The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032446	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 chromosome, complete genome	4844133	1152432	1245952	4844133	plate,transposase,tail,capsid,tRNA,head,integrase,portal,lysis	Salmonella_phage(75.56%)	83	1155469:1155484	1168736:1168751
AYB82529.1|1152432_1153543_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
AYB82530.1|1154339_1155143_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
1155469:1155484	attL	TCAGCCAGCAGGCTTT	NA	NA	NA	NA
AYB82531.1|1155541_1156135_-	hypothetical protein	NA	NA	NA	NA	NA
AYB82532.1|1156394_1157420_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	99.1	9.2e-201
AYB82533.1|1157423_1158056_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.1e-66
AYB82534.1|1158172_1158412_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
AYB82535.1|1158965_1159199_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
AYB82536.1|1159146_1159605_-	hypothetical protein	NA	NA	NA	NA	NA
AYB82537.1|1159824_1160166_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
AYB82538.1|1160233_1160467_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
AYB82539.1|1160466_1160694_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
AYB82540.1|1160690_1161548_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	99.6	1.5e-164
AYB82541.1|1161544_1163941_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.9	0.0e+00
AYB82542.1|1164096_1164285_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
AYB82543.1|1164353_1164653_-	hypothetical protein	NA	NA	NA	NA	NA
AYB82544.1|1164763_1165570_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	6.2e-51
AYB82545.1|1166062_1167217_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYB82546.1|1167996_1169028_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.0	5.0e-170
1168736:1168751	attR	AAAGCCTGCTGGCTGA	NA	NA	NA	NA
AYB82547.1|1169027_1170794_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
AYB82548.1|1170936_1171770_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	5.9e-121
AYB82549.1|1171786_1172845_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	4.9e-181
AYB82550.1|1172848_1173499_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYB82551.1|1173594_1174059_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
AYB82552.1|1174058_1174262_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYB82553.1|1174265_1174481_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYB85904.1|1174500_1174974_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYB82554.1|1174975_1175353_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	5.1e-16
AYB82555.1|1175349_1175778_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	1.3e-47
AYB82556.1|1175707_1175911_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	8.9e-23
AYB82557.1|1175873_1176305_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
AYB82558.1|1176297_1176744_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	3.1e-60
AYB82559.1|1176770_1177637_-	hypothetical protein	NA	NA	NA	NA	NA
AYB82560.1|1177732_1178311_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.8e-92
AYB82561.1|1178307_1178667_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	91.5	3.5e-54
AYB85905.1|1179553_1180159_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
AYB82562.1|1180155_1181841_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	50.6	3.5e-128
AYB82563.1|1181843_1182371_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AYB82564.1|1182501_1183674_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
AYB82565.1|1183683_1184199_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYB82566.1|1184253_1184556_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
AYB82567.1|1184570_1184690_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
AYB82568.1|1187485_1187971_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AYB82569.1|1187967_1189068_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	9.0e-194
AYB85906.1|1189136_1189355_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AYB85907.1|1189906_1191070_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYB82570.1|1193249_1194659_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AYB82571.1|1194723_1205943_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AYB85908.1|1206557_1207040_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AYB82572.1|1207189_1207666_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYB82573.1|1207655_1207946_+	RnfH family protein	NA	NA	NA	NA	NA
AYB82574.1|1208111_1208450_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYB82575.1|1208598_1210260_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AYB85910.1|1210345_1211224_-	NAD(+) kinase	NA	NA	NA	NA	NA
AYB85909.1|1211347_1211938_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYB82576.1|1211972_1212578_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB82577.1|1212698_1213940_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYB82578.1|1214004_1214796_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYB82579.1|1214741_1215038_-	hypothetical protein	NA	NA	NA	NA	NA
AYB82580.1|1214961_1216323_+	signal recognition particle protein	NA	NA	NA	NA	NA
AYB82581.1|1216575_1216824_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYB82582.1|1216842_1217391_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYB82583.1|1217435_1218203_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYB82584.1|1218243_1218591_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYB82585.1|1218748_1219969_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
AYB82586.1|1219961_1220480_-	YfiR family protein	NA	NA	NA	NA	NA
AYB82587.1|1220919_1221990_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AYB82588.1|1221999_1223121_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYB82589.1|1223178_1224087_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AYB82590.1|1224047_1225208_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AYB85911.1|1225307_1225355_-	hypothetical protein	NA	NA	NA	NA	NA
AYB82591.1|1225458_1225797_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AYB82592.1|1226068_1226806_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AYB82593.1|1226937_1227918_+	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AYB82594.1|1227914_1228646_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AYB82595.1|1228775_1231349_+	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
AYB82596.1|1237129_1237585_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
AYB82597.1|1237688_1238990_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
AYB82598.1|1238986_1239310_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AYB82599.1|1239354_1240710_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AYB82600.1|1240824_1243485_-	protein lysine acetyltransferase Pat	NA	NA	NA	NA	NA
AYB82601.1|1243538_1244219_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AYB82602.1|1244291_1244711_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AYB82603.1|1244914_1245952_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
CP032446	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 chromosome, complete genome	4844133	1481307	1487346	4844133		Salmonella_virus(50.0%)	6	NA	NA
AYB82796.1|1481307_1481538_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	5.4e-08
AYB82797.1|1481476_1481620_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
AYB82798.1|1482609_1484532_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	76.9	8.1e-299
AYB82799.1|1484549_1484804_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
AYB85918.1|1484772_1485162_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
AYB82800.1|1486404_1487346_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 3
CP032446	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 chromosome, complete genome	4844133	1723551	1732722	4844133	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYB83017.1|1723551_1724499_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AYB83018.1|1724482_1725214_+	ABC transporter permease	NA	NA	NA	NA	NA
AYB83019.1|1725194_1725302_-	protein YohO	NA	NA	NA	NA	NA
AYB83020.1|1725361_1726093_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	2.2e-100
AYB83021.1|1726315_1728001_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.4e-278
AYB83022.1|1727997_1728717_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYB83023.1|1728763_1729231_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	8.8e-74
AYB83024.1|1729287_1729818_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYB83025.1|1729989_1730448_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	71.2	7.1e-52
AYB83026.1|1730688_1732722_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	2.1e-55
>prophage 4
CP032446	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 chromosome, complete genome	4844133	1799918	1810425	4844133		Enterobacteria_phage(37.5%)	10	NA	NA
AYB83077.1|1799918_1801322_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
AYB83078.1|1801499_1802393_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYB83079.1|1802769_1803855_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYB83080.1|1803854_1804754_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AYB83081.1|1804801_1805680_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AYB83082.1|1805680_1806232_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.5	6.5e-52
AYB83083.1|1806237_1807212_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AYB83084.1|1807227_1808001_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYB83085.1|1808005_1809085_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
AYB83086.1|1809111_1810425_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
CP032446	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 chromosome, complete genome	4844133	1923352	1969563	4844133	plate,tail,transposase,capsid,head,terminase,holin,integrase	Salmonella_phage(84.91%)	64	1921324:1921338	1941644:1941658
1921324:1921338	attL	TTATCAATGACATCT	NA	NA	NA	NA
AYB85933.1|1923352_1924627_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.1	8.2e-74
AYB83197.1|1924982_1925780_-	protein MtfA	NA	NA	NA	NA	NA
AYB83198.1|1926071_1927061_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AYB83199.1|1927062_1927305_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	98.8	2.1e-39
AYB83200.1|1927329_1927899_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	91.0	5.8e-104
AYB83201.1|1927895_1928645_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	83.6	1.1e-46
AYB83202.1|1928648_1929122_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.3	5.0e-69
AYB83203.1|1929121_1929859_-	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	86.3	1.8e-52
AYB83204.1|1929929_1930469_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AYB83205.1|1930605_1931433_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	97.5	1.0e-149
AYB83206.1|1931490_1931862_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AYB83207.1|1932398_1932644_+	hypothetical protein	NA	NA	NA	NA	NA
AYB83208.1|1932561_1932858_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	98.0	1.1e-50
AYB83209.1|1932838_1933090_-	hypothetical protein	NA	NA	NA	NA	NA
AYB83210.1|1933017_1933203_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
AYB83211.1|1933407_1934103_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
AYB83212.1|1934076_1934262_+	amino acid permease	NA	NA	NA	NA	NA
AYB83213.1|1934200_1934425_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AYB83214.1|1934453_1935008_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	5.9e-101
AYB83215.1|1935004_1936147_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.6	1.6e-182
AYB83216.1|1936143_1936368_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AYB83217.1|1936364_1937339_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	98.1	1.2e-165
AYB83218.1|1937335_1937809_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	93.8	6.6e-53
AYB83219.1|1937805_1938687_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	1.1e-170
AYB83220.1|1938695_1939085_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
AYB83221.1|1939056_1939962_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	2.8e-161
AYB85934.1|1939969_1940959_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	3.0e-188
AYB83222.1|1940972_1941725_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	2.4e-134
1941644:1941658	attR	AGATGTCATTGATAA	NA	NA	NA	NA
AYB83223.1|1941756_1941945_+	hypothetical protein	NA	NA	NA	NA	NA
AYB83224.1|1942013_1942256_+	hypothetical protein	NA	NA	NA	NA	NA
AYB83225.1|1942387_1942741_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	88.7	1.0e-50
AYB83226.1|1942744_1943221_+	lysozyme	NA	Q8SBE0	Shigella_phage	96.8	1.7e-85
AYB83227.1|1943204_1943597_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	92.3	1.6e-57
AYB83228.1|1943481_1943754_+	peptidase	NA	Q8SBD8	Shigella_phage	77.6	3.8e-29
AYB83229.1|1944122_1944557_+	hypothetical protein	NA	NA	NA	NA	NA
AYB83230.1|1944684_1945035_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	8.0e-64
AYB83231.1|1945152_1945656_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	3.6e-89
AYB83232.1|1945652_1947386_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
AYB83233.1|1947397_1947580_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	98.3	2.2e-25
AYB83234.1|1949462_1950668_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
AYB83235.1|1950718_1950919_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
AYB83236.1|1950921_1951245_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
AYB83237.1|1951241_1951646_+|head,tail	head-tail adaptor protein	head,tail	A0A192Y6C2	Salmonella_phage	99.3	5.4e-72
AYB83238.1|1951617_1952130_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
AYB83239.1|1952126_1952687_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	99.5	8.8e-105
AYB83240.1|1952690_1952855_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
AYB83241.1|1952844_1954341_+|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	99.8	6.1e-278
AYB83242.1|1954340_1954697_+|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AYB83243.1|1954693_1955020_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
AYB83244.1|1955104_1957033_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.7	0.0e+00
AYB83245.1|1957066_1958407_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
AYB83246.1|1958403_1959468_+|plate	baseplate protein	plate	Q8HAC0	Salmonella_phage	95.1	4.2e-188
AYB83247.1|1959460_1959994_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
AYB83248.1|1959998_1960412_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AYB83249.1|1960404_1961484_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
AYB83250.1|1961486_1962074_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AYB83251.1|1962060_1963623_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	100.0	2.6e-287
AYB83252.1|1963622_1964192_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
AYB83253.1|1964476_1965484_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
AYB83254.1|1965696_1965918_+	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AYB83255.1|1966281_1966464_+	hypothetical protein	NA	NA	NA	NA	NA
AYB83256.1|1966856_1967234_+	hypothetical protein	NA	NA	NA	NA	NA
AYB83257.1|1967260_1968079_+	hypothetical protein	NA	NA	NA	NA	NA
AYB83258.1|1968540_1969563_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP032446	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 chromosome, complete genome	4844133	2661752	2718657	4844133	protease,tail,integrase,tRNA	Moraxella_phage(16.67%)	58	2691535:2691550	2717139:2717154
AYB83921.1|2661752_2662448_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYB83922.1|2662505_2664416_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
AYB83923.1|2664546_2664891_+	RidA family protein	NA	NA	NA	NA	NA
AYB83924.1|2664896_2665076_-	YoaH family protein	NA	NA	NA	NA	NA
AYB83925.1|2665156_2666521_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.5	3.6e-43
AYB83926.1|2666524_2667103_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AYB83927.1|2667366_2668731_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYB83928.1|2668868_2670470_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYB83929.1|2670491_2672051_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
AYB83930.1|2672038_2672374_-	hypothetical protein	NA	NA	NA	NA	NA
AYB83931.1|2672523_2673492_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYB83932.1|2673544_2674345_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYB83933.1|2674357_2675209_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AYB83934.1|2675267_2675726_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AYB85963.1|2676081_2676702_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AYB83935.1|2676698_2677508_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AYB83936.1|2677573_2679319_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AYB83937.1|2679538_2679748_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AYB83938.1|2679760_2679904_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AYB83939.1|2680552_2680840_-	hypothetical protein	NA	NA	NA	NA	NA
AYB83940.1|2680910_2681054_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AYB83941.1|2681211_2681451_+	hypothetical protein	NA	NA	NA	NA	NA
AYB83942.1|2681662_2682454_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYB83943.1|2682629_2684003_+	MFS transporter	NA	NA	NA	NA	NA
AYB83944.1|2684050_2684932_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYB83945.1|2685124_2687173_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AYB83946.1|2687192_2687879_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYB83947.1|2687976_2688561_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AYB83948.1|2688602_2689886_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYB83949.1|2689848_2692488_+	PqiB family protein	NA	NA	NA	NA	NA
2691535:2691550	attL	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB85964.1|2692565_2694005_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AYB83950.1|2694119_2694359_+	DUF1480 family protein	NA	NA	NA	NA	NA
AYB83951.1|2694469_2694661_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYB83952.1|2694679_2695330_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
AYB83953.1|2695553_2695718_-	hypothetical protein	NA	NA	NA	NA	NA
AYB83954.1|2696002_2696725_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AYB83955.1|2697408_2697750_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AYB83956.1|2698131_2698608_+	hypothetical protein	NA	NA	NA	NA	NA
AYB83957.1|2698980_2699400_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB83958.1|2699528_2699723_-	hypothetical protein	NA	NA	NA	NA	NA
AYB83959.1|2699769_2700039_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
AYB83960.1|2700204_2700345_+	hypothetical protein	NA	NA	NA	NA	NA
AYB85965.1|2702653_2702854_-	hypothetical protein	NA	NA	NA	NA	NA
AYB83961.1|2704520_2704679_+	hypothetical protein	NA	NA	NA	NA	NA
AYB83962.1|2704688_2705303_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AYB83963.1|2706055_2706322_-	hypothetical protein	NA	NA	NA	NA	NA
AYB83964.1|2706450_2706576_-	arsenic transporter	NA	NA	NA	NA	NA
AYB83965.1|2706837_2706942_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYB83966.1|2707143_2707344_+	phage virulence factor	NA	NA	NA	NA	NA
AYB83967.1|2708802_2708994_+	hypothetical protein	NA	NA	NA	NA	NA
AYB83968.1|2709058_2709226_+	lytic enzyme	NA	NA	NA	NA	NA
AYB83969.1|2709482_2710016_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	3.2e-11
AYB83970.1|2710012_2710300_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.9	1.6e-38
AYB83971.1|2711433_2712513_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.1e-98
AYB83972.1|2713466_2714267_+	hypothetical protein	NA	NA	NA	NA	NA
AYB83973.1|2714746_2715469_+	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AYB83974.1|2715670_2716240_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	3.4e-96
AYB83975.1|2716239_2718657_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.8	4.7e-86
2717139:2717154	attR	CCGGAATATCGCCACC	NA	NA	NA	NA
>prophage 7
CP032446	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 chromosome, complete genome	4844133	2723022	2760283	4844133	tail,protease,integrase,holin,portal,lysis	Enterobacteria_phage(26.47%)	45	2712514:2712573	2760284:2760448
2712514:2712573	attL	TACTCCAATTTTCGTTGTGAAATAAATGTTAAATTTAATTTGATTGTGATATAACCAAAA	NA	NA	NA	NA
AYB83978.1|2723022_2723754_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	1.0e-113
AYB83979.1|2723763_2724459_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AYB83980.1|2724548_2725082_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AYB83981.1|2725198_2725696_-	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.9	1.4e-16
AYB83982.1|2725794_2726127_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
AYB85966.1|2726123_2729111_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	2.8e-266
AYB83983.1|2729190_2729520_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AYB83984.1|2729516_2729915_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AYB83985.1|2729960_2730710_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	4.8e-90
AYB83986.1|2730721_2731123_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
AYB83987.1|2731119_2731686_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
AYB83988.1|2731666_2731966_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AYB83989.1|2731958_2732282_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AYB85967.1|2734376_2735894_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	4.9e-174
AYB83990.1|2735920_2736127_-	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AYB83991.1|2738217_2738751_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	7.8e-34
AYB85969.1|2738958_2739438_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AYB83992.1|2739455_2739908_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AYB85968.1|2739891_2740221_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AYB83993.1|2740496_2741183_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AYB83994.1|2741543_2741993_+	hypothetical protein	NA	NA	NA	NA	NA
AYB85970.1|2742366_2742891_-	hypothetical protein	NA	NA	NA	NA	NA
AYB83995.1|2742987_2743677_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AYB83996.1|2743806_2744034_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AYB83997.1|2744030_2744630_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
AYB83998.1|2744693_2744999_-	hypothetical protein	NA	NA	NA	NA	NA
AYB83999.1|2745421_2745613_+	hypothetical protein	NA	NA	NA	NA	NA
AYB84000.1|2745630_2747610_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
AYB84001.1|2748006_2749137_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AYB84002.1|2749423_2749819_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
AYB84003.1|2749831_2750293_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.5	3.5e-67
AYB84004.1|2750285_2751284_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.1e-121
AYB84005.1|2751330_2751825_-	hypothetical protein	NA	NA	NA	NA	NA
AYB84006.1|2751811_2752066_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AYB84007.1|2752164_2752563_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
AYB84008.1|2752965_2753232_+	hypothetical protein	NA	NA	NA	NA	NA
AYB84009.1|2753580_2753856_+	hypothetical protein	NA	NA	NA	NA	NA
AYB84010.1|2753859_2754066_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AYB84011.1|2754141_2754477_+	hypothetical protein	NA	NA	NA	NA	NA
AYB84012.1|2754617_2757308_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	72.8	4.0e-118
AYB84013.1|2757300_2758131_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	2.5e-103
AYB84014.1|2758177_2758363_+	DUF1187 family protein	NA	NA	NA	NA	NA
AYB85971.1|2758653_2758890_+	hypothetical protein	NA	NA	NA	NA	NA
AYB84015.1|2758950_2759229_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.8e-10
AYB84016.1|2759203_2760283_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	1.5e-100
2760284:2760448	attR	TACTCCAATTTTCGTTGTGAAATAAATGTTAAATTTAATTTGATTGTGATATAACCAAAAAGACCGGAATACAGAAATTCGGAAAAATTTCGGAAAATTTCGGAAAACGGATCGTAAGCGACTGTTTTATAAGAAAAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 8
CP032446	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 chromosome, complete genome	4844133	2862381	2872089	4844133		Burkholderia_phage(28.57%)	12	NA	NA
AYB84123.1|2862381_2864094_-	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
AYB84124.1|2864258_2864504_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AYB84125.1|2864520_2865438_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AYB84126.1|2865607_2866528_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AYB84127.1|2866516_2866987_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AYB84128.1|2866967_2868398_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
AYB84129.1|2868471_2869167_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AYB84130.1|2869246_2869558_-	hypothetical protein	NA	NA	NA	NA	NA
AYB84131.1|2870207_2870765_+	porin	NA	Q1MVN1	Enterobacteria_phage	68.4	2.0e-64
AYB84132.1|2871020_2871419_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	55.0	2.7e-31
AYB85977.1|2871677_2871866_-	cold-shock protein	NA	NA	NA	NA	NA
AYB84133.1|2871876_2872089_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
>prophage 9
CP032446	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 chromosome, complete genome	4844133	2957007	3000970	4844133	protease,tail	Escherichia_phage(33.33%)	44	NA	NA
AYB84213.1|2957007_2957688_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
AYB84214.1|2958326_2958986_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYB84215.1|2959072_2959402_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AYB84216.1|2959398_2959680_-	acylphosphatase	NA	NA	NA	NA	NA
AYB84217.1|2959728_2960508_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYB84218.1|2960533_2961082_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AYB84219.1|2961296_2962508_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AYB84220.1|2962565_2962883_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AYB84221.1|2962927_2963344_-	CoA-binding protein	NA	NA	NA	NA	NA
AYB84222.1|2963514_2964177_+	DUF2057 family protein	NA	NA	NA	NA	NA
AYB84223.1|2964271_2964730_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AYB84224.1|2964765_2966820_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYB84225.1|2966943_2967390_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AYB84226.1|2967408_2969562_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AYB84227.1|2969548_2970154_-	DNA transformation protein	NA	NA	NA	NA	NA
AYB84228.1|2970370_2970880_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AYB85980.1|2971236_2972289_+	outer membrane protein A	NA	NA	NA	NA	NA
AYB84229.1|2972360_2972813_-	macrodomain Ter protein	NA	NA	NA	NA	NA
AYB84230.1|2972998_2974759_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AYB84231.1|2974827_2975346_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AYB84232.1|2975445_2975613_-	ribosome modulation factor	NA	NA	NA	NA	NA
AYB84233.1|2975868_2976432_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AYB84234.1|2976428_2978069_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AYB84235.1|2978073_2979327_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AYB84236.1|2979341_2981249_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AYB84237.1|2981261_2983370_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AYB84238.1|2983468_2984578_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYB84239.1|2984574_2985117_-	cell division protein ZapC	NA	NA	NA	NA	NA
AYB84240.1|2985282_2986293_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AYB84241.1|2986500_2989113_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AYB84242.1|2989539_2989731_+	DinI family protein	NA	S4TNM0	Salmonella_phage	93.7	1.8e-25
AYB84243.1|2990001_2990688_+	virulence protein	NA	NA	NA	NA	NA
AYB84244.1|2991047_2991674_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AYB84245.1|2992321_2993290_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	3.3e-192
AYB84246.1|2993515_2993764_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
AYB84247.1|2993767_2994349_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AYB84248.1|2994348_2996058_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
AYB84249.1|2996054_2996681_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
AYB84250.1|2996664_2997891_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	63.6	3.2e-147
AYB84251.1|2997887_2998220_-	hypothetical protein	NA	NA	NA	NA	NA
AYB84252.1|2998216_2998933_-	hypothetical protein	NA	NA	NA	NA	NA
AYB84253.1|2998929_2999982_-	hypothetical protein	NA	NA	NA	NA	NA
AYB84254.1|2999981_3000257_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	33.3	1.6e-06
AYB84255.1|3000472_3000970_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.0	8.9e-24
>prophage 10
CP032446	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 chromosome, complete genome	4844133	3007911	3033545	4844133	holin,terminase	Salmonella_phage(72.41%)	32	NA	NA
AYB84263.1|3007911_3008943_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.2	2.5e-73
AYB84264.1|3008960_3009833_-	hypothetical protein	NA	NA	NA	NA	NA
AYB84265.1|3009853_3011428_-	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	2.2e-20
AYB84266.1|3011428_3012304_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.5	1.5e-55
AYB84267.1|3012275_3013706_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	2.6e-92
AYB84268.1|3013705_3014977_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.3	1.1e-83
AYB84269.1|3014966_3015941_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	37.3	1.6e-29
AYB84270.1|3016002_3016416_-	hypothetical protein	NA	NA	NA	NA	NA
AYB84271.1|3016405_3016957_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYB84272.1|3016953_3017568_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	1.2e-107
AYB84273.1|3017570_3017918_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.3e-45
AYB84274.1|3018316_3019114_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.4e-150
AYB84275.1|3019103_3019250_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AYB84276.1|3019246_3019858_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AYB84277.1|3019860_3020067_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AYB84278.1|3020066_3020669_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
AYB84279.1|3020708_3021014_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYB84280.1|3021003_3021243_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYB84281.1|3021398_3021665_-	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYB84282.1|3021758_3022331_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYB84283.1|3022334_3022808_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	4.7e-67
AYB84284.1|3022807_3023332_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYB84285.1|3023328_3023676_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYB84286.1|3023686_3024436_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYB84287.1|3024438_3025422_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AYB84288.1|3025506_3025881_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYB84289.1|3025846_3026083_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
AYB84290.1|3026212_3026617_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYB84291.1|3027326_3030515_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	74.0	0.0e+00
AYB84292.1|3031679_3031919_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AYB84293.1|3031959_3032208_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYB84294.1|3032252_3033545_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.3e-252
>prophage 11
CP032446	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 chromosome, complete genome	4844133	3104513	3111826	4844133	protease,integrase	Ralstonia_phage(16.67%)	7	3099569:3099583	3110562:3110576
3099569:3099583	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYB84346.1|3104513_3104891_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
AYB84347.1|3105052_3105250_+	hypothetical protein	NA	NA	NA	NA	NA
AYB84348.1|3105462_3107739_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AYB84349.1|3107769_3108090_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYB84350.1|3108413_3108635_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYB84351.1|3108764_3110711_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-39
3110562:3110576	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
AYB84352.1|3110707_3111826_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	8.1e-09
>prophage 12
CP032446	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 chromosome, complete genome	4844133	3449284	3494921	4844133	coat,tail,protease,integrase,terminase,holin,portal,lysis	Salmonella_phage(71.64%)	68	3448951:3448991	3494939:3494979
3448951:3448991	attL	GCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
AYB84648.1|3449284_3449647_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
AYB84649.1|3449643_3450570_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	96.7	1.4e-168
AYB84650.1|3450550_3452203_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	38.0	1.5e-83
AYB84651.1|3453686_3454049_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AYB84652.1|3454045_3454978_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
AYB84653.1|3454967_3456425_+	hypothetical protein	NA	E7C9N7	Salmonella_phage	99.8	1.7e-240
AYB84654.1|3456483_3458487_-	endorhamnosidase	NA	E7C9U9	Salmonella_phage	99.9	0.0e+00
AYB84655.1|3458622_3458874_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
AYB86001.1|3458973_3459153_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
AYB84656.1|3459166_3459532_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
AYB84657.1|3459562_3459892_+	hypothetical protein	NA	NA	NA	NA	NA
AYB84658.1|3459909_3461823_-	DNA transfer protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
AYB84659.1|3461822_3463127_-	acyltransferase	NA	E7C9U5	Salmonella_phage	96.3	7.8e-213
AYB84660.1|3463137_3463827_-	DNA transfer protein	NA	E7C9U4	Salmonella_phage	99.6	1.2e-108
AYB84661.1|3463829_3464285_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
AYB84662.1|3464284_3464986_-|tail	phage tail protein	tail	B8K1I3	Salmonella_phage	98.3	8.8e-70
AYB84663.1|3464989_3466408_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.3	3.3e-273
AYB84664.1|3466367_3466868_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
AYB84665.1|3466851_3467412_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.9	1.4e-102
AYB84666.1|3467452_3468745_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.8	1.1e-243
AYB84667.1|3468744_3469656_-	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
AYB84668.1|3469669_3471847_-|portal	portal protein	portal	I6R968	Salmonella_phage	98.3	0.0e+00
AYB84669.1|3471846_3473346_-|terminase	terminase	terminase	A8CGE0	Salmonella_phage	99.8	6.9e-306
AYB84670.1|3473323_3473812_-	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AYB84671.1|3473815_3474220_-	Decoration protein	NA	C6ZR73	Salmonella_phage	100.0	5.3e-67
AYB84672.1|3474219_3474609_-	hypothetical protein	NA	C6ZR72	Salmonella_phage	99.2	1.5e-74
AYB84673.1|3474612_3474855_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AYB84674.1|3475113_3475644_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	4.0e-91
AYB86002.1|3475597_3475822_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	90.3	7.2e-26
AYB84675.1|3475856_3476327_-|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	87.2	1.2e-62
AYB84676.1|3476323_3476761_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
AYB84677.1|3476744_3477071_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
AYB84678.1|3477206_3477404_-	hypothetical protein	NA	C6ZR63	Salmonella_phage	96.2	5.0e-23
AYB84679.1|3477450_3477939_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
AYB84680.1|3478008_3478212_-	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	94.0	5.7e-30
AYB84681.1|3478208_3478604_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	96.9	2.9e-70
AYB84682.1|3478600_3478897_-	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	98.9	7.5e-47
AYB84683.1|3478859_3479036_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.8e-27
AYB84684.1|3479032_3479215_-	NinE family protein	NA	Q716C5	Shigella_phage	96.7	1.8e-27
AYB84685.1|3479181_3479355_-	protein ninD	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
AYB84686.1|3479351_3480224_-	hypothetical protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
AYB84687.1|3480220_3480679_-	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	3.0e-79
AYB84688.1|3480734_3482111_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
AYB84689.1|3482919_3483066_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AYB84690.1|3483100_3483382_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AYB84691.1|3483492_3483708_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
AYB84692.1|3483818_3484508_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
AYB84693.1|3484596_3485520_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	100.0	1.5e-181
AYB84694.1|3485555_3485765_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	5.5e-28
AYB84695.1|3486128_3486461_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	100.0	2.2e-55
AYB84696.1|3486539_3486740_+	restriction endonuclease	NA	A0A1R3Y5S4	Salmonella_virus	100.0	1.0e-31
AYB84697.1|3486779_3487079_+	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	99.0	3.3e-50
AYB84698.1|3487402_3487543_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	2.0e-18
AYB84699.1|3487535_3487649_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
AYB84700.1|3487645_3487834_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
AYB84701.1|3487842_3488550_+	recombinase	NA	E7C9Q0	Salmonella_phage	89.8	9.7e-125
AYB84702.1|3488550_3489057_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	3.8e-91
AYB84703.1|3489065_3489614_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
AYB84704.1|3489629_3489923_+	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	100.0	5.5e-50
AYB84705.1|3489933_3490104_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AYB84706.1|3490100_3490682_+	Eae-like protein	NA	A0A0N6WGF1	Salmonella_phage	71.5	5.2e-68
AYB84707.1|3491066_3491360_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	99.0	4.2e-50
AYB84708.1|3491356_3492439_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.2	6.5e-80
AYB84709.1|3492383_3492713_+	ASCH domain-containing protein	NA	Q9XJG9	Enterobacteria_phage	94.2	1.0e-52
AYB84710.1|3492794_3493106_+	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	99.0	7.9e-55
AYB86003.1|3493183_3493528_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	97.4	1.1e-57
AYB84711.1|3493530_3493902_+	DNA-binding protein	NA	B9UDM0	Salmonella_phage	80.5	2.1e-46
AYB84712.1|3493757_3494921_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	97.1	1.0e-219
3494939:3494979	attR	GCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
>prophage 1
CP032448	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU2-USMARC-69840, complete sequence	77171	18834	56296	77171	integrase,transposase	Escherichia_phage(25.0%)	42	6522:6541	46060:46079
6522:6541	attL	CAAACTTTCACATGTGAAAG	NA	NA	NA	NA
AYB86162.1|18834_19845_-|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
AYB86163.1|19847_20384_-	hypothetical protein	NA	NA	NA	NA	NA
AYB86164.1|20376_20664_-	hypothetical protein	NA	NA	NA	NA	NA
AYB86165.1|20682_21003_-	hypothetical protein	NA	NA	NA	NA	NA
AYB86166.1|21233_21836_+	hypothetical protein	NA	NA	NA	NA	NA
AYB86167.1|22474_22915_-	hypothetical protein	NA	NA	NA	NA	NA
AYB86168.1|22886_27140_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
AYB86238.1|27094_27298_+	hypothetical protein	NA	NA	NA	NA	NA
AYB86169.1|27272_27998_-	hypothetical protein	NA	NA	NA	NA	NA
AYB86170.1|28111_28513_-	hypothetical protein	NA	NA	NA	NA	NA
AYB86171.1|29128_30133_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AYB86172.1|30232_30667_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AYB86173.1|30738_31089_+	mercuric transporter	NA	NA	NA	NA	NA
AYB86174.1|31104_31380_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AYB86175.1|31451_33137_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
AYB86176.1|33151_33790_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
AYB86177.1|33901_34267_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AYB86178.1|34263_34500_+	mercury resistance protein	NA	NA	NA	NA	NA
AYB86179.1|34496_35486_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYB86180.1|35695_36400_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYB86181.1|36439_37276_+	TEM family class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	9.0e-154
AYB86182.1|37951_38314_+	transcriptional regulator	NA	NA	NA	NA	NA
AYB86183.1|38310_38547_+	mercury resistance protein	NA	NA	NA	NA	NA
AYB86184.1|38543_39251_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYB86185.1|39289_40594_+|integrase	integrase	integrase	NA	NA	NA	NA
AYB86186.1|40640_41345_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB86187.1|41534_42350_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AYB86188.1|42502_43207_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB86189.1|43723_43996_-	hypothetical protein	NA	NA	NA	NA	NA
AYB86190.1|44044_45226_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
AYB86191.1|45229_46015_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
AYB86192.1|46188_46500_-	hypothetical protein	NA	NA	NA	NA	NA
46060:46079	attR	CAAACTTTCACATGTGAAAG	NA	NA	NA	NA
AYB86193.1|46806_47622_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AYB86194.1|47682_48486_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AYB86195.1|48485_49322_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AYB86196.1|49627_49870_+	relaxase	NA	NA	NA	NA	NA
AYB86197.1|49901_50579_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYB86198.1|50657_51857_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYB86199.1|52123_52429_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB86200.1|52456_53671_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AYB86201.1|53887_54772_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AYB86202.1|54802_56296_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
