NA	NA	NA
AYC81916.1|468257_470393_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AYC81917.1|470735_471071_+	hypothetical protein	NA	NA	NA	NA	NA
AYC81918.1|471119_471632_-	hypothetical protein	NA	NA	NA	NA	NA
AYC81919.1|471895_473062_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AYC81920.1|473113_473674_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AYC81921.1|473675_474917_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AYC81922.1|474913_475249_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AYC81923.1|475245_475545_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AYC81924.1|475544_475988_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AYC81925.1|476114_476306_+|terminase	terminase	terminase	NA	NA	NA	NA
AYC81926.1|476263_476620_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AYC81927.1|476603_478265_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AYC81928.1|478267_478459_+	hypothetical protein	NA	NA	NA	NA	NA
AYC81929.1|478612_478909_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
478610:478627	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AYC81930.1|478933_479899_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AYC81931.1|480056_480251_-	hypothetical protein	NA	NA	NA	NA	NA
AYC81932.1|480256_481138_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AYC81933.1|481149_482601_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AYC81934.1|482590_482833_-	hypothetical protein	NA	NA	NA	NA	NA
AYC81935.1|482943_484293_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AYC81936.1|484303_484771_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
AYC81937.1|484793_485246_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AYC81938.1|485469_486078_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AYC81939.1|486077_487079_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AYC81940.1|487307_487499_+	hypothetical protein	NA	NA	NA	NA	NA
AYC81941.1|487578_489519_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AYC81942.1|489640_489847_-	hypothetical protein	NA	NA	NA	NA	NA
AYC81943.1|489824_490868_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AYC81944.1|490938_491931_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AYC81945.1|491930_492419_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYC81946.1|492426_493008_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AYC81947.1|493010_494480_+	ribonuclease E/G	NA	NA	NA	NA	NA
AYC81948.1|494517_498318_+	TIGR02099 family protein	NA	NA	NA	NA	NA
AYC81949.1|498406_499852_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AYC81950.1|499887_500817_-	transcriptional regulator	NA	NA	NA	NA	NA
AYC81951.1|500948_501152_+	protein AaeX	NA	NA	NA	NA	NA
AYC81952.1|501159_502092_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AYC81953.1|502097_504065_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AYC81954.1|504144_504420_+	hypothetical protein	NA	NA	NA	NA	NA
AYC81955.1|504470_504737_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYC81956.1|504835_505099_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYC81957.1|505474_505945_-	arginine repressor	NA	NA	NA	NA	NA
AYC81958.1|506359_507298_+	malate dehydrogenase	NA	NA	NA	NA	NA
AYC81959.1|507434_508493_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AYC81960.1|508580_509948_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AYC81961.1|510121_510520_-	hypothetical protein	NA	NA	NA	NA	NA
AYC81962.1|510710_511838_+	cell division protein ZapE	NA	NA	NA	NA	NA
AYC81963.1|512103_512532_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AYC81964.1|512547_512940_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AYC81965.1|513049_513253_-	hypothetical protein	NA	NA	NA	NA	NA
AYC81966.1|513251_513890_+	stringent starvation protein A	NA	NA	NA	NA	NA
AYC81967.1|513893_514388_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
CP022916	Klebsiella pneumoniae strain ST307PT04 chromosome, complete genome	5328896	666397	685640	5328896	terminase,portal,transposase,tail,integrase,head,capsid	uncultured_Caudovirales_phage(71.43%)	21	666171:666218	682991:683038
666171:666218	attL	TTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
AYC82115.1|666397_667822_+|integrase	integrase	integrase	H7BV31	unidentified_phage	27.2	1.1e-07
AYC82116.1|667814_668648_+	hypothetical protein	NA	NA	NA	NA	NA
AYC82117.1|668789_668999_+	DNA-binding protein	NA	NA	NA	NA	NA
AYC82118.1|669009_669960_+	hypothetical protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	36.6	4.4e-40
AYC82119.1|669952_670150_+	hypothetical protein	NA	NA	NA	NA	NA
AYC82120.1|670142_670370_+	aminotransferase	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	89.2	1.6e-28
AYC82121.1|670732_672097_+	hypothetical protein	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	97.1	5.8e-259
AYC82122.1|672450_672687_+	hypothetical protein	NA	NA	NA	NA	NA
AYC82123.1|673260_674277_-|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AYC82124.1|674959_676120_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	94.8	1.8e-205
AYC82125.1|676171_676732_+	peptidase	NA	A0A2H4JB68	uncultured_Caudovirales_phage	93.0	4.4e-96
AYC86302.1|676742_677969_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	95.3	1.5e-229
AYC82126.1|677965_678307_+|head,tail	head-tail adaptor	head,tail	A0A286S2A2	Klebsiella_phage	46.1	6.3e-21
AYC82127.1|678299_678593_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	85.6	3.8e-43
AYC82128.1|678592_679036_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	88.4	1.5e-75
AYC82129.1|679162_679354_+|terminase	terminase	terminase	NA	NA	NA	NA
AYC82130.1|679311_679668_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	97.4	1.6e-59
AYC82131.1|679651_681313_+|terminase	terminase	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.8	0.0e+00
AYC82132.1|681428_682880_+	AAA family ATPase	NA	NA	NA	NA	NA
AYC82133.1|683192_683699_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
682991:683038	attR	TTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
AYC82134.1|683798_685640_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
>prophage 3
CP022916	Klebsiella pneumoniae strain ST307PT04 chromosome, complete genome	5328896	1490145	1567385	5328896	portal,holin,tRNA,tail,integrase,protease,head,capsid,plate,terminase	Escherichia_phage(18.75%)	80	1505098:1505122	1544631:1544655
AYC82850.1|1490145_1491915_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYC82851.1|1491878_1492961_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYC82852.1|1492996_1493521_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYC82853.1|1493525_1495847_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.7e-14
AYC82854.1|1495843_1496347_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.0	1.5e-18
AYC82855.1|1496340_1496685_+	hypothetical protein	NA	NA	NA	NA	NA
AYC86329.1|1496717_1497455_+	hypothetical protein	NA	NA	NA	NA	NA
AYC86330.1|1497697_1498180_+	hypothetical protein	NA	NA	NA	NA	NA
AYC82856.1|1500063_1500948_+	glycine zipper family protein	NA	NA	NA	NA	NA
AYC82857.1|1500937_1501495_+	hypothetical protein	NA	NA	NA	NA	NA
AYC86331.1|1502002_1502401_+	hypothetical protein	NA	NA	NA	NA	NA
AYC82858.1|1503635_1504169_+	hypothetical protein	NA	NA	NA	NA	NA
1505098:1505122	attL	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AYC82859.1|1505316_1506486_+|integrase	integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.1	1.9e-202
AYC82860.1|1506860_1507433_+	hypothetical protein	NA	NA	NA	NA	NA
AYC82861.1|1507534_1507735_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	60.0	1.8e-12
AYC82862.1|1507742_1508546_-	hypothetical protein	NA	NA	NA	NA	NA
AYC82863.1|1508542_1509058_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
AYC82864.1|1509057_1509441_-	hypothetical protein	NA	NA	NA	NA	NA
AYC82865.1|1509433_1510510_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.4	2.8e-147
AYC82866.1|1510637_1511423_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	2.9e-61
AYC82867.1|1511422_1511722_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	1.1e-13
AYC82868.1|1512350_1513046_-	transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	2.7e-87
AYC82869.1|1513143_1513386_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
AYC82870.1|1513420_1513882_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AYC82871.1|1514119_1514299_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
AYC82872.1|1514288_1515242_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	69.0	6.1e-90
AYC82873.1|1515238_1516048_+	DNA methylase	NA	A0A1C9II58	Salmonella_phage	68.9	2.9e-109
AYC82874.1|1516057_1516435_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
AYC82875.1|1516447_1517428_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	7.6e-136
AYC82876.1|1517441_1518020_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
AYC82877.1|1518239_1518665_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	83.7	1.9e-59
AYC82878.1|1519315_1519711_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AYC82879.1|1519697_1519979_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AYC82880.1|1519978_1520608_+	endolysin	NA	G8C7W0	Escherichia_phage	90.9	1.2e-105
AYC82881.1|1520615_1520891_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.3	1.9e-23
AYC82882.1|1520841_1521036_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	83.6	2.7e-21
AYC82883.1|1521092_1521752_-	hypothetical protein	NA	NA	NA	NA	NA
AYC82884.1|1521951_1522302_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	73.7	3.4e-46
AYC82885.1|1522460_1522958_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	2.5e-63
AYC82886.1|1522961_1524713_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	6.7e-252
AYC82887.1|1524860_1526087_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
AYC82888.1|1526079_1526679_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	1.0e-90
AYC82889.1|1526688_1527927_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
AYC82890.1|1528004_1528322_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	4.8e-23
AYC82891.1|1528330_1528669_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	67.9	3.3e-38
AYC82892.1|1528665_1529115_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
AYC82893.1|1529111_1529459_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
AYC82894.1|1529515_1530220_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.5	9.5e-80
AYC82895.1|1530250_1530655_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	1.9e-32
AYC82896.1|1530657_1530963_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
AYC82897.1|1531036_1531270_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
AYC82898.1|1531331_1534718_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.5	4.0e-301
AYC82899.1|1534739_1535213_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
AYC82900.1|1535199_1535676_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
AYC82901.1|1535688_1536069_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	83.3	2.0e-60
AYC82902.1|1536065_1539143_+	kinase	NA	A0A286S259	Klebsiella_phage	62.2	0.0e+00
AYC82903.1|1541827_1542922_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.5	1.4e-178
AYC82904.1|1542956_1544057_-	acyltransferase	NA	C6ZR20	Salmonella_phage	27.2	1.8e-05
AYC82905.1|1544212_1544533_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	1.1e-22
AYC82906.1|1544743_1545673_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
1544631:1544655	attR	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AYC82907.1|1545962_1546724_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AYC82908.1|1546785_1548114_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AYC82909.1|1548481_1548766_+	hypothetical protein	NA	NA	NA	NA	NA
AYC82910.1|1548925_1550236_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AYC82911.1|1550235_1552380_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AYC82912.1|1552589_1553075_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AYC82913.1|1553095_1553647_-	endonuclease SmrB	NA	NA	NA	NA	NA
AYC82914.1|1553814_1554747_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYC82915.1|1554788_1555874_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
AYC82916.1|1555876_1556701_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AYC82917.1|1556700_1557510_+	hypothetical protein	NA	NA	NA	NA	NA
AYC82918.1|1557509_1558058_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AYC86332.1|1558089_1558371_+	hypothetical protein	NA	NA	NA	NA	NA
AYC86333.1|1558432_1560421_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AYC82919.1|1560579_1561800_+	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AYC82920.1|1562009_1563185_+	arabinose transporter	NA	NA	NA	NA	NA
AYC82921.1|1563271_1564249_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AYC82922.1|1564359_1565496_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
AYC82923.1|1565559_1566573_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYC82924.1|1566572_1567385_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 4
CP022916	Klebsiella pneumoniae strain ST307PT04 chromosome, complete genome	5328896	1766305	1773210	5328896		Planktothrix_phage(33.33%)	6	NA	NA
AYC86340.1|1766305_1767169_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AYC83092.1|1767179_1767953_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AYC86341.1|1768193_1769087_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AYC83093.1|1769332_1770694_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AYC83094.1|1771012_1771735_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AYC83095.1|1771731_1773210_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
CP022916	Klebsiella pneumoniae strain ST307PT04 chromosome, complete genome	5328896	2739051	2749938	5328896		Escherichia_phage(87.5%)	9	NA	NA
AYC83987.1|2739051_2742159_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AYC83988.1|2742213_2743479_+	MFS transporter	NA	NA	NA	NA	NA
AYC83989.1|2743509_2744598_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	1.8e-210
AYC83990.1|2744684_2744945_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AYC83991.1|2745242_2746103_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
AYC83992.1|2746123_2746885_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AYC83993.1|2747145_2748048_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AYC83994.1|2748059_2749325_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
AYC83995.1|2749317_2749938_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
CP022916	Klebsiella pneumoniae strain ST307PT04 chromosome, complete genome	5328896	3419710	3429184	5328896	tRNA,protease	Brazilian_cedratvirus(16.67%)	9	NA	NA
AYC84591.1|3419710_3421432_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AYC84592.1|3421476_3422178_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYC84593.1|3422531_3422750_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYC84594.1|3422880_3425160_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AYC84595.1|3425190_3425508_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AYC84596.1|3425833_3426055_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AYC84597.1|3426009_3426192_-	hypothetical protein	NA	NA	NA	NA	NA
AYC84598.1|3426131_3428072_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
AYC84599.1|3428068_3429184_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 7
CP022916	Klebsiella pneumoniae strain ST307PT04 chromosome, complete genome	5328896	3912698	3966377	5328896	holin,lysis,tRNA,tail,integrase,protease,head,terminase	Salmonella_phage(34.78%)	75	3912063:3912108	3953624:3953669
3912063:3912108	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AYC85016.1|3912698_3913793_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.3	1.2e-177
AYC85017.1|3916513_3917287_-	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	43.8	3.1e-31
AYC85018.1|3917286_3918060_-	hypothetical protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	52.9	5.3e-68
AYC85019.1|3918056_3919256_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	75.1	1.3e-161
AYC85020.1|3919255_3919609_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.3e-50
AYC85021.1|3919610_3920264_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	56.7	4.7e-73
AYC85022.1|3920330_3920699_-	hypothetical protein	NA	NA	NA	NA	NA
AYC85023.1|3920708_3920954_-	hypothetical protein	NA	NA	NA	NA	NA
AYC85024.1|3920950_3921511_-	hypothetical protein	NA	NA	NA	NA	NA
AYC85025.1|3921628_3921970_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	65.8	2.4e-20
AYC85026.1|3921966_3923034_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	68.5	3.4e-137
AYC86442.1|3923036_3923264_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.0	5.6e-18
AYC85027.1|3923339_3923915_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	66.0	5.0e-63
AYC85028.1|3923914_3925831_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	57.9	6.1e-198
AYC86443.1|3925820_3925997_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	67.3	2.7e-12
AYC85029.1|3926008_3926437_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.3	8.1e-42
AYC85030.1|3926440_3926884_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	79.3	1.6e-61
AYC85031.1|3926893_3928039_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.4	6.3e-166
AYC85032.1|3928042_3928483_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AYC85033.1|3928577_3928964_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
AYC85034.1|3928963_3929578_-	hypothetical protein	NA	NA	NA	NA	NA
AYC85035.1|3929574_3929994_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	2.6e-40
AYC85036.1|3929962_3930244_-	hypothetical protein	NA	NA	NA	NA	NA
AYC85037.1|3930283_3931225_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	1.3e-137
AYC85038.1|3931236_3931731_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.1	1.2e-49
AYC85039.1|3931734_3932937_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	55.7	8.8e-110
AYC85040.1|3932946_3933141_-	hypothetical protein	NA	NA	NA	NA	NA
AYC86444.1|3933186_3933735_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
AYC85041.1|3933790_3935242_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AYC85042.1|3935480_3936881_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	2.1e-187
AYC86445.1|3936831_3937608_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	67.9	6.4e-13
AYC85043.1|3937680_3938172_+	hypothetical protein	NA	NA	NA	NA	NA
AYC85044.1|3938258_3938501_-	DUF1378 domain-containing protein	NA	NA	NA	NA	NA
AYC85045.1|3938512_3938983_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	59.1	2.8e-43
AYC86446.1|3938979_3939477_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	83.6	4.8e-78
AYC85046.1|3939454_3939724_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
AYC85047.1|3940174_3940753_-	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	56.7	4.2e-49
AYC85048.1|3940749_3941409_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.0	6.3e-102
AYC85049.1|3941401_3941710_-	hypothetical protein	NA	Q6V7S4	Burkholderia_virus	57.6	2.1e-23
AYC85050.1|3941950_3942220_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	80.7	3.5e-35
AYC85051.1|3942266_3942662_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	77.9	8.0e-52
AYC85052.1|3942651_3943683_-	hypothetical protein	NA	S4TSR6	Salmonella_phage	62.2	3.3e-57
AYC85053.1|3943679_3943907_-	hypothetical protein	NA	NA	NA	NA	NA
AYC85054.1|3943906_3944497_-	hypothetical protein	NA	NA	NA	NA	NA
AYC85055.1|3944450_3945242_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	52.9	1.1e-65
AYC85056.1|3945234_3945456_-	hypothetical protein	NA	NA	NA	NA	NA
AYC85057.1|3945455_3945851_-	hypothetical protein	NA	NA	NA	NA	NA
AYC85058.1|3945877_3946906_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	51.5	2.6e-30
AYC85059.1|3946902_3947157_-	hypothetical protein	NA	NA	NA	NA	NA
AYC85060.1|3947170_3947596_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AYC85061.1|3947599_3947851_-	transcriptional regulator	NA	NA	NA	NA	NA
AYC85062.1|3947959_3948361_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	47.0	1.8e-11
AYC85063.1|3948505_3948910_+	hypothetical protein	NA	NA	NA	NA	NA
AYC85064.1|3948938_3949148_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	9.4e-28
AYC85065.1|3949358_3949577_+	hypothetical protein	NA	NA	NA	NA	NA
AYC85066.1|3950210_3950504_+	hypothetical protein	NA	NA	NA	NA	NA
AYC85067.1|3950805_3951033_+	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	48.4	2.1e-09
AYC85068.1|3951029_3951254_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.5e-18
AYC85069.1|3951250_3952000_+	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	59.9	6.7e-84
AYC85070.1|3951996_3952215_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
AYC85071.1|3952445_3953606_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	91.3	8.8e-208
AYC85072.1|3954039_3954906_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
3953624:3953669	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AYC85073.1|3954907_3955120_+	ribosome-associated protein	NA	NA	NA	NA	NA
AYC85074.1|3955165_3956551_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AYC85075.1|3956726_3957221_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AYC85076.1|3957224_3957947_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AYC85077.1|3958054_3958393_+	hypothetical protein	NA	NA	NA	NA	NA
AYC85078.1|3958389_3958557_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYC85079.1|3958489_3958999_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AYC85080.1|3958995_3960063_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AYC85081.1|3960174_3961251_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AYC85082.1|3961358_3962504_-	porin	NA	NA	NA	NA	NA
AYC85083.1|3962685_3965100_-	ABC transporter permease	NA	NA	NA	NA	NA
AYC86447.1|3965096_3965783_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
AYC86448.1|3965750_3966377_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 1
CP022917	Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence	246577	690	54231	246577	protease,transposase,integrase	Escherichia_phage(25.0%)	43	NA	NA
AYC86745.1|690_2037_+|transposase	transposase	transposase	NA	NA	NA	NA
AYC86515.1|2085_2481_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYC86516.1|3970_4933_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AYC86517.1|4919_5669_-	diguanylate cyclase	NA	NA	NA	NA	NA
AYC86518.1|5906_6104_-	hypothetical protein	NA	NA	NA	NA	NA
AYC86519.1|6103_8899_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.0	5.2e-129
AYC86520.1|9022_9592_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYC86746.1|9626_9908_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AYC86521.1|11843_12851_-	formamidase	NA	NA	NA	NA	NA
AYC86522.1|12886_13576_-	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	29.6	8.5e-17
AYC86523.1|13586_14336_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.4e-17
AYC86524.1|14332_15448_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
AYC86525.1|15457_16384_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYC86747.1|16440_17631_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYC86526.1|17935_21316_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	30.3	1.7e-41
AYC86527.1|21278_22199_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.1	2.0e-13
AYC86528.1|23195_24164_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
AYC86529.1|24437_25442_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYC86530.1|25623_25800_-|integrase	integrase	integrase	T1S9J3	Salmonella_phage	68.6	1.0e-06
AYC86531.1|26129_26945_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AYC86532.1|27005_27809_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AYC86533.1|27808_28645_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AYC86534.1|28726_29431_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYC86535.1|30401_31106_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYC86536.1|31398_31713_-|transposase	transposase	transposase	NA	NA	NA	NA
AYC86537.1|31651_32665_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYC86538.1|32811_33294_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AYC86539.1|33514_33781_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AYC86540.1|33923_34688_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AYC86541.1|34729_34942_+	resolvase	NA	NA	NA	NA	NA
AYC86542.1|34954_36163_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AYC86543.1|36196_37630_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AYC86544.1|37948_38653_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYC86748.1|40274_40517_+	relaxase	NA	NA	NA	NA	NA
AYC86545.1|40548_41226_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYC86546.1|41304_42504_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYC86547.1|42535_43420_-	EamA family transporter	NA	NA	NA	NA	NA
AYC86749.1|43557_43950_-	cysteine hydrolase	NA	NA	NA	NA	NA
AYC86548.1|44726_45332_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AYC86549.1|45426_48324_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AYC86550.1|50731_51376_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
AYC86551.1|52175_52880_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYC86552.1|52926_54231_-|integrase	integrase	integrase	NA	NA	NA	NA
>prophage 2
CP022917	Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence	246577	70840	82932	246577		Enterobacteria_phage(25.0%)	13	NA	NA
AYC86572.1|70840_72868_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
AYC86573.1|72979_73195_-	hypothetical protein	NA	NA	NA	NA	NA
AYC86574.1|73419_73752_-	hypothetical protein	NA	NA	NA	NA	NA
AYC86575.1|73771_73957_-	hypothetical protein	NA	NA	NA	NA	NA
AYC86576.1|74128_75103_-	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
AYC86577.1|75099_76305_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
AYC86578.1|76626_77523_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
AYC86579.1|77923_79195_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
AYC86580.1|79194_79626_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
AYC86581.1|79857_80829_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AYC86582.1|80831_81503_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AYC86583.1|81563_81794_+	hypothetical protein	NA	NA	NA	NA	NA
AYC86584.1|82230_82932_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
>prophage 3
CP022917	Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence	246577	151438	168035	246577	transposase,integrase	Escherichia_phage(28.57%)	11	148575:148591	173651:173667
148575:148591	attL	CCGGCATGCGCAGAAAA	NA	NA	NA	NA
AYC86669.1|151438_153154_-|integrase	integrase	integrase	NA	NA	NA	NA
AYC86670.1|153263_156293_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
AYC86671.1|156399_157425_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AYC86672.1|157421_158201_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AYC86673.1|158197_158437_+	hypothetical protein	NA	NA	NA	NA	NA
AYC86674.1|158488_159370_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AYC86675.1|159619_160939_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AYC86676.1|161215_162400_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AYC86677.1|162903_163263_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
AYC86678.1|164428_165049_-	serine recombinase	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
AYC86679.1|165137_168035_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
173651:173667	attR	TTTTCTGCGCATGCCGG	NA	NA	NA	NA
