The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	7317	59992	5577844	holin,head,plate,capsid,tail,transposase	Brevibacillus_phage(24.14%)	60	NA	NA
AYB36799.1|7317_8736_+|capsid	phage major capsid protein	capsid	A0A1B1IQC5	uncultured_Mediterranean_phage	33.6	3.0e-40
AYB36800.1|8787_9051_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36801.1|9050_9605_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AYB36802.1|9658_10150_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36803.1|10146_10497_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36804.1|10483_10975_+	hypothetical protein	NA	A0A1L2JY58	Aeribacillus_phage	32.1	1.1e-10
AYB36805.1|10964_11963_+	DUF3383 family protein	NA	A0A1L2JZ70	Aeribacillus_phage	44.2	2.8e-69
AYB36806.1|11974_12373_+	DUF3277 family protein	NA	A0A1L2K2P1	Aeribacillus_phage	49.2	3.8e-25
AYB36807.1|12400_12724_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36808.1|12922_13603_+	hypothetical protein	NA	M4ZR40	Bacillus_phage	36.3	8.7e-22
AYB36809.1|13862_15188_+	hypothetical protein	NA	A0A1J0MCL0	Streptomyces_phage	32.5	1.7e-13
AYB36810.1|15187_15682_+	hypothetical protein	NA	E5DV59	Deep-sea_thermophilic_phage	33.1	6.5e-11
AYB36811.1|15691_16012_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36812.1|16004_16796_+	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	45.5	7.9e-59
AYB36813.1|16792_17191_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36814.1|17169_17532_+	DUF2634 domain-containing protein	NA	E5DV62	Deep-sea_thermophilic_phage	35.7	2.8e-11
AYB36815.1|17521_18685_+|plate	baseplate J/gp47 family protein	plate	A0A1L2JY69	Aeribacillus_phage	43.7	2.0e-87
AYB36816.1|18660_19278_+	DUF2612 domain-containing protein	NA	A0A1L2JZ80	Aeribacillus_phage	40.0	6.9e-34
AYB36817.1|19292_19901_+	hypothetical protein	NA	E5DV66	Deep-sea_thermophilic_phage	42.4	9.5e-12
AYB36818.1|19897_20857_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36819.1|20875_21265_+	hypothetical protein	NA	A0A0A8WJ01	Clostridium_phage	30.5	5.5e-05
AYB36820.1|21446_21917_+|holin	holin	holin	NA	NA	NA	NA
AYB36821.1|21913_22159_+	hypothetical protein	NA	S5MNY8	Brevibacillus_phage	87.5	1.2e-29
AYB36822.1|22155_22779_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	S5M633	Brevibacillus_phage	92.8	1.0e-109
AYB36823.1|22863_23547_+	site-specific DNA-methyltransferase	NA	S5MBX9	Brevibacillus_phage	89.4	2.2e-121
AYB36824.1|23622_23970_+	hypothetical protein	NA	S5MNN8	Brevibacillus_phage	98.8	3.1e-44
AYB36825.1|25764_26583_-	hypothetical protein	NA	NA	NA	NA	NA
AYB36826.1|26773_27112_+	YolD-like family protein	NA	S5MAC2	Brevibacillus_phage	91.0	7.8e-56
AYB36827.1|27436_27631_+	XRE family transcriptional regulator	NA	A0A288WG80	Bacillus_phage	42.2	2.9e-07
AYB36828.1|27706_27928_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36829.1|28424_29849_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.0	1.1e-122
AYB36830.1|30291_31164_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	36.5	1.9e-13
AYB36831.1|31184_31775_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYB36832.1|32551_32842_-	hypothetical protein	NA	A0A0K2CNH4	Brevibacillus_phage	76.1	1.1e-18
AYB36833.1|32969_33152_+	hypothetical protein	NA	A0A0K2CND6	Brevibacillus_phage	85.0	1.4e-16
AYB36834.1|34209_34653_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36835.1|34944_35880_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	27.8	4.1e-14
AYB36836.1|35994_36522_+	dihydrofolate reductase	NA	NA	NA	NA	NA
AYB36837.1|36987_37167_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36838.1|37163_37589_+	ASCH domain-containing protein	NA	A0A291AUQ6	Sinorhizobium_phage	28.0	4.8e-10
AYB36839.1|38044_38617_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYB36840.1|38594_39572_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36841.1|39809_41546_+	stage II sporulation protein P	NA	NA	NA	NA	NA
AYB36842.1|41701_42253_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYB36843.1|42231_43614_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
AYB36844.1|44000_45035_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36845.1|45116_45386_-	hypothetical protein	NA	NA	NA	NA	NA
AYB36846.1|46049_46532_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36847.1|47503_47803_+	DUF2089 family protein	NA	NA	NA	NA	NA
AYB36848.1|47802_48090_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36849.1|48532_48973_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB36850.1|49477_50626_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYB36851.1|50911_51115_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36852.1|51227_52043_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
AYB36853.1|52497_53394_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	84.9	4.4e-114
AYB36854.1|53387_54071_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	84.6	1.7e-105
AYB41447.1|54227_55268_+	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	60.4	2.1e-83
AYB36855.1|55535_55745_+	DUF3006 domain-containing protein	NA	NA	NA	NA	NA
AYB36856.1|55939_57364_-	aromatic amino acid hydroxylase	NA	NA	NA	NA	NA
AYB36857.1|58567_59992_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.0	1.1e-122
>prophage 2
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	214722	281224	5577844	coat,bacteriocin,holin,transposase	Brevibacillus_phage(17.65%)	55	NA	NA
AYB36967.1|214722_214989_+|bacteriocin	bacteriocin uviB	bacteriocin	S5MCA8	Brevibacillus_phage	82.8	1.5e-30
AYB36968.1|215004_215730_+	N-acetylmuramoyl-L-alanine amidase	NA	S5M9Y4	Brevibacillus_phage	64.7	2.0e-80
AYB36969.1|215730_215916_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36970.1|215988_216189_-	hypothetical protein	NA	NA	NA	NA	NA
AYB36971.1|216931_217438_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
AYB36972.1|218318_220496_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	34.5	1.4e-44
AYB36973.1|220807_221626_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
AYB36974.1|221622_222003_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AYB36975.1|222063_222846_-	transcriptional regulator	NA	NA	NA	NA	NA
AYB36976.1|222925_223861_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.7	1.4e-14
AYB36977.1|224146_224695_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AYB36978.1|225193_225628_+	GNAT family N-acetyltransferase	NA	A0A1S6KV41	Providencia_phage	32.4	3.6e-05
AYB36979.1|225710_226814_+	choloylglycine hydrolase	NA	NA	NA	NA	NA
AYB36980.1|226848_227745_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	28.0	9.1e-11
AYB36981.1|228163_229273_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYB36982.1|229346_230480_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	4.4e-26
AYB41459.1|230642_232325_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AYB36983.1|232477_235024_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36984.1|235123_236644_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AYB36985.1|236640_237627_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AYB36986.1|237677_238520_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
AYB36987.1|238721_239480_+	serine/threonine protein phosphatase	NA	A0A127AVW0	Bacillus_phage	36.7	8.2e-29
AYB36988.1|239734_241303_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.5	2.1e-71
AYB36989.1|241268_242483_-	XRE family transcriptional regulator	NA	A0A0K2FLD1	Brevibacillus_phage	26.5	3.2e-35
AYB36990.1|242591_242951_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36991.1|243098_243530_-	EamA family transporter	NA	NA	NA	NA	NA
AYB36992.1|243580_244834_-	hypothetical protein	NA	NA	NA	NA	NA
AYB36993.1|245064_246036_+	aldose 1-epimerase	NA	NA	NA	NA	NA
AYB36994.1|246169_246502_+	DUF1904 family protein	NA	NA	NA	NA	NA
AYB36995.1|246576_247059_-	DNA-binding protein	NA	NA	NA	NA	NA
AYB36996.1|247257_247461_-	transcriptional regulator	NA	NA	NA	NA	NA
AYB36997.1|247845_251829_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
AYB36998.1|251912_252785_+	hypothetical protein	NA	NA	NA	NA	NA
AYB36999.1|252805_253234_-	hypothetical protein	NA	NA	NA	NA	NA
AYB37000.1|253666_258262_+	endonuclease	NA	NA	NA	NA	NA
AYB37001.1|258281_259487_+	DNA-binding protein	NA	NA	NA	NA	NA
AYB37002.1|259640_260294_+	5,6-dimethylbenzimidazole synthase	NA	NA	NA	NA	NA
AYB37003.1|260421_261723_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.9	1.4e-49
AYB37004.1|268359_268923_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AYB37005.1|269088_269787_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYB37006.1|269920_270616_-	glycosyltransferase	NA	NA	NA	NA	NA
AYB37007.1|270868_271822_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	31.2	1.2e-08
AYB37008.1|271982_272717_+|coat	spore coat protein	coat	I7I009	Enterobacteria_phage	45.1	1.0e-52
AYB37009.1|272740_273196_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYB37010.1|273210_274266_+	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	46.0	1.6e-75
AYB37011.1|274293_275160_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
AYB37012.1|275149_275971_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYB37013.1|275991_277089_+	glycosyltransferase family 2 protein	NA	S5WBE2	Pseudomonas_phage	24.5	6.1e-09
AYB37014.1|277163_277394_-	hypothetical protein	NA	NA	NA	NA	NA
AYB37015.1|277601_277838_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37016.1|277984_278761_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37017.1|278825_279236_+|holin	holin	holin	A0A1U9WQR6	Geobacillus_phage	48.3	2.2e-28
AYB37018.1|279635_279950_+	YbjQ family protein	NA	NA	NA	NA	NA
AYB37019.1|280049_280883_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.6	1.7e-40
AYB37020.1|280903_281224_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	682745	723715	5577844	coat,transposase,integrase,tRNA	Brevibacillus_phage(27.27%)	33	694007:694033	723940:723966
AYB37391.1|682745_684257_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AYB37392.1|684263_684716_+	master regulator for biofilm formation	NA	NA	NA	NA	NA
AYB37393.1|684821_685376_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
AYB37394.1|685536_686841_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37395.1|686894_689675_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.1	4.1e-33
AYB37396.1|689704_691957_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	38.9	1.3e-58
AYB37397.1|692541_692814_+|transposase	IS4/IS5 family transposase	transposase	NA	NA	NA	NA
AYB37398.1|692898_693852_+	toxin ETX	NA	NA	NA	NA	NA
694007:694033	attL	TGGTCTTACCCCTGTCAAGTAGACAGT	NA	NA	NA	NA
AYB37399.1|694050_694884_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.6	1.7e-40
AYB37400.1|694904_695225_-|transposase	transposase	transposase	NA	NA	NA	NA
AYB37401.1|695336_695549_-	hypothetical protein	NA	S5MCD6	Brevibacillus_phage	95.7	5.8e-25
AYB37402.1|695632_696319_-	hypothetical protein	NA	S5MUJ6	Brevibacillus_phage	95.2	3.0e-115
AYB37403.1|696589_696928_+	YolD-like family protein	NA	A0A0K2CNE7	Brevibacillus_phage	93.6	2.7e-56
AYB37404.1|697038_697446_-	XRE family transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	41.7	3.1e-06
AYB37405.1|697650_697905_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYB37406.1|698506_699298_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37407.1|699294_700248_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AYB37408.1|700277_700520_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
AYB37409.1|700594_701464_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	26.4	6.5e-14
AYB37410.1|701468_702401_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB37411.1|707738_708560_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYB37412.1|708767_709469_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYB41477.1|709837_711112_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37413.1|711251_712226_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	40.4	2.8e-50
AYB37414.1|712453_713743_+	GTPase HflX	NA	NA	NA	NA	NA
AYB37415.1|713762_715031_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
AYB37416.1|715222_717613_+	penicillin-binding protein	NA	NA	NA	NA	NA
AYB37417.1|717816_718224_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYB37418.1|718272_719607_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AYB37419.1|719717_720701_-|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	66.7	1.9e-65
AYB37420.1|721135_721426_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37421.1|721514_722588_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37422.1|723169_723715_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.6	1.7e-12
723940:723966	attR	ACTGTCTACTTGACAGGGGTAAGACCA	NA	NA	NA	NA
>prophage 4
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	821985	861061	5577844	terminase,integrase,tail	Bacillus_phage(53.85%)	36	833666:833681	846032:846047
AYB37506.1|821985_823440_-	DNRLRE domain-containing protein	NA	A0A127AWB0	Bacillus_phage	27.2	1.0e-19
AYB37507.1|823471_826036_-	hypothetical protein	NA	G3MAA7	Bacillus_virus	35.3	2.1e-36
AYB37508.1|826041_826674_-	hypothetical protein	NA	NA	NA	NA	NA
AYB37509.1|826674_827646_-	hypothetical protein	NA	A0A127AWB0	Bacillus_phage	37.5	8.1e-05
AYB37510.1|827646_828246_-	hypothetical protein	NA	G3MAA3	Bacillus_virus	38.9	6.2e-32
AYB37511.1|828329_828803_-	hypothetical protein	NA	A0A0K2CNZ3	Brevibacillus_phage	45.6	2.3e-29
AYB37512.1|828827_830030_-	hypothetical protein	NA	A0A0K2FMC4	Brevibacillus_phage	33.9	6.6e-49
AYB37513.1|830048_830474_-	hypothetical protein	NA	A0A0K2FL59	Brevibacillus_phage	49.6	2.6e-32
AYB37514.1|830530_831382_-	hypothetical protein	NA	NA	NA	NA	NA
AYB37515.1|831460_835297_-	hypothetical protein	NA	A0A0K2FLF6	Brevibacillus_phage	33.0	1.6e-189
833666:833681	attL	ATACATGTTCTGAATG	NA	NA	NA	NA
AYB37516.1|835324_835966_-	hypothetical protein	NA	A0A1P8CWP8	Bacillus_phage	38.9	2.9e-11
AYB37517.1|835978_837301_-	hypothetical protein	NA	NA	NA	NA	NA
AYB37518.1|837275_837893_-|tail	phage tail protein	tail	A0A0K2FMB9	Brevibacillus_phage	48.5	4.4e-49
AYB37519.1|837889_844054_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	26.9	2.5e-83
AYB37520.1|844202_845216_-|integrase	site-specific integrase	integrase	A0A1G5SC03	Enterococcus_phage	40.8	3.7e-61
AYB37521.1|845230_845647_-	hypothetical protein	NA	NA	NA	NA	NA
AYB37522.1|845621_846113_-	hypothetical protein	NA	NA	NA	NA	NA
846032:846047	attR	CATTCAGAACATGTAT	NA	NA	NA	NA
AYB37523.1|846140_846569_-	hypothetical protein	NA	A0A0K2FLF1	Brevibacillus_phage	39.7	2.3e-20
AYB37524.1|846617_846998_-	hypothetical protein	NA	NA	NA	NA	NA
AYB37525.1|847001_847274_-	hypothetical protein	NA	NA	NA	NA	NA
AYB37526.1|847292_848057_-	hypothetical protein	NA	A0A0K2FL50	Brevibacillus_phage	31.6	3.3e-30
AYB37527.1|848077_848815_-	hypothetical protein	NA	A0A218KCC3	Bacillus_phage	23.5	2.4e-09
AYB37528.1|848804_849308_-	hypothetical protein	NA	NA	NA	NA	NA
AYB37529.1|849316_850492_-	hypothetical protein	NA	NA	NA	NA	NA
AYB37530.1|850463_850694_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	50.0	1.3e-09
AYB37531.1|850690_851092_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	51.5	4.9e-33
AYB37532.1|851104_851587_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	45.2	3.7e-27
AYB37533.1|851641_852640_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	60.2	3.1e-108
AYB37534.1|852669_853203_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	60.5	1.4e-51
AYB37535.1|853234_854683_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	47.8	5.4e-114
AYB37536.1|854703_856227_-	hypothetical protein	NA	O64068	Bacillus_phage	50.8	4.6e-140
AYB37537.1|856237_858031_-|terminase	terminase	terminase	O64069	Bacillus_phage	49.3	5.8e-158
AYB37538.1|858030_858789_-	hypothetical protein	NA	A0A2R2ZGE8	Clostridioides_phage	34.8	5.9e-19
AYB37539.1|859061_860258_-	hypothetical protein	NA	A0A0A8WJL5	Clostridium_phage	35.6	2.0e-66
AYB37540.1|860269_860485_-	hypothetical protein	NA	NA	NA	NA	NA
AYB37541.1|860740_861061_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	49.1	6.7e-17
>prophage 5
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	886678	892946	5577844		Brevibacillus_phage(50.0%)	10	NA	NA
AYB37565.1|886678_887353_+	hypothetical protein	NA	S5M9Z8	Brevibacillus_phage	41.9	6.6e-30
AYB37566.1|887346_887874_+	hypothetical protein	NA	S5MBZ7	Brevibacillus_phage	37.6	2.0e-18
AYB37567.1|887989_888379_+	hypothetical protein	NA	S5MA89	Brevibacillus_phage	34.9	3.3e-10
AYB37568.1|888591_888894_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37569.1|888955_889180_-	XRE family transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	41.5	7.5e-07
AYB37570.1|889278_889611_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37571.1|889709_890834_+	hypothetical protein	NA	A0A0H3UZ18	Geobacillus_virus	32.9	9.0e-32
AYB37572.1|890934_891222_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37573.1|891221_892361_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37574.1|892511_892946_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5RCS0	Lactobacillus_phage	33.9	3.7e-10
>prophage 6
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	900405	911730	5577844		Bacillus_phage(44.44%)	20	NA	NA
AYB37587.1|900405_901776_+	hypothetical protein	NA	A0A0H3UZ06	Geobacillus_virus	34.6	2.1e-67
AYB37588.1|901768_902779_+	hypothetical protein	NA	A0A218KBY2	Bacillus_phage	29.0	5.4e-28
AYB37589.1|902936_903125_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37590.1|903180_903558_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37591.1|903526_903781_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37592.1|904053_904251_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37593.1|904290_904500_+	hypothetical protein	NA	H7BUW3	unidentified_phage	40.3	1.3e-05
AYB37594.1|904554_905739_+	hypothetical protein	NA	A0A2C9CZ84	Yersinia_phage	44.5	2.0e-45
AYB37595.1|905743_906133_+	hypothetical protein	NA	A0A219UQN9	Bacillus_phage	42.3	4.2e-05
AYB37596.1|906160_906727_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37597.1|906890_907091_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37598.1|907105_907336_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37599.1|907401_908310_+	hypothetical protein	NA	U5J9W3	Bacillus_phage	61.1	8.1e-100
AYB37600.1|908496_908895_+	hypothetical protein	NA	A0A0K2D0B9	Bacillus_phage	28.4	2.1e-07
AYB37601.1|908920_909145_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37602.1|909172_909352_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37603.1|909402_910194_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41481.1|910246_910813_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37604.1|910840_911230_+	hypothetical protein	NA	R4ICD6	Listeria_phage	36.6	6.7e-11
AYB37605.1|911259_911730_+	hypothetical protein	NA	A0A0K2CNU6	Brevibacillus_phage	59.5	2.7e-46
>prophage 7
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	917300	930946	5577844		Bacillus_phage(88.89%)	13	NA	NA
AYB37619.1|917300_918218_+	hypothetical protein	NA	O64140	Bacillus_phage	48.2	3.7e-68
AYB37620.1|918255_919233_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	69.6	2.1e-125
AYB37621.1|919287_919767_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	45.9	4.8e-35
AYB37622.1|919781_921329_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	44.4	4.7e-124
AYB37623.1|921344_922430_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	50.5	8.8e-101
AYB37624.1|922444_924136_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	42.1	1.7e-122
AYB37625.1|924153_928113_+	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	59.9	0.0e+00
AYB37626.1|928448_929078_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37627.1|929256_929604_-	hypothetical protein	NA	NA	NA	NA	NA
AYB37628.1|929727_929940_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37629.1|930156_930495_+	hypothetical protein	NA	A0A0K2CNP7	Brevibacillus_phage	72.4	3.0e-31
AYB37630.1|930445_930667_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37631.1|930697_930946_+	hypothetical protein	NA	A0A0A0RUI4	Bacillus_phage	38.7	1.5e-11
>prophage 8
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	944782	953844	5577844		Bacillus_phage(50.0%)	14	NA	NA
AYB37659.1|944782_945175_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	53.9	5.0e-30
AYB37660.1|945059_947237_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	75.0	4.0e-312
AYB37661.1|947244_947844_+	ribonucleoside-diphosphate reductase	NA	A0A1P8CX32	Bacillus_phage	77.9	1.3e-85
AYB41483.1|948103_948700_+	nuclease	NA	A0A2P0PAD9	Pectobacterium_phage	34.2	3.0e-10
AYB37662.1|948817_949255_+	hypothetical protein	NA	R4JMU8	Bacillus_phage	69.6	4.2e-46
AYB37663.1|949267_949882_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	46.0	7.5e-49
AYB37664.1|949933_950311_-	hypothetical protein	NA	NA	NA	NA	NA
AYB37665.1|950424_950637_+	hypothetical protein	NA	A0A0K2CPB1	Brevibacillus_phage	65.2	2.1e-19
AYB37666.1|950729_950999_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37667.1|951037_951580_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37668.1|951602_952055_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37669.1|952073_952883_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37670.1|953135_953507_+	hypothetical protein	NA	NA	NA	NA	NA
AYB37671.1|953571_953844_+	hypothetical protein	NA	A0A0K2FL96	Brevibacillus_phage	42.6	4.1e-07
>prophage 9
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	1693088	1750907	5577844	transposase	Paenibacillus_phage(41.67%)	49	NA	NA
AYB38149.1|1693088_1693415_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	59.2	8.4e-15
AYB38150.1|1693609_1695502_-	squalene--hopene cyclase	NA	NA	NA	NA	NA
AYB38151.1|1695595_1696783_+	DUF2515 domain-containing protein	NA	NA	NA	NA	NA
AYB41509.1|1696811_1697189_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38152.1|1698576_1698981_-	hypothetical protein	NA	NA	NA	NA	NA
AYB41510.1|1698984_1699890_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38153.1|1703917_1705900_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
AYB38154.1|1706150_1707575_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.0	1.1e-122
AYB38155.1|1707798_1708179_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38156.1|1708334_1708829_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38157.1|1709394_1710690_+	XRE family transcriptional regulator	NA	A0A0K2CNR6	Brevibacillus_phage	56.1	4.7e-133
AYB38158.1|1711057_1711315_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38159.1|1711464_1712823_-	DUF3854 domain-containing protein	NA	S5M810	Pseudoalteromonas_phage	38.1	2.4e-15
AYB38160.1|1712841_1713132_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38161.1|1713919_1714375_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38162.1|1714569_1714779_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38163.1|1714781_1716182_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.7	1.7e-32
AYB38164.1|1716178_1716886_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	40.8	4.9e-44
AYB38165.1|1717320_1717518_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AYB38166.1|1718447_1720073_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
AYB38167.1|1720666_1722310_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38168.1|1722315_1722534_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB38169.1|1722620_1723574_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38170.1|1723566_1724454_-	RNA-binding protein	NA	NA	NA	NA	NA
AYB38171.1|1724901_1725417_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38172.1|1725902_1726091_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38173.1|1726626_1727436_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38174.1|1727591_1728353_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38175.1|1728310_1730491_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38176.1|1730503_1731058_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38177.1|1731491_1731839_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38178.1|1732041_1732359_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38179.1|1734441_1735338_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	84.9	4.4e-114
AYB38180.1|1735331_1735889_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	84.4	2.8e-71
AYB38181.1|1735705_1736014_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	79.2	1.0e-25
AYB38182.1|1736122_1736494_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38183.1|1736577_1737246_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38184.1|1737702_1738284_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38185.1|1738391_1738742_-	DUF1878 family protein	NA	NA	NA	NA	NA
AYB38186.1|1738755_1739193_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38187.1|1739216_1739669_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38188.1|1739942_1740128_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38189.1|1741905_1742178_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB38190.1|1742872_1743427_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38191.1|1743763_1745188_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.0	1.1e-122
AYB38192.1|1745386_1746238_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	1.3e-54
AYB38193.1|1746273_1747257_-	aldo/keto reductase	NA	NA	NA	NA	NA
AYB38194.1|1748841_1749210_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38195.1|1749346_1750907_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	58.4	4.0e-70
>prophage 10
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	1769097	1801713	5577844	bacteriocin,transposase	Bacillus_phage(37.5%)	28	NA	NA
AYB38210.1|1769097_1769418_+|transposase	transposase	transposase	NA	NA	NA	NA
AYB38211.1|1769357_1770272_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.1	1.2e-39
AYB38212.1|1770968_1771499_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38213.1|1773254_1774022_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYB38214.1|1774824_1775376_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38215.1|1777588_1778410_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
AYB38216.1|1778940_1779219_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38217.1|1779184_1779583_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38218.1|1779977_1780454_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB38219.1|1780481_1781165_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	1.2e-23
AYB38220.1|1781183_1781393_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	56.7	2.4e-15
AYB38221.1|1782024_1783449_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.8	9.1e-122
AYB38222.1|1783792_1784149_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38223.1|1784800_1786381_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
AYB38224.1|1786403_1788347_-|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AYB38225.1|1788343_1790269_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
AYB38226.1|1790454_1790703_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
AYB38227.1|1792171_1792363_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38228.1|1792828_1793485_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	2.2e-14
AYB38229.1|1793468_1794185_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.3	1.9e-06
AYB38230.1|1794177_1794963_-	ABC transporter permease	NA	NA	NA	NA	NA
AYB38231.1|1794962_1795898_-	ABC transporter permease	NA	NA	NA	NA	NA
AYB38232.1|1795899_1797465_-	nickel ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYB38233.1|1797953_1798640_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYB38234.1|1799033_1799246_-	hypothetical protein	NA	A0A1P8CWQ3	Bacillus_phage	47.1	1.7e-08
AYB38235.1|1799287_1799725_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38236.1|1799744_1799951_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38237.1|1800151_1801713_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	58.4	4.0e-70
>prophage 11
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	1881561	1887035	5577844	transposase	Bacillus_virus(83.33%)	6	NA	NA
AYB38287.1|1881561_1882338_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	47.7	3.9e-50
AYB38288.1|1882414_1882969_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	43.4	3.6e-34
AYB38289.1|1883024_1884659_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.6	3.7e-111
AYB38290.1|1884672_1885311_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	38.9	2.2e-35
AYB38291.1|1885312_1886134_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.8	3.7e-75
AYB38292.1|1886201_1887035_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.6	1.7e-40
>prophage 12
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	1909633	1929366	5577844		Brevibacillus_phage(72.73%)	12	NA	NA
AYB38311.1|1909633_1911970_-	hypothetical protein	NA	A0A0K2CPK6	Brevibacillus_phage	41.1	8.8e-106
AYB38312.1|1911984_1913772_-	hypothetical protein	NA	A0A0K2CPK6	Brevibacillus_phage	36.4	2.1e-59
AYB38313.1|1914121_1916236_-	hypothetical protein	NA	A0A127AW50	Bacillus_phage	29.5	3.2e-70
AYB38314.1|1916249_1916858_-	hypothetical protein	NA	A0A127AW14	Bacillus_phage	47.0	1.9e-44
AYB38315.1|1916893_1917394_-	hypothetical protein	NA	A0A0K2CNZ3	Brevibacillus_phage	63.3	2.7e-49
AYB38316.1|1917889_1919980_-	hypothetical protein	NA	A0A127AW50	Bacillus_phage	29.5	7.9e-74
AYB38317.1|1919951_1920227_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38318.1|1920482_1921319_-	hypothetical protein	NA	A0A0K2CPK2	Brevibacillus_phage	55.8	1.2e-78
AYB38319.1|1921333_1922425_-	cell adhesion protein	NA	A0A0K2CPP1	Brevibacillus_phage	61.4	9.4e-135
AYB38320.1|1922425_1925986_-	hypothetical protein	NA	A0A0K2CP84	Brevibacillus_phage	24.3	1.4e-33
AYB38321.1|1926009_1927836_-	hypothetical protein	NA	A0A0K2CNY7	Brevibacillus_phage	69.2	2.3e-263
AYB38322.1|1927893_1929366_-	hypothetical protein	NA	A0A0K2CP42	Brevibacillus_phage	72.0	8.0e-206
>prophage 13
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	1988884	2009525	5577844		Brevibacillus_phage(100.0%)	21	NA	NA
AYB38375.1|1988884_1989574_-	lytic transglycosylase domain-containing protein	NA	A0A0K2CNS6	Brevibacillus_phage	48.1	1.0e-33
AYB38376.1|1989654_1989900_-	hypothetical protein	NA	A0A0K2CNT1	Brevibacillus_phage	48.0	7.0e-14
AYB38377.1|1989896_1990184_-	hypothetical protein	NA	A0A0K2CP23	Brevibacillus_phage	44.1	6.0e-17
AYB38378.1|1990222_1990561_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38379.1|1990671_1991001_-	hypothetical protein	NA	A0A0K2CPQ6	Brevibacillus_phage	51.4	3.5e-29
AYB38380.1|1991132_1991576_-	hypothetical protein	NA	A0A0K2CPR2	Brevibacillus_phage	55.2	8.4e-42
AYB38381.1|1991928_1992462_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CPD2	Brevibacillus_phage	57.9	1.5e-48
AYB38382.1|1993041_1993341_-	hypothetical protein	NA	A0A0K2CPL0	Brevibacillus_phage	56.0	1.7e-17
AYB38383.1|1993337_1994165_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CPP8	Brevibacillus_phage	55.4	1.8e-77
AYB41524.1|1994255_1994573_-	hypothetical protein	NA	A0A0K2CNZ6	Brevibacillus_phage	61.7	4.2e-11
AYB38384.1|1994920_1995337_-	hypothetical protein	NA	A0A0K2CP80	Brevibacillus_phage	63.3	2.0e-45
AYB38385.1|1995463_1998925_-	peptidase M23	NA	A0A0K2CNY2	Brevibacillus_phage	64.7	0.0e+00
AYB38386.1|1998935_1999988_-	hypothetical protein	NA	A0A0K2CP35	Brevibacillus_phage	61.6	5.0e-133
AYB38387.1|1999987_2000605_-	S-layer homology domain-containing protein	NA	A0A0K2CPJ2	Brevibacillus_phage	72.8	1.3e-85
AYB38388.1|2000735_2005310_-	hypothetical protein	NA	A0A0K2CPN3	Brevibacillus_phage	39.6	1.9e-221
AYB38389.1|2005285_2005504_-	hypothetical protein	NA	A0A0K2CP74	Brevibacillus_phage	65.3	1.2e-20
AYB38390.1|2005620_2006145_-	DNA polymerase III subunit gamma/tau	NA	A0A0K2CPC8	Brevibacillus_phage	66.3	1.5e-50
AYB38391.1|2006272_2007331_-	hypothetical protein	NA	A0A0K2CNX7	Brevibacillus_phage	76.1	1.3e-146
AYB38392.1|2007601_2007856_-	hypothetical protein	NA	A0A0K2CNW3	Brevibacillus_phage	58.8	1.3e-23
AYB38393.1|2008078_2008312_-	hypothetical protein	NA	A0A0K2CPH0	Brevibacillus_phage	52.6	2.7e-15
AYB38394.1|2008523_2009525_+	replication initiation protein	NA	A0A0K2CNV5	Brevibacillus_phage	24.3	3.9e-18
>prophage 14
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	2118798	2200637	5577844	coat,terminase,head,bacteriocin,plate,portal,capsid,tail,integrase,transposase	Brevibacillus_phage(64.06%)	110	2140043:2140058	2200727:2200742
AYB38463.1|2118798_2119662_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYB38464.1|2119757_2120147_-	kinase	NA	NA	NA	NA	NA
AYB38465.1|2120463_2120706_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38466.1|2121636_2122245_+	nitroreductase family protein	NA	NA	NA	NA	NA
AYB38467.1|2122344_2123781_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38468.1|2123850_2124816_-	DMT family transporter	NA	NA	NA	NA	NA
AYB38469.1|2125017_2126088_-	YheC/YheD family protein	NA	NA	NA	NA	NA
AYB38470.1|2126199_2127111_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AYB38471.1|2127107_2127848_-	glycerophosphodiester phosphodiesterase	NA	M1HU85	Paramecium_bursaria_Chlorella_virus	31.1	5.2e-20
AYB38472.1|2127977_2128337_-	thioredoxin	NA	NA	NA	NA	NA
AYB38473.1|2128381_2129284_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB38474.1|2129428_2130847_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AYB38475.1|2130986_2131580_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AYB38476.1|2131692_2132217_-	DinB family protein	NA	NA	NA	NA	NA
AYB38477.1|2132615_2133011_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB38478.1|2134043_2134601_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	86.0	5.2e-65
AYB38479.1|2135440_2136142_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38480.1|2137876_2138683_+	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	41.2	3.8e-48
2140043:2140058	attL	GATGAGTAATATCTTT	NA	NA	NA	NA
AYB38481.1|2140250_2140589_-	YolD-like family protein	NA	S5MAC2	Brevibacillus_phage	84.7	5.8e-51
AYB38482.1|2140594_2140783_-	hypothetical protein	NA	A0A2I7SCV7	Paenibacillus_phage	47.4	6.3e-07
AYB38483.1|2141021_2141150_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AYB38484.1|2141380_2142160_+	alpha/beta hydrolase	NA	A0A076YKN0	Mycobacterium_phage	24.3	2.2e-08
AYB38485.1|2142647_2142866_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38486.1|2142991_2143324_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38487.1|2143316_2143514_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38488.1|2143553_2143781_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
AYB38489.1|2144043_2144466_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38490.1|2144712_2145798_-|transposase	transposase	transposase	A0A0H3UZC2	Geobacillus_virus	65.0	1.4e-135
AYB38491.1|2145800_2146211_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	63.3	1.2e-42
AYB38492.1|2146340_2146532_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38493.1|2146805_2147204_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AYB38494.1|2147362_2148193_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38495.1|2148843_2150079_+	kelch-like protein	NA	A0A0K2CNX3	Brevibacillus_phage	100.0	3.3e-35
AYB38496.1|2150174_2151089_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.1	1.2e-39
AYB38497.1|2151028_2151349_-|transposase	transposase	transposase	NA	NA	NA	NA
AYB38498.1|2151650_2152796_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38499.1|2154863_2155424_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38500.1|2155509_2156397_-	ATP-binding protein	NA	NA	NA	NA	NA
AYB38501.1|2156546_2157191_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	53.3	9.7e-39
AYB38502.1|2157190_2157442_-	hypothetical protein	NA	A0A0K2CNN1	Brevibacillus_phage	100.0	1.3e-36
AYB38503.1|2157444_2157711_-|bacteriocin	bacteriocin uviB	bacteriocin	S5MCA8	Brevibacillus_phage	85.2	9.5e-33
AYB38504.1|2157784_2158060_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38505.1|2158241_2158640_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38506.1|2158654_2159692_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38507.1|2159688_2160147_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38508.1|2160160_2160712_-	DUF2313 domain-containing protein	NA	S6BFJ0	Thermus_phage	45.5	8.6e-36
AYB38509.1|2160722_2161760_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	50.1	1.8e-87
AYB38510.1|2161760_2162168_-	DUF2634 domain-containing protein	NA	S5MTX3	Brevibacillus_phage	67.4	1.2e-39
AYB38511.1|2162164_2162416_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	45.8	2.3e-12
AYB38512.1|2162417_2163383_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	78.3	2.7e-146
AYB38513.1|2163396_2164086_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	74.8	2.2e-89
AYB38514.1|2164082_2164361_-	hypothetical protein	NA	S5M608	Brevibacillus_phage	57.3	4.3e-20
AYB38515.1|2164377_2166408_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	97.6	0.0e+00
AYB38516.1|2166462_2167014_-	hypothetical protein	NA	A0A0K2CP90	Brevibacillus_phage	98.4	7.1e-91
AYB38517.1|2167249_2167660_-	hypothetical protein	NA	A0A0K2CNS3	Brevibacillus_phage	100.0	2.3e-70
AYB38518.1|2167787_2168075_-	hypothetical protein	NA	A0A0K2CP32	Brevibacillus_phage	85.3	4.0e-37
AYB38519.1|2168212_2168992_-	hypothetical protein	NA	Q7Y5W2	Haemophilus_phage	48.0	3.5e-19
AYB38520.1|2169048_2169264_-	XRE family transcriptional regulator	NA	A0A0K2CNL9	Brevibacillus_phage	80.9	6.5e-24
AYB38521.1|2169435_2169936_+	XRE family transcriptional regulator	NA	S5MTW4	Brevibacillus_phage	45.3	7.8e-28
AYB38522.1|2170027_2170261_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38523.1|2170274_2170745_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38524.1|2170737_2171667_-	DUF3102 domain-containing protein	NA	D2XQ12	Bacillus_virus	53.6	2.0e-29
AYB38525.1|2171703_2171913_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB38526.1|2171952_2172633_+	XRE family transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	42.0	1.3e-12
AYB38527.1|2173471_2173936_-|portal	phage portal protein	portal	A0A0K2CNG3	Brevibacillus_phage	92.9	1.5e-78
AYB38528.1|2173993_2175313_-|tail	phage tail sheath protein	tail	S5MUG6	Brevibacillus_phage	54.5	1.7e-130
AYB38529.1|2175481_2175916_-	hypothetical protein	NA	S5MBU4	Brevibacillus_phage	82.4	2.0e-64
AYB38530.1|2175902_2176409_-	HK97 gp10 family phage protein	NA	A0A0K2CNR5	Brevibacillus_phage	97.0	6.5e-91
AYB38531.1|2176408_2176765_-	ABC transporter ATP-binding protein	NA	S5M673	Brevibacillus_phage	89.8	4.8e-56
AYB38532.1|2176764_2177124_-	DNA-packaging protein	NA	A0A0K2CNK9	Brevibacillus_phage	90.8	7.7e-54
AYB38533.1|2177337_2178378_-|capsid	phage capsid protein	capsid	S5MNB6	Brevibacillus_phage	99.1	3.4e-195
AYB38534.1|2178394_2178766_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	98.4	2.3e-61
AYB38535.1|2178783_2179413_-	hypothetical protein	NA	A0A0K2CP96	Brevibacillus_phage	93.8	2.4e-103
AYB38536.1|2179501_2180539_-|head	phage head morphogenesis protein	head	S5M601	Brevibacillus_phage	94.2	2.3e-183
AYB38537.1|2180535_2181984_-|portal	phage portal protein	portal	A0A0K2CNK4	Brevibacillus_phage	93.8	6.3e-264
AYB38538.1|2182076_2182787_+	hypothetical protein	NA	A0A0K2CP04	Brevibacillus_phage	54.0	1.6e-47
AYB38539.1|2182951_2184229_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.3	5.6e-155
AYB41528.1|2184225_2184984_-	hypothetical protein	NA	A0A0A8WJN3	Clostridium_phage	38.9	1.2e-35
AYB38540.1|2185026_2185263_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38541.1|2185344_2185872_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38542.1|2186279_2186519_-	hypothetical protein	NA	NA	NA	NA	NA
AYB41529.1|2186588_2187035_-	ArpU family transcriptional regulator	NA	A0A1B0T6C9	Bacillus_phage	51.0	2.7e-32
AYB38543.1|2187202_2187694_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38544.1|2187765_2187990_-	hypothetical protein	NA	S5M663	Brevibacillus_phage	91.9	2.4e-37
AYB38545.1|2188144_2188333_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38546.1|2188367_2188571_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38547.1|2188585_2188792_-	hypothetical protein	NA	NA	NA	NA	NA
AYB38548.1|2188944_2189133_-	hypothetical protein	NA	S5MC27	Brevibacillus_phage	86.3	5.5e-19
AYB38549.1|2189216_2189462_+	hypothetical protein	NA	NA	NA	NA	NA
AYB38550.1|2189672_2190170_+	signal peptidase I	NA	NA	NA	NA	NA
AYB38551.1|2190240_2190453_+	hypothetical protein	NA	S5MCE7	Brevibacillus_phage	77.1	2.6e-25
AYB38552.1|2190651_2190927_-	helix-turn-helix domain-containing protein	NA	A0A0K2CNP4	Brevibacillus_phage	98.9	2.7e-46
AYB38553.1|2191021_2191456_-	hypothetical protein	NA	A0A0K2CPB0	Brevibacillus_phage	70.8	8.2e-50
AYB38554.1|2191421_2191634_-	hypothetical protein	NA	A0A0K2CNJ4	Brevibacillus_phage	93.9	1.2e-27
AYB38555.1|2191636_2192371_-	hypothetical protein	NA	S5MP04	Brevibacillus_phage	97.1	9.1e-134
AYB41530.1|2192386_2193175_-	AAA family ATPase	NA	D2XQ17	Bacillus_virus	51.2	3.2e-68
AYB38556.1|2193149_2194154_-	hypothetical protein	NA	S5MUL0	Brevibacillus_phage	97.3	9.6e-118
AYB38557.1|2194173_2194524_-	HNH endonuclease	NA	A0A0K2CPC7	Brevibacillus_phage	81.7	8.3e-53
AYB38558.1|2194537_2194951_-	single-stranded DNA-binding protein	NA	S5MNH0	Brevibacillus_phage	78.1	1.1e-56
AYB38559.1|2194943_2195540_-	hypothetical protein	NA	S5M650	Brevibacillus_phage	89.7	1.2e-91
AYB38560.1|2195550_2196036_-	hypothetical protein	NA	S5MNZ9	Brevibacillus_phage	70.2	2.8e-51
AYB38561.1|2196032_2196290_-	hypothetical protein	NA	A0A0K2CP98	Brevibacillus_phage	89.4	1.6e-37
AYB38562.1|2196273_2196522_-	hypothetical protein	NA	A0A0K2CNT7	Brevibacillus_phage	84.1	2.9e-28
AYB38563.1|2196739_2196955_-	hypothetical protein	NA	S5M645	Brevibacillus_phage	63.4	7.2e-15
AYB38564.1|2196969_2197569_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB38565.1|2197664_2197895_-	DNA-binding protein	NA	NA	NA	NA	NA
AYB38566.1|2197907_2198150_-	XRE family transcriptional regulator	NA	A8ATX6	Listeria_phage	54.3	1.9e-11
AYB38567.1|2198312_2198678_+	XRE family transcriptional regulator	NA	A8ATX5	Listeria_phage	41.1	7.0e-10
AYB38568.1|2198755_2199382_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	32.2	1.5e-15
AYB38569.1|2199479_2200637_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	40.5	3.5e-71
2200727:2200742	attR	GATGAGTAATATCTTT	NA	NA	NA	NA
>prophage 15
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	3507604	3615747	5577844	holin,protease,terminase,head,bacteriocin,capsid,portal,tRNA,tail,integrase,transposase	Brevibacillus_phage(28.12%)	103	3508863:3508879	3589071:3589087
AYB39639.1|3507604_3508793_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.4	5.2e-30
3508863:3508879	attL	TTTTGAAAATAAAGGAG	NA	NA	NA	NA
AYB39640.1|3508881_3510762_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	32.5	8.6e-19
AYB39641.1|3510938_3512369_-	copper amine oxidase	NA	NA	NA	NA	NA
AYB39642.1|3512615_3516212_-	PAS domain S-box protein	NA	NA	NA	NA	NA
AYB39643.1|3516781_3518278_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39644.1|3518526_3520533_+	pilus assembly protein	NA	NA	NA	NA	NA
AYB39645.1|3520802_3521909_-	DUF3626 domain-containing protein	NA	NA	NA	NA	NA
AYB39646.1|3522250_3523102_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYB39647.1|3523473_3523833_-	DUF1036 domain-containing protein	NA	NA	NA	NA	NA
AYB39648.1|3525254_3525464_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39649.1|3525906_3526359_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39650.1|3526836_3529260_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39651.1|3529351_3529984_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39652.1|3531829_3533362_-	recombinase family protein	NA	A0A0C5AN18	Bacteriophage	30.5	6.5e-41
AYB41582.1|3533972_3534632_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYB39653.1|3534641_3535610_+	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
AYB39654.1|3535924_3537310_-	amino acid permease	NA	NA	NA	NA	NA
AYB39655.1|3537785_3539147_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
AYB39656.1|3539308_3539863_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYB39657.1|3540067_3540268_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39658.1|3540394_3540820_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
AYB39659.1|3541443_3542793_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB39660.1|3543095_3543281_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39661.1|3543495_3544113_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39662.1|3544200_3544482_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39663.1|3545396_3545657_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39664.1|3546194_3546743_-	DUF3231 family protein	NA	NA	NA	NA	NA
AYB41583.1|3549620_3551048_-	hypothetical protein	NA	Q38324	Lactococcus_phage	29.5	4.2e-18
AYB39665.1|3551468_3552263_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39666.1|3552564_3553191_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	S5M633	Brevibacillus_phage	86.5	3.6e-99
AYB39667.1|3553187_3553430_-	hypothetical protein	NA	S5MNY8	Brevibacillus_phage	86.2	2.4e-30
AYB39668.1|3553433_3553667_-|bacteriocin	bacteriocin uviB	bacteriocin	A0A0K2CND1	Brevibacillus_phage	65.9	2.3e-22
AYB39669.1|3553907_3554105_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39670.1|3556688_3557309_-|integrase	integrase	integrase	NA	NA	NA	NA
AYB39671.1|3557301_3557601_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39672.1|3557594_3558146_-	DUF2313 domain-containing protein	NA	A0A2H4J1P4	uncultured_Caudovirales_phage	25.0	4.6e-05
AYB39673.1|3558142_3558961_-	hypothetical protein	NA	A0A2H4J7K8	uncultured_Caudovirales_phage	24.9	3.5e-09
AYB39674.1|3558945_3559377_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
AYB39675.1|3559376_3559631_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39676.1|3559636_3560581_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39677.1|3560595_3561162_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39678.1|3561158_3563750_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39679.1|3563807_3564026_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39680.1|3564230_3564611_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39681.1|3564623_3565076_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39682.1|3565077_3566415_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYB39683.1|3566415_3566607_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39684.1|3566599_3567049_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39685.1|3567048_3567531_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
AYB39686.1|3567530_3568151_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYB41584.1|3568122_3568404_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39687.1|3568431_3568701_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B1P7Q8	Bacillus_phage	42.4	1.3e-10
AYB39688.1|3568716_3569850_-|capsid	phage major capsid protein	capsid	A0A2I7SCR0	Paenibacillus_phage	79.1	2.2e-163
AYB39689.1|3569849_3570614_-|protease	Clp protease ClpP	protease	A0A0A7RUD3	Clostridium_phage	38.1	5.7e-38
AYB41585.1|3570597_3571776_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	73.0	1.4e-171
AYB41586.1|3571824_3573606_-|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	64.8	2.2e-226
AYB39690.1|3573580_3573898_-|terminase	phage terminase small subunit P27 family	terminase	A0A0K2CZ94	Paenibacillus_phage	85.0	5.1e-41
AYB39691.1|3573999_3574338_-	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	50.9	1.8e-20
AYB39692.1|3574461_3574935_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39693.1|3575024_3575609_-|integrase	site-specific integrase	integrase	A3F636	Streptococcus_phage	44.9	7.0e-36
AYB39694.1|3575777_3576302_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	46.2	4.9e-33
AYB39695.1|3576806_3577043_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39696.1|3577026_3577272_-	hypothetical protein	NA	A0A0A0RVG0	Bacillus_phage	52.5	1.5e-08
AYB39697.1|3577309_3577549_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39698.1|3577582_3577951_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39699.1|3577947_3578592_-	hypothetical protein	NA	A0A0K2CNK1	Brevibacillus_phage	90.8	3.6e-110
AYB39700.1|3578630_3578879_-	hypothetical protein	NA	A0A0S2MV78	Bacillus_phage	33.3	1.5e-08
AYB39701.1|3578911_3579247_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39702.1|3579278_3579596_-	hypothetical protein	NA	A0A0K2CNQ9	Brevibacillus_phage	69.8	7.3e-32
AYB41587.1|3579611_3580724_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39703.1|3580860_3581331_-	adenine methyltransferase	NA	S5MUL8	Brevibacillus_phage	92.3	1.8e-87
AYB39704.1|3581347_3581533_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39705.1|3581615_3581828_+	hypothetical protein	NA	S5MCE7	Brevibacillus_phage	85.7	3.9e-29
AYB39706.1|3582017_3583286_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	46.4	1.3e-95
AYB39707.1|3583276_3584137_-	replication protein	NA	I1W658	Staphylococcus_phage	46.6	4.5e-23
AYB41588.1|3584418_3584646_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39708.1|3585174_3585648_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39709.1|3585667_3586030_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39710.1|3586494_3587040_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB39711.1|3587489_3587711_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB39712.1|3587873_3588242_+	XRE family transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	32.5	8.6e-08
AYB39713.1|3588738_3589482_-	DNA-binding response regulator	NA	NA	NA	NA	NA
3589071:3589087	attR	CTCCTTTATTTTCAAAA	NA	NA	NA	NA
AYB39714.1|3589537_3589663_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
AYB39715.1|3589662_3590184_-	accessory regulator AgrB	NA	S5MBZ7	Brevibacillus_phage	37.3	4.0e-19
AYB39716.1|3590192_3590879_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39717.1|3591098_3591272_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYB39718.1|3591375_3592818_+	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	64.4	6.5e-176
AYB39719.1|3593826_3594288_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AYB39720.1|3594407_3595139_-	HAD family hydrolase	NA	NA	NA	NA	NA
AYB39721.1|3595198_3595672_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AYB39722.1|3595922_3596951_-	hydrolase	NA	NA	NA	NA	NA
AYB39723.1|3597122_3597644_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	51.5	7.4e-21
AYB39724.1|3597714_3598890_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AYB39725.1|3598886_3599321_-	ribonuclease HI	NA	W5SAN9	Pithovirus	40.3	5.9e-24
AYB39726.1|3599559_3600234_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39727.1|3600253_3601591_-	permease	NA	NA	NA	NA	NA
AYB39728.1|3608063_3608951_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39729.1|3609198_3609615_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39730.1|3609659_3611396_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AYB39731.1|3611663_3612101_-	transcriptional repressor	NA	NA	NA	NA	NA
AYB39732.1|3612298_3612976_-	endonuclease III	NA	NA	NA	NA	NA
AYB39733.1|3613227_3614154_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AYB39734.1|3615336_3615747_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	64.1	3.2e-43
>prophage 16
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	3746314	3752527	5577844		Pneumococcus_phage(33.33%)	8	NA	NA
AYB39856.1|3746314_3746821_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	68.5	5.4e-53
AYB39857.1|3746882_3747626_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	48.0	2.1e-61
AYB39858.1|3747618_3748107_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	67.7	2.7e-57
AYB39859.1|3748090_3748759_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	54.8	2.1e-65
AYB39860.1|3748890_3749766_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
AYB39861.1|3750006_3750837_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	7.8e-65
AYB39862.1|3751085_3751268_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39863.1|3751336_3752527_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	6.8e-30
>prophage 17
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	3769835	3837370	5577844	transposase	Brevibacillus_phage(25.0%)	60	NA	NA
AYB39877.1|3769835_3770921_-|transposase	transposase	transposase	A0A0H3UZC2	Geobacillus_virus	65.6	1.7e-136
AYB39878.1|3770923_3771334_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	64.1	3.2e-43
AYB39879.1|3771876_3772437_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYB39880.1|3772628_3774080_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AYB39881.1|3774279_3774972_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
AYB39882.1|3775433_3776789_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	34.6	1.9e-15
AYB39883.1|3776814_3777963_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39884.1|3777994_3778564_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39885.1|3778596_3779559_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39886.1|3779628_3781341_-	thiamine pyrophosphate-binding protein	NA	E5ERI2	Ostreococcus_lucimarinus_virus	22.3	4.6e-19
AYB39887.1|3781376_3782567_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AYB39888.1|3782607_3783723_-	amino acid--ACP ligase	NA	NA	NA	NA	NA
AYB39889.1|3783722_3783986_-	phosphopantetheine attachment site family protein	NA	NA	NA	NA	NA
AYB39890.1|3784005_3785013_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AYB39891.1|3785038_3785851_-	ABC transporter permease	NA	NA	NA	NA	NA
AYB39892.1|3785853_3786675_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39893.1|3786652_3787654_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.5	3.1e-15
AYB39894.1|3787724_3788858_-	ketoacyl-ACP synthase	NA	NA	NA	NA	NA
AYB39895.1|3788871_3789618_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39896.1|3790247_3790586_-	YolD-like family protein	NA	S5MAC2	Brevibacillus_phage	91.9	2.5e-54
AYB39897.1|3790771_3791584_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AYB39898.1|3791872_3792193_+|transposase	transposase	transposase	NA	NA	NA	NA
AYB39899.1|3792213_3793047_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.6	1.7e-40
AYB39900.1|3793484_3794060_+	hypothetical protein	NA	A0A0K2CNX3	Brevibacillus_phage	71.4	3.5e-24
AYB39901.1|3794765_3795188_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39902.1|3795941_3796178_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39903.1|3796797_3797391_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	47.6	5.2e-39
AYB39904.1|3797330_3797642_-	hypothetical protein	NA	A0A0K2CNN1	Brevibacillus_phage	97.5	6.3e-36
AYB39905.1|3798174_3798522_-	hypothetical protein	NA	S5MUI6	Brevibacillus_phage	74.1	1.2e-40
AYB39906.1|3799236_3800109_-	radical SAM protein	NA	NA	NA	NA	NA
AYB39907.1|3800350_3800860_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYB39908.1|3800840_3801854_+	alkaline phosphatase	NA	NA	NA	NA	NA
AYB39909.1|3801939_3802905_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYB39910.1|3803149_3804886_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	1.9e-44
AYB39911.1|3804854_3806720_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	2.6e-28
AYB39912.1|3806908_3807568_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYB39913.1|3807786_3808602_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
AYB39914.1|3808830_3809382_+	delta-aminolevulinic acid dehydratase	NA	NA	NA	NA	NA
AYB39915.1|3809746_3810382_-	restriction endonuclease	NA	NA	NA	NA	NA
AYB39916.1|3810667_3811714_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39917.1|3812128_3814099_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	2.9e-17
AYB39918.1|3814526_3814895_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AYB39919.1|3814925_3815480_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYB39920.1|3815514_3816138_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYB39921.1|3816139_3816370_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39922.1|3816362_3816689_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39923.1|3816711_3817182_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39924.1|3818256_3818829_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39925.1|3818888_3819170_+	hypothetical protein	NA	NA	NA	NA	NA
AYB39926.1|3819645_3819990_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AYB39927.1|3820050_3821154_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39928.1|3821137_3821671_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYB39929.1|3822218_3822962_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
AYB39930.1|3823830_3825117_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39931.1|3825138_3826545_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	34.5	6.1e-70
AYB39932.1|3827531_3828743_-	glycosyl transferase	NA	NA	NA	NA	NA
AYB39933.1|3831183_3832713_+	alveolysin	NA	NA	NA	NA	NA
AYB39934.1|3833177_3834431_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39935.1|3834427_3835783_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39936.1|3836180_3837370_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.1	5.2e-30
>prophage 18
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	3853521	3894838	5577844	terminase,head,bacteriocin,plate,portal,capsid,tail,integrase	Brevibacillus_phage(72.0%)	62	3878162:3878176	3898630:3898644
AYB39954.1|3853521_3853788_-|bacteriocin	bacteriocin uviB	bacteriocin	A0A0K2CND1	Brevibacillus_phage	86.4	2.3e-34
AYB39955.1|3854040_3854292_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39956.1|3854641_3855022_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39957.1|3855037_3856072_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39958.1|3856068_3856527_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39959.1|3856540_3857104_-	DUF2313 domain-containing protein	NA	S6BFJ0	Thermus_phage	46.0	6.1e-37
AYB39960.1|3857103_3858141_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	51.0	1.9e-89
AYB39961.1|3858141_3858549_-	DUF2634 domain-containing protein	NA	S5MTX3	Brevibacillus_phage	65.1	3.0e-38
AYB39962.1|3858545_3858797_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	47.0	2.7e-13
AYB39963.1|3858796_3859762_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	78.0	2.3e-145
AYB39964.1|3859775_3860465_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	74.3	8.4e-89
AYB39965.1|3860451_3860733_-	hypothetical protein	NA	S5M608	Brevibacillus_phage	63.3	1.6e-25
AYB39966.1|3860749_3862801_-	hypothetical protein	NA	S5MNW9	Brevibacillus_phage	88.3	3.9e-307
AYB39967.1|3862852_3863542_-	hypothetical protein	NA	S5MUN3	Brevibacillus_phage	91.6	1.3e-110
AYB39968.1|3863782_3864205_-|portal	phage portal protein	portal	A0A0A8WJT4	Clostridium_phage	39.0	1.2e-21
AYB39969.1|3864922_3865240_+	hypothetical protein	NA	S6B1N1	Thermus_phage	47.6	3.5e-18
AYB39970.1|3865420_3865885_-|portal	phage portal protein	portal	A0A0K2CNG3	Brevibacillus_phage	92.9	5.3e-79
AYB39971.1|3865942_3867262_-|tail	phage tail sheath protein	tail	S5MUG6	Brevibacillus_phage	54.7	1.3e-130
AYB41596.1|3867430_3867865_-	hypothetical protein	NA	A0A0K2CP81	Brevibacillus_phage	77.5	6.1e-61
AYB39972.1|3867851_3868358_-	HK97 gp10 family phage protein	NA	S5M9M9	Brevibacillus_phage	95.8	9.5e-90
AYB39973.1|3868357_3868714_-	ABC transporter ATP-binding protein	NA	S5MBV4	Brevibacillus_phage	84.7	2.7e-51
AYB39974.1|3868713_3869082_-	DNA-packaging protein	NA	S5MP25	Brevibacillus_phage	79.2	7.4e-44
AYB39975.1|3869074_3869377_-	hypothetical protein	NA	S5MC61	Brevibacillus_phage	74.5	2.7e-31
AYB39976.1|3869406_3870432_-|capsid	major capsid protein	capsid	S5MA55	Brevibacillus_phage	93.3	2.2e-178
AYB39977.1|3870447_3870771_-	hypothetical protein	NA	S5M669	Brevibacillus_phage	97.2	4.5e-53
AYB39978.1|3870787_3871423_-	hypothetical protein	NA	S5MUG0	Brevibacillus_phage	83.4	2.6e-89
AYB39979.1|3871511_3872552_-|head	phage head morphogenesis protein	head	S5M601	Brevibacillus_phage	93.6	1.8e-183
AYB39980.1|3872548_3873997_-|portal	phage portal protein	portal	A0A0K2CNK4	Brevibacillus_phage	93.6	9.2e-263
AYB39981.1|3874178_3875453_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	62.9	2.1e-154
AYB39982.1|3875452_3876187_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	44.5	6.0e-45
AYB39983.1|3876646_3876826_-	hypothetical protein	NA	S5MP19	Brevibacillus_phage	69.8	1.4e-11
AYB39984.1|3876889_3877378_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39985.1|3877734_3878241_-	RNA polymerase subunit sigma-24	NA	S5MAA9	Brevibacillus_phage	96.4	2.6e-87
3878162:3878176	attL	GCTCTTAGATCAGCG	NA	NA	NA	NA
AYB39986.1|3878329_3878566_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39987.1|3878772_3878976_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39988.1|3878993_3879197_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39989.1|3879453_3879852_-	hypothetical protein	NA	S5MUM3	Brevibacillus_phage	32.8	7.4e-05
AYB39990.1|3879848_3880148_-	hypothetical protein	NA	A0A0K2FMK5	Brevibacillus_phage	91.4	6.0e-44
AYB39991.1|3880188_3880572_-	hypothetical protein	NA	R4JMS5	Bacillus_phage	49.6	3.6e-25
AYB39992.1|3880583_3881123_-	hypothetical protein	NA	NA	NA	NA	NA
AYB39993.1|3881175_3881646_-	hypothetical protein	NA	A0A0C5AET2	Bacteriophage	54.4	1.1e-34
AYB39994.1|3881671_3882142_-	adenine methyltransferase	NA	S5MUL8	Brevibacillus_phage	92.8	1.4e-87
AYB39995.1|3882393_3883218_-	DNA adenine methylase	NA	Q24LC8	Clostridium_phage	42.6	2.2e-56
AYB39996.1|3883583_3883967_-	hypothetical protein	NA	A0A1B1P8B5	Bacillus_phage	32.4	6.6e-11
AYB39997.1|3883935_3884145_-	hypothetical protein	NA	A0A0K2CNJ4	Brevibacillus_phage	95.5	8.5e-29
AYB39998.1|3884148_3884883_-	hypothetical protein	NA	A0A0K2CNP0	Brevibacillus_phage	97.1	1.5e-133
AYB39999.1|3884879_3885980_-	hypothetical protein	NA	NA	NA	NA	NA
AYB40000.1|3885966_3886317_-	HNH endonuclease	NA	S5M5S6	Brevibacillus_phage	89.7	5.6e-57
AYB40001.1|3886330_3886735_-	single-stranded DNA-binding protein	NA	S5MP28	Brevibacillus_phage	96.3	1.5e-66
AYB40002.1|3886736_3887339_-	hypothetical protein	NA	S5M650	Brevibacillus_phage	92.5	1.2e-96
AYB40003.1|3887349_3887835_-	hypothetical protein	NA	S5M9S4	Brevibacillus_phage	92.5	2.0e-73
AYB40004.1|3887831_3888089_-	hypothetical protein	NA	S5MU07	Brevibacillus_phage	85.9	2.8e-37
AYB40005.1|3888072_3888321_-	hypothetical protein	NA	A0A0K2CNT7	Brevibacillus_phage	56.1	8.3e-15
AYB41597.1|3888553_3888742_-	hypothetical protein	NA	S5MBR7	Brevibacillus_phage	95.2	5.7e-24
AYB40006.1|3888764_3889013_-	XRE family transcriptional regulator	NA	S5MNZ7	Brevibacillus_phage	100.0	3.1e-38
AYB40007.1|3889146_3889335_-	DNA-binding protein	NA	U5P0W4	Brevibacillus_phage	91.9	7.9e-26
AYB40008.1|3889423_3889849_+	hypothetical protein	NA	NA	NA	NA	NA
AYB40009.1|3889993_3890230_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB41598.1|3890580_3891024_+	XRE family transcriptional regulator	NA	A8ATX5	Listeria_phage	36.8	7.2e-09
AYB40010.1|3891100_3891733_+|terminase	terminase	terminase	A0A2H4JA43	uncultured_Caudovirales_phage	25.5	2.4e-10
AYB40011.1|3891849_3893031_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	66.8	1.0e-150
AYB40012.1|3893176_3894838_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	48.2	4.1e-89
3898630:3898644	attR	CGCTGATCTAAGAGC	NA	NA	NA	NA
>prophage 19
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	4452987	4502506	5577844	protease,transposase,tRNA	Paenibacillus_phage(21.05%)	50	NA	NA
AYB40500.1|4452987_4454358_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
AYB40501.1|4454369_4456271_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AYB40502.1|4456282_4456999_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
AYB40503.1|4457237_4457489_+	hypothetical protein	NA	NA	NA	NA	NA
AYB40504.1|4457669_4458518_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	32.8	1.1e-16
AYB40505.1|4458702_4459461_+	ParA family protein	NA	Q8JL10	Natrialba_phage	29.2	3.9e-23
AYB40506.1|4459457_4460303_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.4	5.2e-16
AYB40507.1|4460315_4461476_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
AYB40508.1|4461533_4462160_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	36.2	3.8e-16
AYB40509.1|4462368_4462620_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
AYB40510.1|4462641_4463556_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AYB40511.1|4463560_4463776_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
AYB40512.1|4464119_4466051_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AYB40513.1|4466312_4466528_-	hypothetical protein	NA	NA	NA	NA	NA
AYB41616.1|4466647_4467358_+	hypothetical protein	NA	NA	NA	NA	NA
AYB40514.1|4467407_4467983_-	hypothetical protein	NA	NA	NA	NA	NA
AYB40515.1|4468150_4468804_-	recombinase family protein	NA	E5DV73	Deep-sea_thermophilic_phage	43.0	1.9e-42
AYB40516.1|4468944_4469754_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	54.9	4.0e-66
AYB40517.1|4469819_4470494_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	43.8	1.3e-41
AYB40518.1|4470879_4471065_-	hypothetical protein	NA	NA	NA	NA	NA
AYB40519.1|4471280_4471874_+	hypothetical protein	NA	NA	NA	NA	NA
AYB40520.1|4471998_4473423_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.8	9.1e-122
AYB40521.1|4473454_4473916_-	VanZ family protein	NA	NA	NA	NA	NA
AYB40522.1|4474695_4475106_+	hypothetical protein	NA	NA	NA	NA	NA
AYB40523.1|4475413_4476052_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	31.2	1.1e-10
AYB40524.1|4476170_4477271_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AYB40525.1|4477410_4477698_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AYB40526.1|4477722_4478190_+	single-stranded DNA-binding protein	NA	S5MNH0	Brevibacillus_phage	69.7	5.0e-53
AYB40527.1|4478242_4478473_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AYB40528.1|4478548_4479529_+	DUF2232 domain-containing protein	NA	NA	NA	NA	NA
AYB40529.1|4479544_4481482_+	hypothetical protein	NA	NA	NA	NA	NA
AYB40530.1|4481497_4481941_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AYB40531.1|4481969_4483316_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	51.6	1.5e-121
AYB40532.1|4483624_4484911_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	38.5	1.6e-72
AYB40533.1|4486563_4486773_+	hypothetical protein	NA	NA	NA	NA	NA
AYB40534.1|4486968_4487340_-	hypothetical protein	NA	NA	NA	NA	NA
AYB40535.1|4487707_4489201_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A7K9	Microcystis_virus	47.7	2.2e-17
AYB40536.1|4489369_4490080_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	41.5	2.5e-43
AYB40537.1|4490072_4491905_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	34.0	3.0e-32
AYB40538.1|4491901_4493287_+	transcriptional regulator	NA	NA	NA	NA	NA
AYB40539.1|4493273_4494056_+	hypothetical protein	NA	NA	NA	NA	NA
AYB40540.1|4494074_4494863_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	38.2	4.5e-46
AYB40541.1|4494886_4495201_-	hypothetical protein	NA	NA	NA	NA	NA
AYB40542.1|4495448_4496726_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	30.5	4.5e-11
AYB40543.1|4497154_4497559_-	RidA family protein	NA	NA	NA	NA	NA
AYB40544.1|4498135_4498369_+	CxxH/CxxC protein	NA	NA	NA	NA	NA
AYB40545.1|4498374_4498854_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AYB40546.1|4499166_4500669_+	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
AYB40547.1|4500932_4501616_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	84.6	1.7e-105
AYB40548.1|4501609_4502506_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	84.9	4.4e-114
>prophage 20
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	5091241	5152193	5577844	holin,protease,terminase,head,plate,portal,capsid,tail,integrase,transposase	Paenibacillus_phage(23.4%)	77	5087743:5087759	5130648:5130664
5087743:5087759	attL	AGATGAAGCGATTGCCA	NA	NA	NA	NA
AYB41012.1|5091241_5092282_-|integrase	site-specific integrase	integrase	A0A223LI82	Staphylococcus_phage	48.9	1.7e-93
AYB41013.1|5092339_5092474_-	DNA-binding protein	NA	NA	NA	NA	NA
AYB41014.1|5092518_5093376_+	helix-turn-helix domain-containing protein	NA	S5M5V5	Brevibacillus_phage	83.2	1.1e-117
AYB41015.1|5094170_5095571_+	transcriptional regulator	NA	NA	NA	NA	NA
AYB41016.1|5096035_5096389_-	XRE family transcriptional regulator	NA	S5MAC0	Brevibacillus_phage	39.5	1.1e-09
AYB41017.1|5096576_5096780_+	XRE family transcriptional regulator	NA	S5M643	Brevibacillus_phage	42.6	9.8e-06
AYB41018.1|5096922_5097141_+	hypothetical protein	NA	R9TQ08	Paenibacillus_phage	65.5	6.0e-17
AYB41639.1|5097317_5097533_+	hypothetical protein	NA	S5MNR1	Brevibacillus_phage	61.2	1.6e-06
AYB41019.1|5097554_5098076_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	37.9	2.0e-18
AYB41020.1|5098177_5098402_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41021.1|5098459_5098687_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	66.7	8.1e-25
AYB41022.1|5099129_5099486_+	replication terminator protein	NA	A0A1L2JY32	Aeribacillus_phage	68.7	7.0e-39
AYB41023.1|5099501_5100212_+	hypothetical protein	NA	A0A1L2JZ42	Aeribacillus_phage	60.3	1.3e-73
AYB41024.1|5100388_5101687_+	chromosome segregation protein SMC	NA	Q5YA97	Bacillus_phage	72.1	1.1e-171
AYB41025.1|5101689_5102232_+	hypothetical protein	NA	A0A096XT05	Enterococcus_phage	47.0	3.3e-40
AYB41026.1|5102218_5103361_+	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	73.9	4.4e-159
AYB41027.1|5103379_5103964_+	hypothetical protein	NA	A0A0K2CZ91	Paenibacillus_phage	80.5	9.9e-67
AYB41028.1|5103973_5105554_+	DEAD/DEAH box helicase	NA	A0A2I7SC38	Paenibacillus_phage	89.7	3.8e-278
AYB41029.1|5105570_5105960_+	DUF3797 domain-containing protein	NA	A0A0K2CZU3	Paenibacillus_phage	61.7	1.0e-14
AYB41030.1|5106048_5108319_+	DNA primase	NA	A0A0K2CZ75	Paenibacillus_phage	84.1	0.0e+00
AYB41640.1|5108733_5109135_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7SC39	Paenibacillus_phage	68.4	3.5e-47
AYB41031.1|5109138_5109378_+	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	75.8	2.5e-24
AYB41032.1|5109374_5109893_+	sigma-70 family RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	39.0	2.1e-07
AYB41033.1|5109977_5110466_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41034.1|5110687_5110894_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41035.1|5110895_5111252_+	hypothetical protein	NA	A0A0K2CNQ4	Brevibacillus_phage	96.6	3.5e-67
AYB41036.1|5111289_5112054_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41037.1|5112111_5112537_+	transcriptional regulator	NA	A0A0K2CZI2	Paenibacillus_phage	73.0	5.7e-56
AYB41038.1|5113292_5113814_+	VanZ family protein	NA	NA	NA	NA	NA
AYB41039.1|5114514_5114862_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	43.9	1.8e-23
AYB41040.1|5114858_5115119_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41041.1|5115243_5115744_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	68.5	5.0e-59
AYB41042.1|5115740_5117450_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	56.2	3.6e-181
AYB41043.1|5117472_5117664_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41044.1|5117664_5118894_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	43.8	7.7e-85
AYB41045.1|5118890_5119712_+|protease	Clp protease ClpP	protease	A0A0C5AEN1	Bacteriophage	49.0	2.6e-52
AYB41046.1|5119715_5121134_+|capsid	phage major capsid protein	capsid	A0A1B1IQC5	uncultured_Mediterranean_phage	33.6	3.0e-40
AYB41047.1|5121185_5121449_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41048.1|5121448_5122003_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AYB41049.1|5122056_5122548_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41050.1|5122544_5122895_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41051.1|5122881_5123373_+	hypothetical protein	NA	A0A1L2JY58	Aeribacillus_phage	32.1	1.1e-10
AYB41052.1|5123362_5124361_+	DUF3383 family protein	NA	A0A1L2JZ70	Aeribacillus_phage	44.2	2.8e-69
AYB41053.1|5124372_5124771_+	DUF3277 family protein	NA	A0A1L2K2P1	Aeribacillus_phage	49.2	3.8e-25
AYB41054.1|5124798_5125122_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41055.1|5125320_5126001_+	hypothetical protein	NA	M4ZR40	Bacillus_phage	36.3	8.7e-22
AYB41056.1|5126260_5127586_+	hypothetical protein	NA	A0A1J0MCL0	Streptomyces_phage	32.5	1.7e-13
AYB41057.1|5127585_5128080_+	hypothetical protein	NA	E5DV59	Deep-sea_thermophilic_phage	33.1	6.5e-11
AYB41058.1|5128089_5128410_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41059.1|5128402_5129194_+	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	45.5	7.9e-59
AYB41060.1|5129190_5129589_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41061.1|5129567_5129930_+	DUF2634 domain-containing protein	NA	E5DV62	Deep-sea_thermophilic_phage	35.7	2.8e-11
AYB41062.1|5129919_5131083_+|plate	baseplate J/gp47 family protein	plate	A0A1L2JY69	Aeribacillus_phage	43.7	2.0e-87
5130648:5130664	attR	AGATGAAGCGATTGCCA	NA	NA	NA	NA
AYB41063.1|5131058_5131676_+	DUF2612 domain-containing protein	NA	A0A1L2JZ80	Aeribacillus_phage	40.0	6.9e-34
AYB41064.1|5131690_5132299_+	hypothetical protein	NA	E5DV66	Deep-sea_thermophilic_phage	42.4	9.5e-12
AYB41065.1|5132295_5133255_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41066.1|5133273_5133663_+	hypothetical protein	NA	A0A0A8WJ01	Clostridium_phage	30.5	5.5e-05
AYB41067.1|5133844_5134315_+|holin	holin	holin	NA	NA	NA	NA
AYB41068.1|5134311_5134557_+	hypothetical protein	NA	S5MNY8	Brevibacillus_phage	87.5	1.2e-29
AYB41069.1|5134553_5135210_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	S5M633	Brevibacillus_phage	93.2	6.3e-110
AYB41070.1|5135415_5135820_-	hypothetical protein	NA	NA	NA	NA	NA
AYB41071.1|5136234_5137515_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYB41072.1|5138188_5139262_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41073.1|5139342_5139534_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41641.1|5139605_5139800_+	hypothetical protein	NA	S5MAC2	Brevibacillus_phage	84.8	3.1e-17
AYB41074.1|5140125_5140320_+	XRE family transcriptional regulator	NA	A0A288WG80	Bacillus_phage	42.2	2.9e-07
AYB41075.1|5142157_5143138_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41076.1|5143261_5143945_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	84.6	1.7e-105
AYB41077.1|5143938_5144835_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	84.9	4.4e-114
AYB41078.1|5145399_5145723_-	hypothetical protein	NA	NA	NA	NA	NA
AYB41079.1|5146458_5146746_+	YolD-like family protein	NA	S5MAC2	Brevibacillus_phage	91.9	5.4e-42
AYB41642.1|5146816_5147347_-	hypothetical protein	NA	NA	NA	NA	NA
AYB41080.1|5147653_5148187_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41081.1|5148337_5149456_+	spore gernimation protein	NA	NA	NA	NA	NA
AYB41082.1|5149855_5150209_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41083.1|5150695_5151457_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41084.1|5151683_5152193_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 21
CP032410	Brevibacillus laterosporus strain E7593-50 chromosome, complete genome	5577844	5557285	5576710	5577844	protease	Paenibacillus_phage(38.1%)	27	NA	NA
AYB41420.1|5557285_5558095_+	hypothetical protein	NA	S5M5V5	Brevibacillus_phage	74.2	2.0e-102
AYB41421.1|5558211_5558295_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41422.1|5559045_5560341_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB41423.1|5560627_5560825_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41424.1|5560845_5561142_-	XRE family transcriptional regulator	NA	D2XQ11	Bacillus_virus	38.7	1.9e-10
AYB41425.1|5561332_5561542_+	XRE family transcriptional regulator	NA	A0A290G4F8	Caldibacillus_phage	57.4	4.0e-10
AYB41426.1|5561588_5562359_+	Rha family transcriptional regulator	NA	A0A0B5A507	Paenibacillus_phage	58.3	4.2e-57
AYB41427.1|5562373_5562577_+	DNA-binding protein	NA	A0A1B0T6C2	Bacillus_phage	36.5	3.7e-05
AYB41660.1|5562775_5562991_+	hypothetical protein	NA	S5MNR1	Brevibacillus_phage	61.2	1.6e-06
AYB41428.1|5563012_5563534_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	37.9	2.0e-18
AYB41429.1|5563635_5563860_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41430.1|5563917_5564145_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	66.7	8.1e-25
AYB41431.1|5564587_5564944_+	replication terminator protein	NA	A0A1L2JY32	Aeribacillus_phage	68.7	7.0e-39
AYB41432.1|5564959_5565670_+	hypothetical protein	NA	A0A1L2JZ42	Aeribacillus_phage	60.3	1.3e-73
AYB41433.1|5565846_5567145_+	chromosome segregation protein SMC	NA	Q5YA97	Bacillus_phage	72.1	1.1e-171
AYB41434.1|5567147_5567690_+	hypothetical protein	NA	A0A096XT05	Enterococcus_phage	47.0	3.3e-40
AYB41435.1|5567676_5568819_+	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	73.9	4.4e-159
AYB41436.1|5568837_5569422_+	hypothetical protein	NA	A0A0K2CZ91	Paenibacillus_phage	80.5	9.9e-67
AYB41437.1|5569431_5571012_+	DEAD/DEAH box helicase	NA	A0A2I7SC38	Paenibacillus_phage	89.7	3.8e-278
AYB41438.1|5571028_5571418_+	DUF3797 domain-containing protein	NA	A0A0K2CZU3	Paenibacillus_phage	61.7	1.0e-14
AYB41439.1|5571506_5573777_+	DNA primase	NA	A0A0K2CZ75	Paenibacillus_phage	84.1	0.0e+00
AYB41661.1|5574191_5574593_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7SC39	Paenibacillus_phage	68.4	3.5e-47
AYB41440.1|5574596_5574836_+	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	75.8	2.5e-24
AYB41441.1|5574832_5575351_+	sigma-70 family RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	39.0	2.1e-07
AYB41442.1|5575435_5575924_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41443.1|5576145_5576352_+	hypothetical protein	NA	NA	NA	NA	NA
AYB41444.1|5576353_5576710_+	hypothetical protein	NA	A0A0K2CNQ4	Brevibacillus_phage	96.6	3.5e-67
