The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032449	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 chromosome, complete genome	4913018	1152815	1218588	4913018	tail,capsid,plate,portal,integrase,transposase,head,tRNA,lysis	Salmonella_phage(87.8%)	64	1155852:1155867	1169119:1169134
AYB77711.1|1152815_1153926_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
AYB77712.1|1154722_1155526_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
1155852:1155867	attL	TCAGCCAGCAGGCTTT	NA	NA	NA	NA
AYB77713.1|1155924_1156518_-	hypothetical protein	NA	NA	NA	NA	NA
AYB77714.1|1156777_1157803_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	99.1	9.2e-201
AYB77715.1|1157806_1158439_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.1e-66
AYB77716.1|1158555_1158795_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
AYB77717.1|1159348_1159582_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
AYB77718.1|1159529_1159988_-	hypothetical protein	NA	NA	NA	NA	NA
AYB77719.1|1160207_1160549_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
AYB77720.1|1160616_1160850_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
AYB77721.1|1160849_1161077_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
AYB77722.1|1161073_1161931_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	99.6	1.5e-164
AYB77723.1|1161927_1164324_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.9	0.0e+00
AYB77724.1|1164479_1164668_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
AYB77725.1|1164736_1165036_-	hypothetical protein	NA	NA	NA	NA	NA
AYB77726.1|1165146_1165953_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	6.2e-51
AYB77727.1|1166445_1167600_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYB77728.1|1168379_1169411_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.0	5.0e-170
1169119:1169134	attR	AAAGCCTGCTGGCTGA	NA	NA	NA	NA
AYB77729.1|1169410_1171177_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
AYB77730.1|1171319_1172153_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	5.9e-121
AYB77731.1|1172169_1173228_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	4.9e-181
AYB77732.1|1173231_1173882_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYB77733.1|1173977_1174442_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
AYB77734.1|1174441_1174645_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYB77735.1|1174648_1174864_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYB81170.1|1174883_1175357_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYB77736.1|1175358_1175736_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	5.1e-16
AYB77737.1|1175732_1176161_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	1.3e-47
AYB77738.1|1176090_1176294_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	8.9e-23
AYB77739.1|1176256_1176688_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
AYB77740.1|1176680_1177127_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	3.1e-60
AYB77741.1|1177153_1178020_-	hypothetical protein	NA	NA	NA	NA	NA
AYB77742.1|1178115_1178694_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.8e-92
AYB77743.1|1178690_1179050_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	91.5	3.5e-54
AYB77744.1|1179036_1179945_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.0	7.2e-157
AYB77745.1|1179937_1180543_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
AYB77746.1|1180539_1182225_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	50.6	3.5e-128
AYB77747.1|1182227_1182755_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AYB77748.1|1182885_1184058_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
AYB77749.1|1184067_1184583_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYB77750.1|1184637_1184940_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
AYB77751.1|1184954_1185074_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
AYB77752.1|1185066_1187874_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.0	0.0e+00
AYB77753.1|1187870_1188356_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AYB77754.1|1188352_1189453_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	9.0e-194
AYB81171.1|1189521_1189740_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AYB81172.1|1190291_1191455_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYB77755.1|1193634_1195044_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AYB77756.1|1195108_1206328_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AYB81173.1|1206942_1207425_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AYB77757.1|1207574_1208051_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYB77758.1|1208040_1208331_+	RnfH family protein	NA	NA	NA	NA	NA
AYB77759.1|1208496_1208835_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYB77760.1|1208983_1210645_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AYB81175.1|1210730_1211609_-	NAD(+) kinase	NA	NA	NA	NA	NA
AYB81174.1|1211732_1212323_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYB77761.1|1212357_1212963_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB77762.1|1213083_1214325_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYB77763.1|1214389_1215181_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYB77764.1|1215126_1215423_-	hypothetical protein	NA	NA	NA	NA	NA
AYB77765.1|1215346_1216708_+	signal recognition particle protein	NA	NA	NA	NA	NA
AYB77766.1|1216960_1217209_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYB77767.1|1217227_1217776_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYB77768.1|1217820_1218588_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
CP032449	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 chromosome, complete genome	4913018	1455983	1555035	4913018	tail,protease,integrase,transposase,head,tRNA	Salmonella_phage(20.83%)	103	1500752:1500766	1508366:1508380
AYB77962.1|1455983_1457399_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AYB77963.1|1457452_1457845_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYB77964.1|1457846_1458209_-	hypothetical protein	NA	NA	NA	NA	NA
AYB77965.1|1458228_1458429_+	hypothetical protein	NA	NA	NA	NA	NA
AYB77966.1|1458814_1461004_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AYB77967.1|1461056_1462259_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AYB77968.1|1462601_1463843_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AYB77969.1|1463903_1464230_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AYB77970.1|1464343_1465342_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
AYB77971.1|1467194_1468430_-	ion channel protein	NA	NA	NA	NA	NA
AYB77972.1|1468633_1469599_+	glucokinase	NA	NA	NA	NA	NA
AYB77973.1|1470321_1471560_+	alanine transaminase	NA	NA	NA	NA	NA
AYB81182.1|1471609_1471681_-	membrane protein YpdK	NA	NA	NA	NA	NA
AYB77974.1|1472083_1473004_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
AYB77975.1|1473525_1473768_+	DUF2545 family protein	NA	NA	NA	NA	NA
AYB77976.1|1474042_1475434_-	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
AYB77977.1|1475607_1475826_+	hypothetical protein	NA	NA	NA	NA	NA
AYB77978.1|1475869_1477063_+	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
AYB77979.1|1477059_1479066_+	two-component system sensor histidine kinase PgtB	NA	NA	NA	NA	NA
AYB77980.1|1479055_1480303_+	two-component system response regulator PgtA	NA	NA	NA	NA	NA
AYB77981.1|1480570_1481509_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
AYB77982.1|1481694_1481925_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	5.4e-08
AYB77983.1|1481863_1482007_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
AYB77984.1|1482996_1484919_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	76.9	8.1e-299
AYB77985.1|1484936_1485191_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
AYB81183.1|1485159_1485549_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
AYB81184.1|1486377_1486956_+	hypothetical protein	NA	NA	NA	NA	NA
AYB77986.1|1487594_1488035_-	hypothetical protein	NA	NA	NA	NA	NA
AYB77987.1|1488006_1492260_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
AYB81185.1|1492214_1492418_+	hypothetical protein	NA	NA	NA	NA	NA
AYB77988.1|1492392_1493118_-	hypothetical protein	NA	NA	NA	NA	NA
AYB77989.1|1493231_1493633_-	hypothetical protein	NA	NA	NA	NA	NA
AYB77990.1|1494248_1495253_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AYB77991.1|1495352_1495787_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AYB77992.1|1495858_1496209_+	mercuric transporter	NA	NA	NA	NA	NA
AYB77993.1|1496224_1496500_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AYB77994.1|1496571_1498257_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
AYB77995.1|1498271_1498910_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
AYB77996.1|1499021_1499387_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AYB77997.1|1499383_1499620_+	mercury resistance protein	NA	NA	NA	NA	NA
AYB77998.1|1499616_1500606_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
1500752:1500766	attL	GGGCACTGTTGCAAA	NA	NA	NA	NA
AYB77999.1|1500815_1501520_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYB78000.1|1501559_1502396_+	TEM family class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	9.0e-154
AYB78001.1|1503071_1503434_+	transcriptional regulator	NA	NA	NA	NA	NA
AYB78002.1|1503430_1503667_+	mercury resistance protein	NA	NA	NA	NA	NA
AYB78003.1|1503663_1504371_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYB78004.1|1504409_1505714_+|integrase	integrase	integrase	NA	NA	NA	NA
AYB78005.1|1505760_1506465_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB78006.1|1506654_1507470_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AYB78007.1|1507622_1508327_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB78008.1|1508947_1510093_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
1508366:1508380	attR	TTTGCAACAGTGCCC	NA	NA	NA	NA
AYB78009.1|1510416_1511679_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AYB78010.1|1511963_1512356_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AYB78011.1|1512359_1512938_-	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AYB78012.1|1512934_1514251_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AYB78013.1|1514247_1515165_-	conjugal transfer protein TraK	NA	NA	NA	NA	NA
AYB78014.1|1515148_1515775_-	pilus assembly protein	NA	NA	NA	NA	NA
AYB78015.1|1515771_1516053_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AYB78016.1|1516197_1516575_-	hypothetical protein	NA	NA	NA	NA	NA
AYB78017.1|1516898_1517561_-	hypothetical protein	NA	NA	NA	NA	NA
AYB78018.1|1517560_1517938_-	hypothetical protein	NA	NA	NA	NA	NA
AYB78019.1|1517947_1518394_-	hypothetical protein	NA	NA	NA	NA	NA
AYB78020.1|1518403_1519033_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
AYB78021.1|1518989_1519574_-	hypothetical protein	NA	NA	NA	NA	NA
AYB78022.1|1519584_1521450_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AYB78023.1|1521446_1524419_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AYB78024.1|1524586_1525204_+	hypothetical protein	NA	NA	NA	NA	NA
AYB78025.1|1525185_1525419_+	hypothetical protein	NA	NA	NA	NA	NA
AYB78026.1|1525418_1527611_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
AYB78027.1|1527625_1528114_+	hypothetical protein	NA	NA	NA	NA	NA
AYB78028.1|1528204_1528504_-	ASCH domain-containing protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
AYB78029.1|1528508_1528715_-	hypothetical protein	NA	NA	NA	NA	NA
AYB78030.1|1528715_1529333_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AYB78031.1|1529388_1530045_-	hypothetical protein	NA	NA	NA	NA	NA
AYB78032.1|1530044_1531472_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
AYB78033.1|1531475_1531976_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
AYB78034.1|1531984_1532317_-	hypothetical protein	NA	NA	NA	NA	NA
AYB81186.1|1532301_1532733_-	hypothetical protein	NA	NA	NA	NA	NA
AYB78035.1|1532800_1533475_-	thymidylate kinase	NA	NA	NA	NA	NA
AYB78036.1|1533449_1533731_-	hypothetical protein	NA	NA	NA	NA	NA
AYB78037.1|1533723_1534101_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
AYB78038.1|1534662_1535298_+	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AYB78039.1|1535350_1535623_-	hypothetical protein	NA	NA	NA	NA	NA
AYB78040.1|1535671_1536853_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
AYB78041.1|1536856_1537642_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
AYB78042.1|1537815_1538127_-	hypothetical protein	NA	NA	NA	NA	NA
AYB78043.1|1538433_1539249_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AYB78044.1|1539309_1540113_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AYB78045.1|1540112_1540949_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AYB78046.1|1541254_1541497_+	relaxase	NA	NA	NA	NA	NA
AYB78047.1|1541528_1542206_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYB78048.1|1542284_1543484_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYB78049.1|1543750_1544056_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB78050.1|1544083_1545298_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AYB78051.1|1545514_1546399_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AYB78052.1|1546429_1547923_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYB78053.1|1548133_1548358_-	hypothetical protein	NA	NA	NA	NA	NA
AYB78054.1|1548354_1549092_-	resolvase	NA	NA	NA	NA	NA
AYB78055.1|1549198_1549690_+	hypothetical protein	NA	NA	NA	NA	NA
AYB78056.1|1549723_1550428_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB78057.1|1550978_1551683_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB78058.1|1552303_1553449_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
AYB78059.1|1553772_1555035_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 3
CP032449	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 chromosome, complete genome	4913018	1792805	1801976	4913018	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYB78275.1|1792805_1793753_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AYB78276.1|1793736_1794468_+	ABC transporter permease	NA	NA	NA	NA	NA
AYB78277.1|1794448_1794556_-	protein YohO	NA	NA	NA	NA	NA
AYB78278.1|1794615_1795347_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	2.2e-100
AYB78279.1|1795569_1797255_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.4e-278
AYB78280.1|1797251_1797971_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYB78281.1|1798017_1798485_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	8.8e-74
AYB78282.1|1798541_1799072_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYB78283.1|1799243_1799702_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	71.2	7.1e-52
AYB78284.1|1799942_1801976_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	2.1e-55
>prophage 4
CP032449	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 chromosome, complete genome	4913018	1869172	1879679	4913018		Enterobacteria_phage(37.5%)	10	NA	NA
AYB78335.1|1869172_1870576_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
AYB78336.1|1870753_1871647_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYB78337.1|1872023_1873109_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYB78338.1|1873108_1874008_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AYB81197.1|1874055_1874934_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AYB78339.1|1874934_1875486_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AYB78340.1|1875491_1876466_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AYB78341.1|1876481_1877255_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYB78342.1|1877259_1878339_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
AYB78343.1|1878365_1879679_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
CP032449	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 chromosome, complete genome	4913018	1992606	2038816	4913018	tail,capsid,plate,holin,integrase,transposase,head,terminase	Salmonella_phage(84.91%)	64	1990578:1990592	2010898:2010912
1990578:1990592	attL	TTATCAATGACATCT	NA	NA	NA	NA
AYB81204.1|1992606_1993881_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.1	8.2e-74
AYB78453.1|1994236_1995034_-	protein MtfA	NA	NA	NA	NA	NA
AYB78454.1|1995325_1996315_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AYB78455.1|1996316_1996559_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	98.8	2.1e-39
AYB78456.1|1996583_1997153_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	91.0	5.8e-104
AYB78457.1|1997149_1997899_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	83.6	1.1e-46
AYB78458.1|1997902_1998376_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.3	5.0e-69
AYB78459.1|1998375_1999113_-	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	86.3	1.8e-52
AYB78460.1|1999183_1999723_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AYB78461.1|1999859_2000687_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	97.5	1.0e-149
AYB78462.1|2000744_2001116_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AYB78463.1|2001652_2001898_+	hypothetical protein	NA	NA	NA	NA	NA
AYB78464.1|2001815_2002112_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	98.0	1.1e-50
AYB78465.1|2002092_2002344_-	hypothetical protein	NA	NA	NA	NA	NA
AYB78466.1|2002271_2002457_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
AYB78467.1|2002661_2003357_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
AYB78468.1|2003330_2003516_+	amino acid permease	NA	NA	NA	NA	NA
AYB78469.1|2003454_2003679_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AYB78470.1|2003707_2004262_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	5.9e-101
AYB78471.1|2004258_2005401_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.6	1.6e-182
AYB78472.1|2005397_2005622_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AYB78473.1|2005618_2006593_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	98.1	1.2e-165
AYB78474.1|2006589_2007063_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	93.8	6.6e-53
AYB78475.1|2007059_2007941_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	1.1e-170
AYB78476.1|2007949_2008339_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
AYB78477.1|2008310_2009216_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	2.8e-161
AYB81205.1|2009223_2010213_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	3.0e-188
AYB78478.1|2010226_2010979_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	2.4e-134
2010898:2010912	attR	AGATGTCATTGATAA	NA	NA	NA	NA
AYB78479.1|2011010_2011199_+	hypothetical protein	NA	NA	NA	NA	NA
AYB78480.1|2011267_2011510_+	hypothetical protein	NA	NA	NA	NA	NA
AYB78481.1|2011641_2011995_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	88.7	1.0e-50
AYB78482.1|2011998_2012475_+	lysozyme	NA	Q8SBE0	Shigella_phage	96.8	1.7e-85
AYB78483.1|2012458_2012851_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	92.3	1.6e-57
AYB78484.1|2012735_2013008_+	peptidase	NA	Q8SBD8	Shigella_phage	77.6	3.8e-29
AYB78485.1|2013376_2013811_+	hypothetical protein	NA	NA	NA	NA	NA
AYB78486.1|2013938_2014289_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	8.0e-64
AYB78487.1|2014406_2014910_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	3.6e-89
AYB78488.1|2014906_2016640_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
AYB78489.1|2016651_2016834_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
AYB78490.1|2018716_2019922_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
AYB78491.1|2019972_2020173_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
AYB78492.1|2020175_2020499_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
AYB78493.1|2020495_2020900_+|head,tail	head-tail adaptor protein	head,tail	A0A192Y6C2	Salmonella_phage	99.3	5.4e-72
AYB78494.1|2020871_2021384_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
AYB78495.1|2021380_2021941_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	99.5	8.8e-105
AYB78496.1|2021944_2022109_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
AYB78497.1|2022098_2023595_+|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	99.8	6.1e-278
AYB78498.1|2023594_2023951_+|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AYB78499.1|2023947_2024274_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
AYB78500.1|2024358_2026287_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.7	0.0e+00
AYB78501.1|2026320_2027661_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
AYB78502.1|2027657_2028722_+|plate	baseplate protein	plate	Q8HAC0	Salmonella_phage	95.1	4.2e-188
AYB78503.1|2028714_2029248_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
AYB78504.1|2029252_2029666_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AYB78505.1|2029658_2030738_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
AYB78506.1|2030740_2031328_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AYB78507.1|2031314_2032877_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	100.0	2.6e-287
AYB78508.1|2032876_2033446_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
AYB78509.1|2033730_2034738_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
AYB78510.1|2034949_2035171_+	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AYB78511.1|2035534_2035717_+	hypothetical protein	NA	NA	NA	NA	NA
AYB78512.1|2036109_2036487_+	hypothetical protein	NA	NA	NA	NA	NA
AYB78513.1|2036513_2037332_+	hypothetical protein	NA	NA	NA	NA	NA
AYB78514.1|2037793_2038816_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP032449	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 chromosome, complete genome	4913018	2731009	2829543	4913018	tail,protease,holin,portal,integrase,terminase,tRNA,lysis	Enterobacteria_phage(24.0%)	108	2760792:2760807	2829544:2829708
AYB79179.1|2731009_2731705_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYB79180.1|2731762_2733673_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
AYB79181.1|2733803_2734148_+	RidA family protein	NA	NA	NA	NA	NA
AYB79182.1|2734153_2734333_-	YoaH family protein	NA	NA	NA	NA	NA
AYB79183.1|2734413_2735778_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.5	3.6e-43
AYB79184.1|2735781_2736360_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AYB79185.1|2736623_2737988_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYB79186.1|2738125_2739727_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYB79187.1|2739748_2741308_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
AYB79188.1|2741295_2741631_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79189.1|2741780_2742749_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYB79190.1|2742801_2743602_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYB79191.1|2743614_2744466_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AYB79192.1|2744524_2744983_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AYB81236.1|2745338_2745959_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AYB79193.1|2745955_2746765_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AYB79194.1|2746830_2748576_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AYB79195.1|2748795_2749005_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AYB79196.1|2749017_2749161_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AYB79197.1|2749809_2750097_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79198.1|2750167_2750311_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AYB79199.1|2750468_2750708_+	hypothetical protein	NA	NA	NA	NA	NA
AYB79200.1|2750919_2751711_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYB79201.1|2751886_2753260_+	MFS transporter	NA	NA	NA	NA	NA
AYB79202.1|2753307_2754189_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYB79203.1|2754381_2756430_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AYB79204.1|2756449_2757136_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYB79205.1|2757233_2757818_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AYB79206.1|2757859_2759143_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYB79207.1|2759105_2761745_+	PqiB family protein	NA	NA	NA	NA	NA
2760792:2760807	attL	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB81237.1|2761822_2763262_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
2760792:2760807	attL	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB79208.1|2763376_2763616_+	DUF1480 family protein	NA	NA	NA	NA	NA
AYB79209.1|2763726_2763918_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYB79210.1|2763936_2764587_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
AYB79211.1|2764810_2764975_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79212.1|2765259_2765982_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AYB79213.1|2766665_2767007_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AYB79214.1|2767388_2767865_+	hypothetical protein	NA	NA	NA	NA	NA
AYB79215.1|2768237_2768657_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB79216.1|2768785_2768980_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79217.1|2769026_2769296_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
AYB79218.1|2769461_2769602_+	hypothetical protein	NA	NA	NA	NA	NA
AYB81238.1|2771910_2772111_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79219.1|2773777_2773936_+	hypothetical protein	NA	NA	NA	NA	NA
AYB79220.1|2773945_2774560_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AYB79221.1|2775312_2775579_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79222.1|2775707_2775833_-	arsenic transporter	NA	NA	NA	NA	NA
AYB79223.1|2776094_2776199_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYB79224.1|2776400_2776601_+	phage virulence factor	NA	NA	NA	NA	NA
AYB79225.1|2778059_2778251_+	hypothetical protein	NA	NA	NA	NA	NA
AYB79226.1|2778315_2778483_+	lytic enzyme	NA	NA	NA	NA	NA
AYB79227.1|2778739_2779273_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	3.2e-11
AYB79228.1|2779269_2779557_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.9	1.6e-38
AYB79229.1|2780690_2781770_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.1e-98
AYB79230.1|2782723_2783524_+	hypothetical protein	NA	NA	NA	NA	NA
AYB79231.1|2784003_2784726_+	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AYB79232.1|2784927_2785497_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	3.4e-96
AYB79233.1|2785496_2787914_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.8	4.7e-86
2786396:2786411	attR	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB79234.1|2787967_2788210_-	hypothetical protein	NA	NA	NA	NA	NA
2786396:2786411	attR	CCGGAATATCGCCACC	NA	NA	NA	NA
AYB79235.1|2788248_2789112_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
AYB79236.1|2791672_2792377_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
AYB79237.1|2792280_2793012_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	1.0e-113
AYB79238.1|2793021_2793717_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AYB79239.1|2793806_2794340_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AYB79240.1|2794456_2794954_-	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.9	1.4e-16
AYB79241.1|2795052_2795385_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
AYB81239.1|2795381_2798369_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	2.8e-266
AYB79242.1|2798448_2798778_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AYB79243.1|2798774_2799173_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AYB79244.1|2799218_2799968_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	4.8e-90
AYB79245.1|2799979_2800381_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
AYB79246.1|2800377_2800944_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
AYB79247.1|2800924_2801224_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AYB79248.1|2801216_2801540_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AYB81241.1|2801630_2803712_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AYB81240.1|2803635_2805153_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	4.9e-174
AYB79249.1|2805179_2805386_-	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AYB79250.1|2805382_2807521_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AYB79251.1|2807477_2808011_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	7.8e-34
AYB81243.1|2808218_2808698_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AYB79252.1|2808715_2809168_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AYB81242.1|2809151_2809481_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AYB79253.1|2809756_2810443_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AYB79254.1|2810803_2811253_+	hypothetical protein	NA	NA	NA	NA	NA
AYB81244.1|2811626_2812151_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79255.1|2812247_2812937_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AYB79256.1|2813066_2813294_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AYB79257.1|2813290_2813890_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
AYB79258.1|2813953_2814259_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79259.1|2814681_2814873_+	hypothetical protein	NA	NA	NA	NA	NA
AYB79260.1|2814890_2816870_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
AYB79261.1|2817266_2818397_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AYB79262.1|2818683_2819079_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
AYB79263.1|2819091_2819553_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.5	3.5e-67
AYB79264.1|2819545_2820544_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.1e-121
AYB79265.1|2820590_2821085_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79266.1|2821071_2821326_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AYB79267.1|2821424_2821823_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
AYB79268.1|2822225_2822492_+	hypothetical protein	NA	NA	NA	NA	NA
AYB79269.1|2822840_2823116_+	hypothetical protein	NA	NA	NA	NA	NA
AYB79270.1|2823119_2823326_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AYB79271.1|2823401_2823737_+	hypothetical protein	NA	NA	NA	NA	NA
AYB79272.1|2823877_2826568_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	72.8	4.0e-118
AYB79273.1|2826560_2827391_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	2.5e-103
AYB79274.1|2827437_2827623_+	DUF1187 family protein	NA	NA	NA	NA	NA
AYB81245.1|2827913_2828150_+	hypothetical protein	NA	NA	NA	NA	NA
AYB79275.1|2828210_2828489_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.8e-10
AYB79276.1|2828463_2829543_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	1.5e-100
2829544:2829708	attR	TACTCCAATTTTCGTTGTGAAATAAATGTTAAATTTAATTTGATTGTGATATAACCAAAAAGACCGGAATACAGAAATTCGGAAAAATTTCGGAAAATTTCGGAAAACGGATCGTAAGCGACTGTTTTATAAGAAAAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
CP032449	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 chromosome, complete genome	4913018	2931642	2941350	4913018		Burkholderia_phage(28.57%)	12	NA	NA
AYB79384.1|2931642_2933355_-	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
AYB79385.1|2933519_2933765_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AYB79386.1|2933781_2934699_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AYB79387.1|2934868_2935789_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AYB79388.1|2935777_2936248_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AYB79389.1|2936228_2937659_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
AYB79390.1|2937732_2938428_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AYB79391.1|2938507_2938819_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79392.1|2939468_2940026_+	porin	NA	Q1MVN1	Enterobacteria_phage	68.4	2.0e-64
AYB79393.1|2940281_2940680_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	55.0	2.7e-31
AYB81251.1|2940938_2941127_-	cold-shock protein	NA	NA	NA	NA	NA
AYB79394.1|2941137_2941350_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
>prophage 8
CP032449	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 chromosome, complete genome	4913018	3026270	3070233	4913018	protease,tail	Escherichia_phage(33.33%)	44	NA	NA
AYB79475.1|3026270_3026951_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
AYB79476.1|3027589_3028249_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYB79477.1|3028335_3028665_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AYB79478.1|3028661_3028943_-	acylphosphatase	NA	NA	NA	NA	NA
AYB79479.1|3028991_3029771_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYB79480.1|3029796_3030345_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AYB79481.1|3030559_3031771_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AYB79482.1|3031828_3032146_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AYB79483.1|3032190_3032607_-	CoA-binding protein	NA	NA	NA	NA	NA
AYB79484.1|3032777_3033440_+	DUF2057 family protein	NA	NA	NA	NA	NA
AYB79485.1|3033534_3033993_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AYB79486.1|3034028_3036083_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYB79487.1|3036206_3036653_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AYB79488.1|3036671_3038825_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AYB79489.1|3038811_3039417_-	DNA transformation protein	NA	NA	NA	NA	NA
AYB79490.1|3039633_3040143_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AYB81254.1|3040499_3041552_+	outer membrane protein A	NA	NA	NA	NA	NA
AYB79491.1|3041623_3042076_-	macrodomain Ter protein	NA	NA	NA	NA	NA
AYB79492.1|3042261_3044022_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AYB79493.1|3044090_3044609_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AYB79494.1|3044708_3044876_-	ribosome modulation factor	NA	NA	NA	NA	NA
AYB79495.1|3045131_3045695_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AYB79496.1|3045691_3047332_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AYB79497.1|3047336_3048590_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AYB79498.1|3048604_3050512_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AYB79499.1|3050524_3052633_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AYB79500.1|3052731_3053841_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYB79501.1|3053837_3054380_-	cell division protein ZapC	NA	NA	NA	NA	NA
AYB79502.1|3054545_3055556_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AYB79503.1|3055763_3058376_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AYB79504.1|3058802_3058994_+	DinI family protein	NA	S4TNM0	Salmonella_phage	93.7	1.8e-25
AYB79505.1|3059264_3059951_+	virulence protein	NA	NA	NA	NA	NA
AYB79506.1|3060310_3060937_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AYB79507.1|3061584_3062553_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	3.3e-192
AYB79508.1|3062778_3063027_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
AYB79509.1|3063030_3063612_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AYB79510.1|3063611_3065321_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
AYB79511.1|3065317_3065944_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
AYB79512.1|3065927_3067154_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	63.6	3.2e-147
AYB79513.1|3067150_3067483_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79514.1|3067479_3068196_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79515.1|3068192_3069245_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79516.1|3069244_3069520_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	33.3	1.6e-06
AYB79517.1|3069735_3070233_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.0	8.9e-24
>prophage 9
CP032449	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 chromosome, complete genome	4913018	3077175	3102809	4913018	terminase,holin	Salmonella_phage(72.41%)	32	NA	NA
AYB79525.1|3077175_3078207_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.2	2.5e-73
AYB79526.1|3078224_3079097_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79527.1|3079117_3080692_-	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	2.2e-20
AYB79528.1|3080692_3081568_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.5	1.5e-55
AYB79529.1|3081539_3082970_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	2.6e-92
AYB79530.1|3082969_3084241_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.3	1.1e-83
AYB79531.1|3084230_3085205_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	37.3	1.6e-29
AYB79532.1|3085266_3085680_-	hypothetical protein	NA	NA	NA	NA	NA
AYB79533.1|3085669_3086221_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYB79534.1|3086217_3086832_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	1.2e-107
AYB79535.1|3086834_3087182_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.3e-45
AYB79536.1|3087580_3088378_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.4e-150
AYB79537.1|3088367_3088514_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AYB79538.1|3088510_3089122_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AYB79539.1|3089124_3089331_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AYB79540.1|3089330_3089933_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
AYB79541.1|3089972_3090278_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYB79542.1|3090267_3090507_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYB79543.1|3090662_3090929_-	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYB79544.1|3091022_3091595_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYB79545.1|3091598_3092072_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	4.7e-67
AYB79546.1|3092071_3092596_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYB79547.1|3092592_3092940_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYB79548.1|3092950_3093700_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYB79549.1|3093702_3094686_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AYB79550.1|3094770_3095145_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYB79551.1|3095110_3095347_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
AYB79552.1|3095476_3095881_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYB79553.1|3096590_3099779_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	74.0	0.0e+00
AYB79554.1|3100943_3101183_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AYB79555.1|3101223_3101472_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYB79556.1|3101516_3102809_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.3e-252
>prophage 10
CP032449	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 chromosome, complete genome	4913018	3173778	3181091	4913018	integrase,protease	Ralstonia_phage(16.67%)	7	3168834:3168848	3179827:3179841
3168834:3168848	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYB79609.1|3173778_3174156_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
AYB79610.1|3174317_3174515_+	hypothetical protein	NA	NA	NA	NA	NA
AYB79611.1|3174727_3177004_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AYB79612.1|3177034_3177355_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYB79613.1|3177678_3177900_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYB79614.1|3178029_3179976_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-39
3179827:3179841	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
AYB79615.1|3179972_3181091_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	8.1e-09
>prophage 11
CP032449	Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 chromosome, complete genome	4913018	3518546	3564182	4913018	tail,protease,holin,portal,integrase,coat,terminase,lysis	Salmonella_phage(71.21%)	67	3518213:3518253	3564200:3564240
3518213:3518253	attL	GCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
AYB79909.1|3518546_3518909_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
AYB79910.1|3518905_3519832_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	96.7	1.4e-168
AYB79911.1|3519812_3521465_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	38.0	1.5e-83
AYB79912.1|3522948_3523311_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AYB79913.1|3523307_3524240_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
AYB79914.1|3524229_3525687_+	hypothetical protein	NA	E7C9N7	Salmonella_phage	99.8	1.7e-240
AYB79915.1|3527883_3528135_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
AYB81275.1|3528234_3528414_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
AYB79916.1|3528427_3528793_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
AYB79917.1|3528823_3529153_+	hypothetical protein	NA	NA	NA	NA	NA
AYB79918.1|3529170_3531084_-	DNA transfer protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
AYB79919.1|3531083_3532388_-	acyltransferase	NA	E7C9U5	Salmonella_phage	96.3	7.8e-213
AYB79920.1|3532398_3533088_-	DNA transfer protein	NA	E7C9U4	Salmonella_phage	99.6	1.2e-108
AYB79921.1|3533090_3533546_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
AYB79922.1|3533545_3534247_-|tail	phage tail protein	tail	B8K1I3	Salmonella_phage	98.3	8.8e-70
AYB79923.1|3534250_3535669_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.3	3.3e-273
AYB79924.1|3535628_3536129_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
AYB79925.1|3536112_3536673_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.9	1.4e-102
AYB79926.1|3536713_3538006_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.8	1.1e-243
AYB79927.1|3538005_3538917_-	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
AYB79928.1|3538930_3541108_-|portal	portal protein	portal	I6R968	Salmonella_phage	98.3	0.0e+00
AYB79929.1|3541107_3542607_-|terminase	terminase	terminase	A8CGE0	Salmonella_phage	99.8	6.9e-306
AYB79930.1|3542584_3543073_-	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AYB79931.1|3543076_3543481_-	Decoration protein	NA	C6ZR73	Salmonella_phage	100.0	5.3e-67
AYB79932.1|3543480_3543870_-	hypothetical protein	NA	C6ZR72	Salmonella_phage	99.2	1.5e-74
AYB79933.1|3543873_3544116_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AYB79934.1|3544374_3544905_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	4.0e-91
AYB79935.1|3544858_3545083_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	90.3	7.2e-26
AYB79936.1|3545117_3545588_-|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	87.2	1.2e-62
AYB79937.1|3545584_3546022_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
AYB79938.1|3546005_3546332_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
AYB79939.1|3546467_3546665_-	hypothetical protein	NA	C6ZR63	Salmonella_phage	96.2	5.0e-23
AYB79940.1|3546711_3547200_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
AYB79941.1|3547269_3547473_-	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	94.0	5.7e-30
AYB79942.1|3547469_3547865_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	96.9	2.9e-70
AYB79943.1|3547861_3548158_-	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	98.9	7.5e-47
AYB79944.1|3548120_3548297_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.8e-27
AYB79945.1|3548293_3548476_-	NinE family protein	NA	Q716C5	Shigella_phage	96.7	1.8e-27
AYB79946.1|3548442_3548616_-	protein ninD	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
AYB79947.1|3548612_3549485_-	hypothetical protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
AYB79948.1|3549481_3549940_-	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	3.0e-79
AYB79949.1|3549995_3551372_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
AYB79950.1|3552180_3552327_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AYB79951.1|3552361_3552643_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AYB79952.1|3552753_3552969_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
AYB79953.1|3553079_3553769_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
AYB79954.1|3553857_3554781_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	100.0	1.5e-181
AYB79955.1|3554816_3555026_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	5.5e-28
AYB79956.1|3555389_3555722_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	100.0	2.2e-55
AYB79957.1|3555800_3556001_+	restriction endonuclease	NA	A0A1R3Y5S4	Salmonella_virus	100.0	1.0e-31
AYB79958.1|3556040_3556340_+	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	99.0	3.3e-50
AYB79959.1|3556663_3556804_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	2.0e-18
AYB79960.1|3556796_3556910_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
AYB79961.1|3556906_3557095_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
AYB79962.1|3557103_3557811_+	recombinase	NA	E7C9Q0	Salmonella_phage	89.8	9.7e-125
AYB79963.1|3557811_3558318_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	3.8e-91
AYB79964.1|3558326_3558875_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
AYB79965.1|3558890_3559184_+	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	100.0	5.5e-50
AYB79966.1|3559194_3559365_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AYB79967.1|3559361_3559943_+	Eae-like protein	NA	A0A0N6WGF1	Salmonella_phage	71.5	5.2e-68
AYB79968.1|3560327_3560621_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	99.0	4.2e-50
AYB79969.1|3560617_3561700_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.2	6.5e-80
AYB79970.1|3561644_3561974_+	ASCH domain-containing protein	NA	Q9XJG9	Enterobacteria_phage	94.2	1.0e-52
AYB79971.1|3562055_3562367_+	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	99.0	7.9e-55
AYB81276.1|3562444_3562789_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	97.4	1.1e-57
AYB79972.1|3562791_3563163_+	DNA-binding protein	NA	B9UDM0	Salmonella_phage	80.5	2.1e-46
AYB79973.1|3563018_3564182_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	97.1	1.0e-219
3564200:3564240	attR	GCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
