The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	0	6696	4846886		Hokovirus(50.0%)	5	NA	NA
AYB19178.1|542_1418_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AYB19179.1|1633_3880_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	25.1	1.3e-10
AYB19180.1|3892_4423_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AYB19181.1|5105_5801_+	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AYB19182.1|5982_6696_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	6.9e-46
>prophage 2
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	17526	20060	4846886		Aichi_virus(50.0%)	2	NA	NA
AYB19192.1|17526_18945_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.5	3.0e-24
AYB19193.1|19298_20060_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
>prophage 3
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	34858	35395	4846886		Enterobacteria_phage(100.0%)	1	NA	NA
AYB19209.1|34858_35395_-	porin family protein	NA	A5LH44	Enterobacteria_phage	30.7	5.6e-16
>prophage 4
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	38659	46406	4846886	tRNA	Clostridium_phage(20.0%)	8	NA	NA
AYB19215.1|38659_39418_-	LysM peptidoglycan-binding domain-containing protein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
AYB19216.1|39443_39632_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19217.1|39682_40228_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AYB19218.1|40303_41821_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
AYB19219.1|41830_42929_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AYB19220.1|43033_44767_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	1.4e-63
AYB19221.1|44772_45486_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AYB19222.1|45509_46406_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.9	1.4e-30
>prophage 5
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	50388	56092	4846886		Pandoravirus(50.0%)	4	NA	NA
AYB19231.1|50388_51822_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.2	8.8e-32
AYB19232.1|51869_52763_-	transporter	NA	NA	NA	NA	NA
AYB19233.1|52846_52993_-	immunoglobulin	NA	NA	NA	NA	NA
AYB19234.1|53218_56092_-	glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.1	1.4e-262
>prophage 6
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	64360	65593	4846886		Catovirus(100.0%)	1	NA	NA
AYB19243.1|64360_65593_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	1.2e-101
>prophage 7
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	76781	77438	4846886		Bacillus_virus(100.0%)	1	NA	NA
AYB19256.1|76781_77438_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.2	4.3e-10
>prophage 8
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	85454	86927	4846886		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYB19263.1|85454_86927_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.2	1.5e-47
>prophage 9
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	92745	93900	4846886		Staphylococcus_phage(100.0%)	1	NA	NA
AYB19268.1|92745_93900_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	5.1e-131
>prophage 10
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	111212	112295	4846886		Geobacillus_virus(100.0%)	1	NA	NA
AYB19289.1|111212_112295_+	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
>prophage 11
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	134199	135078	4846886		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYB19308.1|134199_135078_-	amidohydrolase	NA	M1HPY5	Paramecium_bursaria_Chlorella_virus	28.4	3.5e-07
>prophage 12
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	138477	139950	4846886		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYB19311.1|138477_139950_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	6.0e-44
>prophage 13
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	155370	160511	4846886		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
AYB19328.1|155370_157014_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.7	1.1e-09
AYB19329.1|157320_157815_-	TIGR00645 family protein	NA	NA	NA	NA	NA
AYB19330.1|158094_158610_-	RNA helicase	NA	NA	NA	NA	NA
AYB19331.1|158701_159112_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19332.1|159098_159503_+	cytoplasmic protein	NA	NA	NA	NA	NA
AYB19333.1|159626_160511_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	48.2	1.5e-66
>prophage 14
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	166452	172157	4846886		Staphylococcus_phage(33.33%)	5	NA	NA
AYB19341.1|166452_167280_+	2,5-diketo-D-gluconic acid reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	8.6e-64
AYB19342.1|167476_168931_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
AYB19343.1|168975_169431_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.4e-20
AYB19344.1|169588_169783_-	hypothetical protein	NA	NA	NA	NA	NA
AYB19345.1|169985_172157_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.8	2.0e-104
>prophage 15
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	177995	181695	4846886		Bacillus_virus(50.0%)	3	NA	NA
AYB19351.1|177995_180254_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.0	1.0e-87
AYB19352.1|180364_181231_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYB19353.1|181302_181695_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	1.6e-20
>prophage 16
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	185010	186903	4846886		Bacillus_virus(100.0%)	1	NA	NA
AYB19358.1|185010_186903_-	DNA topoisomerase 4 subunit B	NA	G3M9Z3	Bacillus_virus	34.8	5.3e-93
>prophage 17
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	191303	193144	4846886		Erwinia_phage(50.0%)	2	NA	NA
AYB19364.1|191303_191975_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.9	5.7e-34
AYB19365.1|191980_193144_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	1.4e-88
>prophage 18
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	198900	199554	4846886		Staphylococcus_phage(100.0%)	1	NA	NA
AYB19372.1|198900_199554_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
>prophage 19
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	203605	205039	4846886		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYB19378.1|203605_205039_-	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.6	3.9e-40
>prophage 20
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	210267	227130	4846886	tRNA	Sinorhizobium_phage(14.29%)	16	NA	NA
AYB19382.1|210267_211509_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
AYB19383.1|211612_212434_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AYB19384.1|212531_212891_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AYB19385.1|212997_213609_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AYB19386.1|213616_213955_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19387.1|213858_214872_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
AYB19388.1|215099_215315_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AYB19389.1|215549_217295_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.9	4.7e-72
AYB23614.1|217444_219292_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AYB19390.1|219415_219922_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AYB19391.1|220202_220970_-	siderophore-interacting protein	NA	NA	NA	NA	NA
AYB19392.1|221201_221849_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AYB19393.1|221845_223414_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.2e-12
AYB19394.1|223801_225322_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
AYB19395.1|225608_225791_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19396.1|225750_227130_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.3	1.0e-32
>prophage 21
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	233321	234290	4846886		Enterobacteria_phage(100.0%)	1	NA	NA
AYB19402.1|233321_234290_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
>prophage 22
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	247484	249779	4846886		Tetraselmis_virus(100.0%)	1	NA	NA
AYB19418.1|247484_249779_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	9.7e-158
>prophage 23
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	255691	256837	4846886		Streptococcus_phage(100.0%)	1	NA	NA
AYB19424.1|255691_256837_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.6	3.5e-47
>prophage 24
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	267524	274173	4846886		Streptococcus_phage(25.0%)	9	NA	NA
AYB19434.1|267524_268388_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.6	1.1e-50
AYB19435.1|268451_270494_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
AYB19436.1|270451_270847_+	YraN family protein	NA	NA	NA	NA	NA
AYB19437.1|270868_271459_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.9	7.1e-12
AYB19438.1|271468_272044_+	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AYB19439.1|272110_272746_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AYB19440.1|272876_273395_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.2	9.0e-11
AYB19441.1|273374_273818_-	hypothetical protein	NA	NA	NA	NA	NA
AYB19442.1|273855_274173_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	50.0	6.5e-12
>prophage 25
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	281309	283250	4846886		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AYB19451.1|281309_283250_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.5	3.0e-51
>prophage 26
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	288734	295391	4846886		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
AYB19456.1|288734_291413_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.9e-24
AYB19457.1|291437_292940_-	transcription termination protein NusA	NA	NA	NA	NA	NA
AYB19458.1|292967_293432_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AYB19459.1|294047_295391_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
>prophage 27
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	298577	301465	4846886	protease	Pandoravirus(50.0%)	2	NA	NA
AYB19463.1|298577_299426_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.3	1.4e-21
AYB19464.1|299530_301465_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.1	2.0e-116
>prophage 28
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	308177	309668	4846886		Indivirus(50.0%)	2	NA	NA
AYB19473.1|308177_309149_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	7.8e-08
AYB19474.1|309380_309668_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.7	3.5e-17
>prophage 29
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	313777	328684	4846886		Staphylococcus_phage(25.0%)	17	NA	NA
AYB19480.1|313777_314590_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	9.7e-20
AYB19481.1|314802_315780_+	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.9	1.5e-06
AYB19482.1|315793_316780_+	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	1.1e-38
AYB19483.1|316800_317367_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.3	3.6e-53
AYB19484.1|317363_317939_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AYB19485.1|317907_318462_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AYB19486.1|318468_319194_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.1e-22
AYB19487.1|319241_320675_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AYB19488.1|320697_320985_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AYB19489.1|321102_321594_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AYB19490.1|321639_322494_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AYB19491.1|322490_322763_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
AYB19492.1|323012_323645_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
AYB19493.1|323719_324448_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AYB19494.1|324444_325098_-	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AYB19495.1|325324_327661_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.9	2.1e-38
AYB19496.1|327754_328684_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	1.5e-16
>prophage 30
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	335451	336555	4846886		Salmonella_phage(100.0%)	1	NA	NA
AYB19499.1|335451_336555_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.1	1.9e-74
>prophage 31
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	341344	345379	4846886	protease	Burkholderia_virus(50.0%)	4	NA	NA
AYB19505.1|341344_342835_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	21.9	2.7e-07
AYB19506.1|342950_343844_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AYB19507.1|343978_344770_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
AYB19508.1|344878_345379_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
>prophage 32
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	350247	351615	4846886	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYB23621.1|350247_351615_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.3	2.7e-22
>prophage 33
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	358471	359740	4846886		Oenococcus_phage(100.0%)	1	NA	NA
AYB19521.1|358471_359740_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.0	1.1e-59
>prophage 34
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	378195	379239	4846886		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYB19539.1|378195_379239_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 35
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	391323	394705	4846886		Ostreococcus_lucimarinus_virus(50.0%)	3	NA	NA
AYB19552.1|391323_392208_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
AYB19553.1|392290_392455_+	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
AYB19554.1|392605_394705_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.5	7.1e-22
>prophage 36
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	408745	413065	4846886	tRNA	Pandoravirus(33.33%)	6	NA	NA
AYB19561.1|408745_409318_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
AYB19562.1|409322_409865_-	DNA topoisomerase	NA	NA	NA	NA	NA
AYB19563.1|409891_410365_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AYB19564.1|410336_411461_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AYB19565.1|411592_412102_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
AYB19566.1|412117_413065_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	6.5e-07
>prophage 37
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	432958	438529	4846886		Tupanvirus(33.33%)	7	NA	NA
AYB19606.1|432958_434143_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
AYB19607.1|434214_436329_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	8.1e-58
AYB19608.1|436425_436896_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AYB19609.1|436991_437366_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AYB19610.1|437491_437779_-	sulfurtransferase TusB	NA	NA	NA	NA	NA
AYB19611.1|437786_438143_-	sulfurtransferase TusC	NA	NA	NA	NA	NA
AYB19612.1|438142_438529_-	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	2.1e-20
>prophage 38
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	444488	446396	4846886		Tupanvirus(100.0%)	1	NA	NA
AYB19621.1|444488_446396_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.7	2.2e-75
>prophage 39
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	450981	454978	4846886		environmental_Halophage(50.0%)	3	NA	NA
AYB19628.1|450981_453069_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	89.1	4.2e-67
AYB19629.1|453111_454329_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AYB19630.1|454414_454978_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	3.2e-62
>prophage 40
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	472486	473323	4846886		Vibrio_phage(100.0%)	1	NA	NA
AYB19643.1|472486_473323_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	1.9e-66
>prophage 41
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	490364	494127	4846886		Bacillus_phage(66.67%)	3	NA	NA
AYB19658.1|490364_491984_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.3	1.2e-141
AYB19659.1|492058_493411_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	22.9	9.5e-12
AYB19660.1|493407_494127_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 42
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	500739	501666	4846886	transposase	Sodalis_phage(100.0%)	1	NA	NA
AYB19667.1|500739_501666_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.1	4.4e-69
>prophage 43
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	507726	510120	4846886		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AYB19673.1|507726_510120_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	4.7e-14
>prophage 44
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	515168	518284	4846886		Ralstonia_phage(50.0%)	2	NA	NA
AYB19677.1|515168_516383_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.6	1.6e-135
AYB19678.1|516730_518284_-	TROVE domain-containing protein	NA	R4TL80	Halovirus	25.9	4.4e-29
>prophage 45
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	532519	534967	4846886		Dickeya_phage(100.0%)	1	NA	NA
AYB19690.1|532519_534967_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 46
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	556349	558157	4846886		Enterococcus_phage(50.0%)	2	NA	NA
AYB19709.1|556349_557090_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.4e-09
AYB19710.1|557086_558157_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	2.0e-20
>prophage 47
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	562284	563767	4846886		Planktothrix_phage(50.0%)	2	NA	NA
AYB19716.1|562284_562998_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.7e-15
AYB19717.1|562999_563767_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	7.5e-14
>prophage 48
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	569558	581221	4846886		Dickeya_phage(28.57%)	12	NA	NA
AYB19724.1|569558_570413_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	7.0e-45
AYB19725.1|570658_571714_-	cell division protein FtsX	NA	NA	NA	NA	NA
AYB19726.1|571706_572375_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.9e-13
AYB19727.1|572377_573853_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AYB19728.1|573978_574575_+	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
AYB19729.1|574561_574834_+	DUF1145 family protein	NA	NA	NA	NA	NA
AYB19730.1|574855_575227_-	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
AYB19731.1|575368_575995_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	64.6	3.8e-32
AYB19732.1|576075_578274_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	36.0	2.9e-111
AYB19733.1|578473_580117_+	methyl-accepting chemotaxis citrate transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.4	1.8e-12
AYB23626.1|580140_580386_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
AYB23627.1|580555_581221_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.9	1.6e-57
>prophage 49
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	597568	599611	4846886		Indivirus(100.0%)	1	NA	NA
AYB19746.1|597568_599611_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	3.6e-47
>prophage 50
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	614326	615229	4846886		Burkholderia_virus(100.0%)	1	NA	NA
AYB19759.1|614326_615229_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.5	3.4e-05
>prophage 51
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	643958	645952	4846886		Bacillus_virus(50.0%)	2	NA	NA
AYB19780.1|643958_644972_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	9.6e-17
AYB19781.1|644968_645952_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	6.7e-15
>prophage 52
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	664093	673276	4846886		Escherichia_phage(25.0%)	11	NA	NA
AYB19798.1|664093_666427_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.4	9.8e-73
AYB19799.1|666579_667242_+	OmpA family lipoprotein	NA	NA	NA	NA	NA
AYB19800.1|667460_668435_+	bifunctional glyoxylate/hydroxypyruvate reductase B	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.1	5.4e-17
AYB19801.1|668484_669195_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
AYB19802.1|669633_669924_+	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
AYB19803.1|670211_670424_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AYB19804.1|670597_671137_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19805.1|671507_671993_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB19806.1|671980_672268_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AYB19807.1|672445_672913_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB19808.1|673126_673276_-	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	69.4	3.6e-13
>prophage 53
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	677469	678465	4846886		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AYB19813.1|677469_678465_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.8	8.3e-13
>prophage 54
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	704948	706799	4846886	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYB19838.1|704948_706799_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	24.3	6.5e-11
>prophage 55
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	730300	739802	4846886		Rhizobium_phage(16.67%)	9	NA	NA
AYB19860.1|730300_730552_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
AYB19861.1|730638_731070_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AYB19862.1|731317_732862_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AYB19863.1|732871_734155_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
AYB19864.1|734158_735121_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AYB19865.1|735107_736142_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.1e-07
AYB19866.1|736435_737461_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AYB19867.1|737470_738667_-	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	1.9e-35
AYB19868.1|738869_739802_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	37.2	5.5e-35
>prophage 56
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	754179	758733	4846886		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AYB19881.1|754179_754659_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.2e-28
AYB19882.1|754686_755496_-	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	31.8	1.3e-24
AYB19883.1|755593_755761_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AYB19884.1|755781_756018_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AYB19885.1|756235_756901_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AYB19886.1|757076_758297_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.1	7.2e-43
AYB23629.1|758277_758733_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.2e-48
>prophage 57
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	764711	769737	4846886		Pseudomonas_phage(33.33%)	4	NA	NA
AYB19894.1|764711_766397_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.0	8.2e-21
AYB19895.1|766653_767277_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.8e-19
AYB19896.1|767331_767607_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AYB19897.1|767625_769737_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 58
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	773986	775378	4846886		environmental_Halophage(100.0%)	1	NA	NA
AYB19901.1|773986_775378_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.9	6.7e-69
>prophage 59
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	784462	790358	4846886		Wolbachia_phage(50.0%)	3	NA	NA
AYB19906.1|784462_785500_+	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	43.4	5.5e-68
AYB19907.1|786798_787416_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AYB19908.1|787490_790358_+	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.3	5.0e-95
>prophage 60
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	794210	800247	4846886	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
AYB19914.1|794210_796937_-	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.1	1.2e-34
AYB19915.1|797156_797852_-	protein MgtC	NA	G3MA03	Bacillus_virus	42.4	2.8e-15
AYB23633.1|798360_799263_+	EamA family transporter	NA	NA	NA	NA	NA
AYB19916.1|799305_800247_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	4.7e-66
>prophage 61
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	808611	809994	4846886		Pandoravirus(100.0%)	1	NA	NA
AYB19926.1|808611_809994_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.1	1.2e-41
>prophage 62
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	822943	827900	4846886		Micromonas_pusilla_virus(50.0%)	5	NA	NA
AYB19940.1|822943_824632_-	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.7	4.2e-57
AYB19941.1|824738_824837_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AYB19942.1|825470_825560_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AYB19943.1|825652_826513_+	EamA family transporter	NA	NA	NA	NA	NA
AYB19944.1|826715_827900_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.1	9.8e-13
>prophage 63
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	836403	837355	4846886		Synechococcus_phage(50.0%)	2	NA	NA
AYB23635.1|836403_836832_-	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	38.2	1.7e-15
AYB23636.1|836941_837355_-	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	37.0	1.0e-17
>prophage 64
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	844998	858809	4846886		Brazilian_cedratvirus(20.0%)	10	NA	NA
AYB23637.1|844998_845616_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.8e-10
AYB19961.1|845621_847022_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AYB19962.1|847211_847844_-	molecular chaperone TorD	NA	NA	NA	NA	NA
AYB19963.1|847836_850389_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.2	4.8e-73
AYB19964.1|850378_851563_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AYB23638.1|851692_852385_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	3.8e-17
AYB19965.1|852357_853398_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AYB19966.1|853477_856213_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.2	1.4e-33
AYB19967.1|856238_857576_-	MFS transporter	NA	NA	NA	NA	NA
AYB19968.1|857660_858809_-	D-galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	8.0e-52
>prophage 65
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	863657	873448	4846886		Oenococcus_phage(25.0%)	9	NA	NA
AYB19974.1|863657_864851_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.7	6.2e-47
AYB19975.1|864965_865862_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB19976.1|865880_868295_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.2e-115
AYB19977.1|868323_869397_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AYB19978.1|869544_870645_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
AYB19979.1|870649_872050_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AYB19980.1|872710_872851_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AYB19981.1|872867_873227_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AYB19982.1|873190_873448_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 66
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	880441	887333	4846886		Moraxella_phage(33.33%)	7	NA	NA
AYB19988.1|880441_881905_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	1.2e-63
AYB19989.1|881947_882613_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AYB19990.1|882707_883433_-	phosphate transport system regulator PhoU	NA	NA	NA	NA	NA
AYB23640.1|883447_884221_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	2.0e-14
AYB19991.1|884307_885198_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AYB19992.1|885197_886157_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AYB19993.1|886292_887333_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	36.2	4.1e-47
>prophage 67
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	891740	895129	4846886		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AYB19996.1|891740_893570_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	6.2e-131
AYB19997.1|893758_895129_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.7	8.7e-37
>prophage 68
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	908018	909011	4846886		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AYB20011.1|908018_909011_+	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	3.2e-49
>prophage 69
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	912304	916322	4846886		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
AYB20014.1|912304_914173_+	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.5e-63
AYB20015.1|914389_914809_+	D-ribose pyranase	NA	NA	NA	NA	NA
AYB23643.1|914816_916322_+	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	5.1e-14
>prophage 70
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	931721	933368	4846886		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AYB20026.1|931721_933368_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	3.1e-65
>prophage 71
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	938728	939070	4846886		Pseudomonas_phage(100.0%)	1	NA	NA
AYB20031.1|938728_939070_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.5	1.7e-05
>prophage 72
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	942510	947931	4846886		Bacillus_phage(33.33%)	5	NA	NA
AYB20037.1|942510_944535_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	1.1e-112
AYB20038.1|944574_946056_-	guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase	NA	NA	NA	NA	NA
AYB20039.1|946061_946184_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AYB20040.1|946192_947458_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.4	4.1e-41
AYB20041.1|947601_947931_+	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 73
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	952055	957559	4846886		Enterobacteria_phage(40.0%)	6	NA	NA
AYB20045.1|952055_953186_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	2.3e-27
AYB20046.1|953182_954445_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	27.0	1.2e-24
AYB20047.1|954444_955512_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	1.4e-98
AYB20048.1|955544_955769_+	sugar nucleotidyltransferase	NA	I7I009	Enterobacteria_phage	52.2	2.0e-07
AYB20049.1|955719_956424_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AYB20050.1|956428_957559_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 74
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	974998	978915	4846886		Bacillus_phage(100.0%)	3	NA	NA
AYB20068.1|974998_975901_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	31.0	5.9e-26
AYB20069.1|975900_976617_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AYB20070.1|976752_978915_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	1.7e-116
>prophage 75
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	983791	985621	4846886		Catovirus(100.0%)	1	NA	NA
AYB23646.1|983791_985621_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	5.9e-81
>prophage 76
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	999865	1003300	4846886		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AYB20091.1|999865_1001506_+	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.5	3.4e-40
AYB20092.1|1001711_1001966_+	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AYB20093.1|1001969_1002518_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AYB20094.1|1002520_1003300_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.7	1.5e-25
>prophage 77
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1014176	1014791	4846886		Streptococcus_phage(100.0%)	1	NA	NA
AYB20103.1|1014176_1014791_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.3	6.2e-19
>prophage 78
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1027242	1030029	4846886		Enterococcus_phage(100.0%)	1	NA	NA
AYB20111.1|1027242_1030029_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	27.0	1.3e-47
>prophage 79
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1035386	1036436	4846886		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AYB20117.1|1035386_1036436_-	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.0	4.1e-10
>prophage 80
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1054874	1057669	4846886		Staphylococcus_phage(50.0%)	3	NA	NA
AYB20134.1|1054874_1055771_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	100.0	1.5e-66
AYB20135.1|1055935_1056832_+	sugar kinase	NA	NA	NA	NA	NA
AYB20136.1|1056865_1057669_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	7.6e-25
>prophage 81
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1065868	1068919	4846886		Escherichia_phage(100.0%)	1	NA	NA
AYB20148.1|1065868_1068919_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	1.6e-06
>prophage 82
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1087651	1091557	4846886		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
AYB20168.1|1087651_1088272_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
AYB20169.1|1088278_1089031_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AYB20170.1|1089042_1089438_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AYB20171.1|1089488_1090862_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	5.5e-15
AYB20172.1|1090858_1091557_-	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 83
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1104620	1106156	4846886		Staphylococcus_phage(100.0%)	1	NA	NA
AYB20186.1|1104620_1106156_+	autoinducer 2 import ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
>prophage 84
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1116989	1121600	4846886		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
AYB20199.1|1116989_1117835_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
AYB20200.1|1118233_1118473_+	cell division protein ZapB	NA	NA	NA	NA	NA
AYB20201.1|1118694_1119180_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AYB20202.1|1119272_1120202_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AYB20203.1|1120268_1121600_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
>prophage 85
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1139694	1140954	4846886		Aeromonas_phage(100.0%)	1	NA	NA
AYB23652.1|1139694_1140954_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	1.0e-100
>prophage 86
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1149051	1152226	4846886		Synechococcus_phage(50.0%)	2	NA	NA
AYB20224.1|1149051_1149714_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
AYB20225.1|1149724_1152226_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.4	3.6e-12
>prophage 87
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1173342	1175187	4846886		Acinetobacter_phage(100.0%)	1	NA	NA
AYB20244.1|1173342_1175187_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.0	1.7e-11
>prophage 88
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1183843	1186937	4846886		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AYB20248.1|1183843_1184794_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	6.0e-29
AYB20249.1|1185002_1185176_-	hypothetical protein	NA	NA	NA	NA	NA
AYB20250.1|1185752_1186937_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
>prophage 89
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1191057	1204566	4846886		Chrysochromulina_ericina_virus(25.0%)	10	NA	NA
AYB20257.1|1191057_1195086_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
AYB20258.1|1195162_1199386_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
AYB20259.1|1199468_1199750_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23653.1|1199751_1200072_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB20260.1|1200167_1200410_+	hypothetical protein	NA	NA	NA	NA	NA
AYB20261.1|1200475_1201504_+	type III secretion system effector arginine glycosyltransferase SseK1	NA	Q8HAB2	Salmonella_phage	60.5	4.0e-103
AYB20262.1|1201724_1202858_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
AYB20263.1|1202854_1203625_-	thiazole synthase	NA	NA	NA	NA	NA
AYB20264.1|1203626_1203827_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AYB20265.1|1203807_1204566_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	28.5	5.9e-11
>prophage 90
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1209921	1211684	4846886		Klosneuvirus(50.0%)	3	NA	NA
AYB20271.1|1209921_1210593_+	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	2.1e-20
AYB20272.1|1210634_1211225_+	DUF416 family protein	NA	NA	NA	NA	NA
AYB20273.1|1211411_1211684_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
>prophage 91
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1217168	1218758	4846886		Prochlorococcus_phage(100.0%)	1	NA	NA
AYB20279.1|1217168_1218758_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	8.4e-68
>prophage 92
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1232653	1236337	4846886		Dickeya_phage(100.0%)	1	NA	NA
AYB20286.1|1232653_1236337_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 93
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1247671	1248019	4846886		Burkholderia_phage(100.0%)	1	NA	NA
AYB20297.1|1247671_1248019_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 94
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1260605	1261715	4846886		Mycoplasma_phage(100.0%)	1	NA	NA
AYB20308.1|1260605_1261715_+	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 95
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1268973	1269582	4846886		Lactococcus_phage(100.0%)	1	NA	NA
AYB20315.1|1268973_1269582_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 96
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1276316	1278843	4846886		Salmonella_phage(50.0%)	2	NA	NA
AYB20323.1|1276316_1277732_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
AYB20324.1|1277763_1278843_+	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	1.2e-28
>prophage 97
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1282938	1286542	4846886		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AYB20332.1|1282938_1285764_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
AYB20333.1|1285728_1285845_+	hypothetical protein	NA	NA	NA	NA	NA
AYB20334.1|1286011_1286542_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	88.9	3.9e-54
>prophage 98
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1308939	1311006	4846886		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYB20341.1|1308939_1311006_+	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	23.7	6.3e-15
>prophage 99
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1315893	1317243	4846886		Moraxella_phage(100.0%)	1	NA	NA
AYB20347.1|1315893_1317243_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	6.7e-159
>prophage 100
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1323455	1325414	4846886		Staphylococcus_phage(100.0%)	1	NA	NA
AYB20354.1|1323455_1325414_-	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	1.6e-89
>prophage 101
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1335091	1343462	4846886		Escherichia_phage(25.0%)	8	NA	NA
AYB20364.1|1335091_1337239_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.6	5.9e-32
AYB20365.1|1337604_1338513_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	37.1	5.9e-34
AYB20366.1|1338770_1339235_-	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
AYB20367.1|1339356_1339800_-	VOC family metalloprotein YjdN	NA	NA	NA	NA	NA
AYB20368.1|1339919_1340255_-	phnA family protein	NA	NA	NA	NA	NA
AYB20369.1|1340722_1342225_+	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	30.5	3.5e-55
AYB20370.1|1342294_1342384_+	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
AYB23659.1|1342391_1343462_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	25.3	6.0e-09
>prophage 102
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1361666	1366141	4846886		Escherichia_phage(100.0%)	4	NA	NA
AYB23661.1|1361666_1364066_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	81.6	0.0e+00
AYB20382.1|1364079_1364706_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	92.3	2.9e-120
AYB20383.1|1364698_1365472_+	dimethyl sulfoxide reductase	NA	A0A077SK59	Escherichia_phage	79.8	3.5e-104
AYB20384.1|1365487_1366141_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	72.4	1.8e-80
>prophage 103
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1382291	1384275	4846886		Cronobacter_phage(50.0%)	2	NA	NA
AYB20400.1|1382291_1382585_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.6e-12
AYB20401.1|1382628_1384275_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
>prophage 104
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1389351	1389885	4846886		Morganella_phage(100.0%)	1	NA	NA
AYB20409.1|1389351_1389885_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	4.7e-47
>prophage 105
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1393612	1394590	4846886		Tupanvirus(100.0%)	1	NA	NA
AYB20414.1|1393612_1394590_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.4	1.3e-26
>prophage 106
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1402314	1402860	4846886		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AYB20420.1|1402314_1402860_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
>prophage 107
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1407882	1411071	4846886		Vibrio_phage(50.0%)	2	NA	NA
AYB20425.1|1407882_1409205_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.2	1.8e-15
AYB20426.1|1409214_1411071_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	5.8e-60
>prophage 108
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1416616	1421031	4846886		Pithovirus(50.0%)	3	NA	NA
AYB20433.1|1416616_1417915_+	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.6	8.4e-66
AYB20434.1|1418129_1418555_+	transcriptional regulator	NA	NA	NA	NA	NA
AYB20435.1|1418592_1421031_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	2.6e-68
>prophage 109
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1425895	1427059	4846886		Ralstonia_phage(100.0%)	1	NA	NA
AYB20443.1|1425895_1427059_+	glutathionylspermidine synthase preATP-grasp family protein	NA	B2ZXR7	Ralstonia_phage	43.5	2.0e-82
>prophage 110
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1465131	1466887	4846886		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AYB20484.1|1465131_1465662_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
AYB20485.1|1465888_1466887_-	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
>prophage 111
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1478810	1482150	4846886		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AYB20499.1|1478810_1479053_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	5.6e-16
AYB20500.1|1479042_1479327_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	69.1	1.9e-31
AYB20501.1|1479330_1479795_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	55.8	2.7e-51
AYB20502.1|1480011_1482150_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	1.5e-266
>prophage 112
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1485816	1492365	4846886	transposase	Enterobacteria_phage(33.33%)	7	NA	NA
AYB20505.1|1485816_1486764_-	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	21.5	1.2e-13
AYB20506.1|1486908_1487007_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
AYB20507.1|1487147_1489856_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.8	5.9e-45
AYB20508.1|1489971_1490418_-|transposase	transposase	transposase	NA	NA	NA	NA
AYB20509.1|1490492_1490879_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AYB20510.1|1490955_1491417_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AYB20511.1|1491429_1492365_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.9	5.5e-51
>prophage 113
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1504472	1509419	4846886	tRNA	Klosneuvirus(50.0%)	3	NA	NA
AYB20525.1|1504472_1507328_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	1.6e-141
AYB20526.1|1507327_1507810_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AYB20527.1|1507907_1509419_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
>prophage 114
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1517186	1518206	4846886		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AYB20536.1|1517186_1518206_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	7.9e-43
>prophage 115
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1557653	1563928	4846886		Liberibacter_phage(50.0%)	2	NA	NA
AYB20574.1|1557653_1560920_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	2.8e-49
AYB20575.1|1562308_1563928_-	DNA methyltransferase	NA	A0A2H4UVW8	Bodo_saltans_virus	22.0	1.9e-06
>prophage 116
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1574593	1576255	4846886		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYB20584.1|1574593_1576255_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 117
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1581986	1583045	4846886		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
AYB20589.1|1581986_1583045_+	SIS domain-containing protein	NA	J3IZE6	Acanthamoeba_polyphaga_lentillevirus	23.6	2.0e-09
>prophage 118
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1587299	1588579	4846886		Shigella_phage(50.0%)	2	NA	NA
AYB20593.1|1587299_1588037_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	3.4e-64
AYB20594.1|1588039_1588579_-	primosomal protein 1	NA	T1SA92	Salmonella_phage	65.6	2.2e-28
>prophage 119
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1593561	1594626	4846886		Bacillus_virus(100.0%)	1	NA	NA
AYB20600.1|1593561_1594626_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.1	4.2e-15
>prophage 120
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1598404	1601303	4846886		Streptococcus_phage(50.0%)	3	NA	NA
AYB20604.1|1598404_1599994_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	3.1e-30
AYB20605.1|1600395_1601013_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AYB20606.1|1601123_1601303_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.5e-10
>prophage 121
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1606850	1608173	4846886		Geobacillus_virus(100.0%)	1	NA	NA
AYB20611.1|1606850_1608173_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.4	1.8e-79
>prophage 122
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1616284	1621448	4846886		Enterococcus_phage(33.33%)	3	NA	NA
AYB23671.1|1616284_1617517_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	45.2	3.3e-88
AYB20619.1|1617634_1619302_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.7	1.7e-42
AYB20620.1|1619474_1621448_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.4	1.8e-11
>prophage 123
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1625397	1626822	4846886		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AYB20627.1|1625397_1626822_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.7	5.1e-08
>prophage 124
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1645561	1657865	4846886		Cyanophage(20.0%)	12	NA	NA
AYB20643.1|1645561_1646515_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.0	9.7e-11
AYB20644.1|1646625_1647216_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AYB20645.1|1647272_1647839_-	acetate uptake transporter	NA	NA	NA	NA	NA
AYB20646.1|1647988_1648702_-	acidic protein MsyB	NA	NA	NA	NA	NA
AYB20647.1|1648737_1649142_-	DUF2541 family protein	NA	NA	NA	NA	NA
AYB20648.1|1649490_1651407_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.1	1.2e-148
AYB20649.1|1651492_1652632_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.0	4.2e-29
AYB20650.1|1652912_1653860_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB20651.1|1653986_1654331_+	hypothetical protein	NA	NA	NA	NA	NA
AYB20652.1|1654391_1654925_-	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	1.2e-53
AYB20653.1|1654941_1655385_-	transcriptional regulator	NA	NA	NA	NA	NA
AYB20654.1|1655765_1657865_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	9.5e-35
>prophage 125
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1678025	1679519	4846886		Tetraselmis_virus(100.0%)	1	NA	NA
AYB20672.1|1678025_1679519_+	DUF229 domain-containing protein	NA	A0A2P0VMN7	Tetraselmis_virus	30.6	9.1e-32
>prophage 126
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1684084	1685251	4846886		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYB20676.1|1684084_1685251_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	7.5e-90
>prophage 127
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1691749	1694584	4846886	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYB23673.1|1691749_1694584_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	5.0e-79
>prophage 128
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1713593	1714742	4846886		Halovirus(100.0%)	1	NA	NA
AYB20699.1|1713593_1714742_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.0e-50
>prophage 129
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1720278	1725918	4846886		Hepacivirus(50.0%)	4	NA	NA
AYB20704.1|1720278_1721832_-	ATP-dependent acyl-CoA ligase	NA	Q75ZG1	Hepacivirus	24.6	2.0e-29
AYB20705.1|1721894_1723112_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AYB20706.1|1723223_1724366_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYB20707.1|1724400_1725918_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	22.2	1.4e-08
>prophage 130
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1734235	1735669	4846886		Bacillus_phage(50.0%)	2	NA	NA
AYB20717.1|1734235_1734715_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	2.3e-29
AYB20718.1|1734820_1735669_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	47.8	5.8e-07
>prophage 131
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1743398	1748830	4846886		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AYB20726.1|1743398_1746305_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	2.9e-21
AYB20727.1|1746478_1748830_-	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.5	4.2e-15
>prophage 132
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1756603	1757311	4846886		Bacillus_virus(100.0%)	1	NA	NA
AYB20733.1|1756603_1757311_-	thiamine import ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.3	8.2e-23
>prophage 133
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1767006	1768578	4846886		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
AYB20742.1|1767006_1768578_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.1	6.9e-06
>prophage 134
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1800555	1801599	4846886		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AYB20771.1|1800555_1801599_+	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	3.4e-102
>prophage 135
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1805856	1806420	4846886		Sphingobium_phage(100.0%)	1	NA	NA
AYB20777.1|1805856_1806420_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.0	2.6e-11
>prophage 136
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1817510	1818935	4846886		Erysipelothrix_phage(100.0%)	1	NA	NA
AYB20785.1|1817510_1818935_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.2e-41
>prophage 137
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1830277	1839981	4846886		Escherichia_phage(25.0%)	9	NA	NA
AYB20795.1|1830277_1831045_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	1.7e-29
AYB20796.1|1831074_1831869_-	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AYB20797.1|1831889_1832750_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AYB20798.1|1832856_1833204_-	hypothetical protein	NA	NA	NA	NA	NA
AYB20799.1|1833405_1835016_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	58.7	1.9e-19
AYB20800.1|1835093_1837484_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AYB20801.1|1837689_1838226_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
AYB20802.1|1838283_1838946_-	carbonate dehydratase	NA	NA	NA	NA	NA
AYB20803.1|1839054_1839981_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	5.9e-21
>prophage 138
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1850737	1852156	4846886		unidentified_phage(100.0%)	1	NA	NA
AYB20815.1|1850737_1852156_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	1.4e-26
>prophage 139
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1855172	1857647	4846886		Bodo_saltans_virus(100.0%)	1	NA	NA
AYB20819.1|1855172_1857647_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.2	1.1e-34
>prophage 140
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1862840	1863638	4846886		Planktothrix_phage(100.0%)	1	NA	NA
AYB20822.1|1862840_1863638_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	2.7e-14
>prophage 141
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1877028	1877373	4846886		Lake_Baikal_phage(100.0%)	1	NA	NA
AYB20834.1|1877028_1877373_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
>prophage 142
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1881356	1887183	4846886	protease	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AYB20839.1|1881356_1882784_+|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
AYB20840.1|1882936_1884094_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
AYB20841.1|1884150_1887183_-	viral enhancin protein	NA	A0A288QW20	Cyclophragma_undans_nucleopolyhedrovirus	25.8	1.2e-46
>prophage 143
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1899405	1900164	4846886		Flavobacterium_phage(100.0%)	1	NA	NA
AYB20855.1|1899405_1900164_+	ditrans,polycis-undecaprenyl-diphosphate synthase ((2E,6E)-farnesyl-diphosphate specific)	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
>prophage 144
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1908978	1913081	4846886		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
AYB20864.1|1908978_1909575_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
AYB20865.1|1909598_1913081_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
>prophage 145
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1927068	1928100	4846886		Planktothrix_phage(100.0%)	1	NA	NA
AYB20881.1|1927068_1928100_-	methionine import ATP-binding protein MetN 1	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 146
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1935116	1935920	4846886		Indivirus(100.0%)	1	NA	NA
AYB20883.1|1935116_1935920_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	1.6e-38
>prophage 147
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1939970	1944181	4846886		Lactobacillus_phage(33.33%)	5	NA	NA
AYB20888.1|1939970_1941338_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
AYB20889.1|1941409_1942165_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AYB20890.1|1942199_1942922_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYB20891.1|1942918_1943386_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
AYB23680.1|1943449_1944181_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
>prophage 148
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1951195	1953835	4846886		Vibrio_phage(100.0%)	1	NA	NA
AYB20898.1|1951195_1953835_+	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.3	5.7e-77
>prophage 149
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1977124	1979899	4846886		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYB20918.1|1977124_1979899_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	40.0	2.2e-31
>prophage 150
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	1998063	1998642	4846886		Caulobacter_phage(100.0%)	1	NA	NA
AYB20936.1|1998063_1998642_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
>prophage 151
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2001856	2002996	4846886		Mycobacterium_phage(100.0%)	1	NA	NA
AYB20940.1|2001856_2002996_+	RNA ligase RtcB family protein	NA	A0A0M5M6X2	Mycobacterium_phage	30.5	1.5e-29
>prophage 152
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2007768	2012091	4846886		Enterobacteria_phage(50.0%)	4	NA	NA
AYB20946.1|2007768_2008821_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
AYB20947.1|2009104_2010208_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
AYB20948.1|2010219_2011467_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.9	5.5e-99
AYB20949.1|2011821_2012091_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	63.8	1.4e-20
>prophage 153
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2020181	2020454	4846886		Salmonella_phage(100.0%)	1	NA	NA
AYB20958.1|2020181_2020454_-	cytoplasmic protein	NA	B8K1I9	Salmonella_phage	60.9	5.4e-07
>prophage 154
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2032999	2033524	4846886		Escherichia_phage(100.0%)	1	NA	NA
AYB20971.1|2032999_2033524_+	outer membrane protein	NA	B0FEG7	Escherichia_phage	29.2	1.3e-09
>prophage 155
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2041171	2050883	4846886		Streptococcus_phage(33.33%)	6	NA	NA
AYB20977.1|2041171_2043475_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.4	7.1e-92
AYB20978.1|2043471_2043936_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AYB20979.1|2044013_2044208_+	copper chaperone	NA	NA	NA	NA	NA
AYB20980.1|2044500_2045754_+	MFS transporter	NA	NA	NA	NA	NA
AYB20981.1|2045942_2047901_+	type III restriction-modification system StyLTI enzyme mod	NA	Q1MVP0	Enterobacteria_phage	32.2	1.3e-81
AYB20982.1|2047910_2050883_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	26.3	2.1e-83
>prophage 156
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2064204	2066001	4846886		Staphylococcus_phage(100.0%)	1	NA	NA
AYB20994.1|2064204_2066001_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	28.9	9.0e-50
>prophage 157
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2080655	2081768	4846886		Bacillus_phage(100.0%)	1	NA	NA
AYB21008.1|2080655_2081768_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	33.1	5.6e-18
>prophage 158
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2085472	2095392	4846886		Bacillus_phage(60.0%)	7	NA	NA
AYB21015.1|2085472_2086384_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	7.1e-104
AYB21016.1|2086509_2087418_+	fructokinase	NA	NA	NA	NA	NA
AYB21017.1|2087439_2088612_-	MFS transporter AraJ	NA	NA	NA	NA	NA
AYB21018.1|2088784_2091925_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	21.3	7.4e-07
AYB21019.1|2091921_2093124_-	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	26.0	7.4e-08
AYB21020.1|2093337_2094027_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
AYB21021.1|2094096_2095392_+	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.1	2.6e-27
>prophage 159
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2103363	2107703	4846886	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AYB21028.1|2103363_2104491_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	9.5e-90
AYB21029.1|2104513_2104846_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	3.7e-10
AYB21030.1|2104873_2106721_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AYB21031.1|2106731_2107703_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	2.3e-44
>prophage 160
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2112383	2114046	4846886		Indivirus(50.0%)	2	NA	NA
AYB21039.1|2112383_2113487_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	1.1e-50
AYB21040.1|2113575_2114046_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.0	1.0e-29
>prophage 161
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2123565	2124675	4846886		Bacillus_virus(100.0%)	1	NA	NA
AYB21051.1|2123565_2124675_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.8	8.0e-25
>prophage 162
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2146518	2151686	4846886	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AYB21070.1|2146518_2147142_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AYB21071.1|2147393_2148665_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	5.6e-131
AYB21072.1|2148850_2151205_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	1.6e-224
AYB21073.1|2151413_2151686_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
>prophage 163
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2154979	2155675	4846886		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYB21077.1|2154979_2155675_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.2e-87
>prophage 164
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2160075	2163622	4846886		Bacillus_phage(100.0%)	2	NA	NA
AYB21081.1|2160075_2161848_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	4.7e-51
AYB21082.1|2161840_2163622_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	1.9e-39
>prophage 165
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2181241	2192273	4846886	transposase	Sodalis_phage(20.0%)	14	NA	NA
AYB21099.1|2181241_2182177_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.1	1.6e-63
AYB21100.1|2182246_2182414_-	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AYB21101.1|2182427_2182943_-	primosomal replication protein N''	NA	NA	NA	NA	NA
AYB21102.1|2183023_2183401_+	DUF454 family protein	NA	NA	NA	NA	NA
AYB21103.1|2183553_2184105_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.0e-28
AYB21104.1|2184218_2186147_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	2.3e-43
AYB21105.1|2186192_2186522_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AYB21106.1|2186521_2187127_+	recombination protein RecR	NA	NA	NA	NA	NA
AYB21107.1|2187237_2189112_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	1.3e-115
AYB21108.1|2189331_2189553_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21109.1|2189469_2190114_+	adenylate kinase	NA	NA	NA	NA	NA
AYB21110.1|2190126_2190333_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21111.1|2190342_2191305_+	ferrochelatase	NA	NA	NA	NA	NA
AYB21112.1|2191301_2192273_-	acetylesterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.9	1.7e-15
>prophage 166
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2201373	2206592	4846886		uncultured_virus(50.0%)	5	NA	NA
AYB21119.1|2201373_2203875_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.1	2.0e-111
AYB21120.1|2203984_2204401_+	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AYB21121.1|2204401_2204854_-	NfeD family protein	NA	NA	NA	NA	NA
AYB21122.1|2204850_2205768_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AYB21123.1|2205914_2206592_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.5	3.0e-22
>prophage 167
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2209867	2210554	4846886		Planktothrix_phage(100.0%)	1	NA	NA
AYB21128.1|2209867_2210554_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	4.6e-31
>prophage 168
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2215407	2216424	4846886		Planktothrix_phage(100.0%)	1	NA	NA
AYB21132.1|2215407_2216424_+	methionine import ATP-binding protein MetN 2	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-32
>prophage 169
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2220895	2222677	4846886		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AYB21138.1|2220895_2222677_+	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.3	1.9e-39
>prophage 170
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2230121	2231252	4846886		Streptococcus_phage(100.0%)	1	NA	NA
AYB21145.1|2230121_2231252_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	39.2	1.7e-46
>prophage 171
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2242542	2246976	4846886	tRNA	Moumouvirus(50.0%)	6	NA	NA
AYB21157.1|2242542_2243928_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
AYB21158.1|2243972_2244797_-	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
AYB21159.1|2244793_2245231_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21160.1|2245223_2245769_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYB21161.1|2245895_2246108_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AYB21162.1|2246109_2246976_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
>prophage 172
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2257053	2306623	4846886	protease,holin,lysis,terminase,tail,portal,integrase,coat	Salmonella_phage(70.59%)	73	2256996:2257036	2302984:2303024
2256996:2257036	attL	TCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGC	NA	NA	NA	NA
AYB21172.1|2257053_2258217_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	97.1	1.0e-219
AYB21173.1|2258072_2258444_-	DNA-binding protein	NA	B9UDM0	Salmonella_phage	80.5	2.1e-46
AYB21174.1|2258446_2258791_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	97.4	1.1e-57
AYB21175.1|2258868_2259180_-	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	99.0	7.9e-55
AYB21176.1|2259261_2259591_-	ASCH domain-containing protein	NA	Q9XJG9	Enterobacteria_phage	94.2	1.0e-52
AYB21177.1|2259535_2260618_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.2	6.5e-80
AYB21178.1|2260614_2260908_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	99.0	4.2e-50
AYB21179.1|2261292_2261874_-	Eae-like protein	NA	A0A0N6WGF1	Salmonella_phage	71.5	5.2e-68
AYB21180.1|2261870_2262041_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AYB21181.1|2262051_2262345_-	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	100.0	5.5e-50
AYB21182.1|2262360_2262909_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
AYB21183.1|2262917_2263424_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	3.8e-91
AYB21184.1|2263424_2264132_-	recombinase	NA	E7C9Q0	Salmonella_phage	89.8	9.7e-125
AYB21185.1|2264140_2264329_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
AYB21186.1|2264325_2264439_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
AYB21187.1|2264431_2264572_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	2.0e-18
AYB21188.1|2264895_2265195_-	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	99.0	3.3e-50
AYB21189.1|2265234_2265435_-	restriction endonuclease	NA	A0A1R3Y5S4	Salmonella_virus	100.0	1.0e-31
AYB21190.1|2265513_2265846_-	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	100.0	2.2e-55
AYB21191.1|2266209_2266419_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	5.5e-28
AYB21192.1|2266454_2267378_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	100.0	1.5e-181
AYB21193.1|2267466_2268156_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
AYB21194.1|2268266_2268482_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
AYB21195.1|2268592_2268874_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AYB21196.1|2268908_2269055_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AYB21197.1|2269863_2271240_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
AYB21198.1|2271295_2271754_+	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	3.0e-79
AYB21199.1|2271750_2272623_+	hypothetical protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
AYB21200.1|2272619_2272793_+	protein ninD	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
AYB21201.1|2272759_2272942_+	NinE family protein	NA	Q716C5	Shigella_phage	96.7	1.8e-27
AYB21202.1|2272938_2273115_+	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.8e-27
AYB21203.1|2273077_2273374_+	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	98.9	7.5e-47
AYB21204.1|2273370_2273766_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	96.9	2.9e-70
AYB21205.1|2273762_2273966_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	94.0	5.7e-30
AYB21206.1|2274035_2274524_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
AYB21207.1|2274570_2274768_+	hypothetical protein	NA	C6ZR63	Salmonella_phage	96.2	5.0e-23
AYB21208.1|2274903_2275230_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
AYB21209.1|2275213_2275651_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
AYB21210.1|2275647_2276118_+|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	87.2	1.2e-62
AYB21211.1|2276152_2276377_+	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	90.3	7.2e-26
AYB21212.1|2276330_2276861_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	4.0e-91
AYB21213.1|2277119_2277362_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AYB21214.1|2277365_2277755_+	hypothetical protein	NA	C6ZR72	Salmonella_phage	99.2	1.5e-74
AYB21215.1|2277754_2278159_+	Decoration protein	NA	C6ZR73	Salmonella_phage	100.0	5.3e-67
AYB21216.1|2278162_2278651_+	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AYB21217.1|2278628_2280128_+|terminase	terminase	terminase	A8CGE0	Salmonella_phage	99.8	6.9e-306
AYB21218.1|2280127_2282305_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.3	0.0e+00
AYB21219.1|2282318_2283230_+	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
AYB21220.1|2283229_2284522_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.8	1.1e-243
AYB21221.1|2284562_2285123_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.9	1.4e-102
AYB21222.1|2285106_2285607_+	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
AYB21223.1|2285566_2286985_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.3	3.3e-273
AYB21224.1|2286988_2287690_+|tail	phage tail protein	tail	B8K1I3	Salmonella_phage	98.3	8.8e-70
AYB21225.1|2287689_2288145_+	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
AYB21226.1|2288147_2288837_+	DNA transfer protein	NA	E7C9U4	Salmonella_phage	99.6	1.2e-108
AYB21227.1|2288847_2290152_+	acyltransferase	NA	E7C9U5	Salmonella_phage	96.3	7.8e-213
AYB21228.1|2290151_2292065_+	DNA transfer protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
AYB21229.1|2292082_2292412_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21230.1|2292442_2292808_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
AYB23693.1|2292821_2293001_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
AYB21231.1|2293100_2293352_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
AYB21232.1|2293487_2295491_+	endorhamnosidase	NA	E7C9U9	Salmonella_phage	99.9	0.0e+00
AYB21233.1|2295549_2297007_-	hypothetical protein	NA	E7C9N7	Salmonella_phage	99.8	1.7e-240
AYB21234.1|2296996_2297929_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
AYB21235.1|2297925_2298288_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AYB21236.1|2299771_2301424_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	38.0	1.5e-83
AYB21237.1|2301404_2302331_-	glycosyltransferase	NA	I1TED8	Salmonella_phage	96.7	1.4e-168
AYB21238.1|2302327_2302690_-	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
AYB23694.1|2303114_2303324_-	copper-binding protein	NA	NA	NA	NA	NA
2302984:2303024	attR	TCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGC	NA	NA	NA	NA
AYB21239.1|2303559_2303889_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
AYB21240.1|2303997_2304177_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AYB21241.1|2304227_2305082_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYB21242.1|2305297_2306623_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.5	1.0e-103
>prophage 173
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2322865	2328983	4846886		Tupanvirus(50.0%)	3	NA	NA
AYB21260.1|2322865_2326750_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	28.5	1.9e-60
AYB21261.1|2326999_2328136_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AYB21262.1|2328188_2328983_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.9	2.2e-08
>prophage 174
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2343453	2345279	4846886		uncultured_marine_virus(50.0%)	2	NA	NA
AYB21275.1|2343453_2344071_-	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	51.3	3.0e-53
AYB21276.1|2344043_2345279_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	2.9e-60
>prophage 175
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2348654	2355203	4846886		Bacillus_virus(33.33%)	7	NA	NA
AYB21280.1|2348654_2350220_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	3.2e-43
AYB21281.1|2350552_2351113_+	molecular chaperone	NA	NA	NA	NA	NA
AYB21282.1|2351105_2351462_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
AYB21283.1|2351439_2353386_+	DMSO reductase	NA	A0A077SK27	Escherichia_phage	24.0	3.5e-31
AYB21284.1|2353382_2353940_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AYB21285.1|2353939_2354707_+	hydrogenase	NA	NA	NA	NA	NA
AYB21286.1|2354774_2355203_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.3e-18
>prophage 176
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2370312	2370963	4846886		Morganella_phage(50.0%)	2	NA	NA
AYB21299.1|2370312_2370522_+	cold shock-like protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
AYB21300.1|2370579_2370963_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.6	1.7e-22
>prophage 177
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2375798	2378283	4846886		Stx2-converting_phage(50.0%)	2	NA	NA
AYB21307.1|2375798_2377010_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.7	3.4e-101
AYB21308.1|2377149_2378283_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.8e-09
>prophage 178
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2386510	2389093	4846886	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AYB21317.1|2386510_2389093_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.6e-185
>prophage 179
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2399918	2404721	4846886		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
AYB21326.1|2399918_2401598_-	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	36.1	1.0e-76
AYB21327.1|2401673_2402912_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21328.1|2402943_2403879_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AYB21329.1|2403995_2404721_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	8.7e-28
>prophage 180
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2410621	2411707	4846886		Pseudomonas_phage(100.0%)	1	NA	NA
AYB21335.1|2410621_2411707_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.6e-48
>prophage 181
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2416214	2417879	4846886		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYB21339.1|2416214_2417879_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.0	4.7e-85
>prophage 182
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2422534	2432748	4846886	tRNA	Vibrio_phage(25.0%)	7	NA	NA
AYB21344.1|2422534_2424487_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.9e-09
AYB21345.1|2424697_2426365_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	96.0	0.0e+00
AYB21346.1|2426712_2426898_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21347.1|2428482_2428815_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21348.1|2428863_2430168_-	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	34.9	1.2e-59
AYB21349.1|2430218_2431358_-	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
AYB21350.1|2431344_2432748_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	1.0e-08
>prophage 183
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2443831	2444509	4846886		Bacillus_phage(100.0%)	1	NA	NA
AYB21362.1|2443831_2444509_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	2.6e-26
>prophage 184
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2447779	2455213	4846886		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AYB21364.1|2447779_2449828_-	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.3	1.9e-27
AYB21365.1|2449848_2451528_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AYB21366.1|2451527_2451617_-	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AYB21367.1|2451953_2452160_+	DUF2517 family protein	NA	NA	NA	NA	NA
AYB21368.1|2452271_2453693_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.3	2.3e-56
AYB21369.1|2453731_2455213_-	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	28.7	1.1e-45
>prophage 185
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2458728	2459520	4846886		Kaumoebavirus(100.0%)	1	NA	NA
AYB21375.1|2458728_2459520_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.1	4.0e-10
>prophage 186
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2485622	2489145	4846886		Vibrio_phage(33.33%)	4	NA	NA
AYB21396.1|2485622_2486342_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	35.8	1.7e-23
AYB21397.1|2486338_2487277_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.1	1.0e-25
AYB21398.1|2487387_2487774_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21399.1|2488092_2489145_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.1	6.4e-80
>prophage 187
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2492870	2494139	4846886		Oenococcus_phage(100.0%)	1	NA	NA
AYB21404.1|2492870_2494139_+	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	26.6	3.2e-33
>prophage 188
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2499814	2500591	4846886		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AYB21410.1|2499814_2500591_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.0	3.3e-09
>prophage 189
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2504899	2512517	4846886		Tupanvirus(33.33%)	8	NA	NA
AYB21416.1|2504899_2505916_-	UDP-glucose 4-epimerase	NA	A0A2K9L5H6	Tupanvirus	47.3	3.3e-81
AYB21417.1|2506138_2507047_-	DUF2167 domain-containing protein	NA	NA	NA	NA	NA
AYB21418.1|2507217_2508693_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	30.2	4.4e-10
AYB21419.1|2508760_2509549_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AYB21420.1|2509677_2509827_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AYB21421.1|2509993_2510767_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYB21422.1|2510766_2511456_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AYB21423.1|2511458_2512517_+	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	5.1e-21
>prophage 190
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2520974	2524402	4846886		Catovirus(50.0%)	3	NA	NA
AYB21430.1|2520974_2522495_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.0	1.7e-81
AYB21431.1|2522579_2523056_-	kinase inhibitor	NA	NA	NA	NA	NA
AYB21432.1|2523103_2524402_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	7.7e-19
>prophage 191
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2531262	2534530	4846886		Phage_Gifsy-2(50.0%)	2	NA	NA
AYB21440.1|2531262_2533530_+	SPI-1 type III secretion system effector E3 ubiquitin transferase SlrP	NA	Q9MBL9	Phage_Gifsy-2	42.1	4.1e-15
AYB21441.1|2533621_2534530_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.9	6.0e-26
>prophage 192
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2546243	2555556	4846886		Anomala_cuprea_entomopoxvirus(25.0%)	8	NA	NA
AYB21456.1|2546243_2547980_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	4.6e-19
AYB21457.1|2547972_2548968_-	secretion protein HlyD	NA	NA	NA	NA	NA
AYB21458.1|2548967_2549642_-	transcriptional regulator	NA	NA	NA	NA	NA
AYB21459.1|2549871_2551233_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	2.9e-53
AYB21460.1|2551440_2553585_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.6	3.7e-42
AYB21461.1|2553614_2554589_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AYB21462.1|2554744_2555005_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYB21463.1|2555289_2555556_-	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	52.8	1.7e-13
>prophage 193
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2559024	2564305	4846886		Planktothrix_phage(33.33%)	6	NA	NA
AYB21466.1|2559024_2559747_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.2	1.9e-35
AYB21467.1|2559743_2560403_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AYB21468.1|2560546_2561293_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AYB21469.1|2561769_2562273_-	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	23.0	7.1e-05
AYB21470.1|2562575_2563436_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AYB21471.1|2563789_2564305_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	34.2	1.1e-16
>prophage 194
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2569290	2570883	4846886		Tupanvirus(100.0%)	1	NA	NA
AYB21477.1|2569290_2570883_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.9	1.6e-58
>prophage 195
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2575603	2578036	4846886		Citrobacter_phage(100.0%)	1	NA	NA
AYB21480.1|2575603_2578036_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	43.5	2.1e-09
>prophage 196
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2582358	2584230	4846886		Planktothrix_phage(100.0%)	1	NA	NA
AYB21485.1|2582358_2584230_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.0	2.4e-13
>prophage 197
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2599776	2601782	4846886		Stx2-converting_phage(50.0%)	2	NA	NA
AYB21499.1|2599776_2600979_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.4e-99
AYB21500.1|2601023_2601782_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	29.6	8.8e-15
>prophage 198
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2609353	2618519	4846886		Vibrio_phage(25.0%)	11	NA	NA
AYB21507.1|2609353_2609617_-	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	5.9e-27
AYB21508.1|2609786_2610077_+	DUF1418 family protein	NA	NA	NA	NA	NA
AYB21509.1|2610060_2610783_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AYB21510.1|2610840_2611743_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	3.5e-34
AYB21511.1|2611838_2612315_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AYB21512.1|2612663_2613776_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AYB21513.1|2613863_2614997_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	8.5e-30
AYB21514.1|2615006_2615960_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AYB21515.1|2615956_2616802_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AYB23708.1|2616875_2617349_+	DUF2593 family protein	NA	NA	NA	NA	NA
AYB21516.1|2617391_2618519_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.0	4.1e-24
>prophage 199
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2625319	2628071	4846886		Planktothrix_phage(50.0%)	4	NA	NA
AYB21524.1|2625319_2626048_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
AYB21525.1|2626277_2626793_-	lipoprotein	NA	NA	NA	NA	NA
AYB21526.1|2626920_2627244_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21527.1|2627240_2628071_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
>prophage 200
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2631660	2633379	4846886		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AYB21531.1|2631660_2633379_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	2.2e-29
>prophage 201
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2640165	2647478	4846886	protease,integrase	Dickeya_phage(16.67%)	7	2641416:2641430	2652409:2652423
AYB21538.1|2640165_2641284_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	8.1e-09
AYB21539.1|2641280_2643227_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-39
2641416:2641430	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYB21540.1|2643356_2643578_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYB21541.1|2643901_2644222_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYB21542.1|2644252_2646529_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AYB21543.1|2646741_2646939_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21544.1|2647100_2647478_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
2652409:2652423	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 202
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2651832	2668627	4846886	tRNA	Bacillus_phage(25.0%)	12	NA	NA
AYB21551.1|2651832_2653554_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	24.4	1.2e-14
AYB21552.1|2653554_2655321_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
AYB21553.1|2655434_2656403_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	1.1e-62
AYB23709.1|2656744_2657020_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21554.1|2656948_2657443_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AYB23710.1|2657577_2661660_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
AYB23711.1|2661802_2662414_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYB21555.1|2662423_2663767_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
AYB23712.1|2663763_2663982_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21556.1|2664025_2665318_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	1.9e-94
AYB21557.1|2665554_2667999_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	7.0e-223
AYB21558.1|2668009_2668627_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
>prophage 203
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2672921	2677612	4846886		Tetraselmis_virus(100.0%)	4	NA	NA
AYB21562.1|2672921_2673746_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
AYB21563.1|2673837_2674164_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB21564.1|2674294_2675254_+	SPI-2 type III secretion system effector SopD2	NA	NA	NA	NA	NA
AYB21565.1|2675329_2677612_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
>prophage 204
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2681708	2682797	4846886		Streptococcus_phage(100.0%)	1	NA	NA
AYB21568.1|2681708_2682797_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.5	2.8e-78
>prophage 205
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2687853	2692417	4846886		Bacillus_phage(66.67%)	3	NA	NA
AYB21573.1|2687853_2688138_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
AYB21574.1|2688367_2690632_+	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	8.8e-10
AYB21575.1|2690668_2692417_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
>prophage 206
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2707351	2713097	4846886	tRNA	Rhodobacter_phage(33.33%)	5	NA	NA
AYB21587.1|2707351_2707900_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AYB21588.1|2707927_2708575_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYB21589.1|2708636_2709827_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AYB21590.1|2710011_2711103_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
AYB21591.1|2711696_2713097_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
>prophage 207
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2718447	2778995	4846886	protease,terminase,holin,tail	Salmonella_phage(54.55%)	66	NA	NA
AYB21596.1|2718447_2719740_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.3e-252
AYB21597.1|2719784_2720033_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYB21598.1|2720073_2720313_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AYB21599.1|2721477_2724666_-	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	74.0	0.0e+00
AYB21600.1|2725375_2725780_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYB21601.1|2725909_2726146_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
AYB21602.1|2726111_2726486_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYB21603.1|2726570_2727554_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AYB21604.1|2727556_2728306_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYB21605.1|2728316_2728664_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYB21606.1|2728660_2729185_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYB21607.1|2729184_2729658_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	4.7e-67
AYB21608.1|2729661_2730234_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYB21609.1|2730327_2730594_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYB21610.1|2730749_2730989_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYB21611.1|2730978_2731284_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYB21612.1|2731323_2731926_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
AYB21613.1|2731925_2732132_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AYB21614.1|2732134_2732746_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AYB21615.1|2732742_2732889_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AYB21616.1|2732878_2733676_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.4e-150
AYB21617.1|2734074_2734422_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.3e-45
AYB21618.1|2734424_2735039_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	1.2e-107
AYB21619.1|2735035_2735587_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYB21620.1|2735576_2735990_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21621.1|2736051_2737026_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	37.3	1.6e-29
AYB21622.1|2737015_2738287_+	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.3	1.1e-83
AYB21623.1|2738286_2739717_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	2.6e-92
AYB21624.1|2739688_2740564_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.5	1.5e-55
AYB21625.1|2740564_2742139_+	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	2.2e-20
AYB21626.1|2742159_2743032_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21627.1|2743049_2744081_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.2	2.5e-73
AYB21628.1|2744145_2744631_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21629.1|2744643_2745069_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23714.1|2745086_2745497_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21630.1|2745480_2746419_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.9	2.9e-52
AYB21631.1|2746423_2747818_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.0	1.2e-70
AYB21632.1|2747821_2748259_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21633.1|2748258_2748846_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21634.1|2748969_2751024_+	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	36.3	7.7e-21
AYB21635.1|2751023_2751521_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.0	8.9e-24
AYB21636.1|2751736_2752012_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	33.3	1.6e-06
AYB21637.1|2752011_2753064_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21638.1|2753060_2753777_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21639.1|2753773_2754106_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21640.1|2754102_2755329_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	63.6	3.2e-147
AYB21641.1|2755312_2755939_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
AYB21642.1|2755935_2757645_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
AYB21643.1|2757644_2758226_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AYB21644.1|2758229_2758478_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
AYB21645.1|2758703_2759672_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	3.3e-192
AYB21646.1|2760319_2760946_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AYB21647.1|2761305_2761992_-	virulence protein	NA	NA	NA	NA	NA
AYB21648.1|2762262_2762454_-	DinI family protein	NA	S4TNM0	Salmonella_phage	93.7	1.8e-25
AYB21649.1|2762880_2765493_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AYB21650.1|2765700_2766711_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AYB21651.1|2766876_2767419_+	cell division protein ZapC	NA	NA	NA	NA	NA
AYB21652.1|2767415_2768525_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYB21653.1|2768623_2770732_+	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AYB21654.1|2770744_2772652_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AYB21655.1|2772666_2773920_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AYB21656.1|2773924_2775565_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AYB21657.1|2775561_2776125_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AYB21658.1|2776380_2776548_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYB21659.1|2776647_2777166_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AYB21660.1|2777234_2778995_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 208
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2785173	2787228	4846886		Bacillus_phage(100.0%)	1	NA	NA
AYB21667.1|2785173_2787228_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
>prophage 209
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2793007	2796621	4846886	protease	uncultured_Caudovirales_phage(33.33%)	4	NA	NA
AYB21677.1|2793007_2793667_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYB21678.1|2794305_2794986_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
AYB21679.1|2795207_2796083_-	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
AYB23715.1|2796297_2796621_+	hypothetical protein	NA	E5G6P3	Salmonella_phage	68.1	3.2e-06
>prophage 210
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2802394	2803141	4846886		Bacillus_phage(100.0%)	1	NA	NA
AYB21686.1|2802394_2803141_-	DNA-binding response regulator HprR	NA	W8CYM9	Bacillus_phage	36.5	3.7e-34
>prophage 211
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2816438	2818680	4846886		Phage_258-320(50.0%)	4	NA	NA
AYB21702.1|2816438_2816801_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	43.5	1.9e-23
AYB21703.1|2817248_2817404_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21704.1|2817454_2817760_-	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AYB21705.1|2817759_2818680_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	46.7	3.2e-11
>prophage 212
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2824964	2825132	4846886		Enterobacteria_phage(100.0%)	1	NA	NA
AYB21714.1|2824964_2825132_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 213
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2833075	2836699	4846886		Cronobacter_phage(33.33%)	3	NA	NA
AYB21719.1|2833075_2833930_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	4.5e-92
AYB21720.1|2834035_2834917_-	MurR/RpiR family transcriptional regulator	NA	A0A2P0VNK5	Tetraselmis_virus	28.9	3.3e-05
AYB21721.1|2835202_2836699_-	acetylneuraminate ABC transporter	NA	A0A240F3J2	Aeromonas_phage	22.9	1.3e-17
>prophage 214
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2853988	2856724	4846886		Cronobacter_phage(100.0%)	1	NA	NA
AYB21738.1|2853988_2856724_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.4	5.0e-84
>prophage 215
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2867632	2874066	4846886		Ralstonia_phage(50.0%)	2	NA	NA
AYB21750.1|2867632_2869747_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.6	7.6e-24
AYB21751.1|2869848_2874066_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	41.7	9.2e-21
>prophage 216
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2879906	2889614	4846886		Burkholderia_phage(40.0%)	10	NA	NA
AYB21759.1|2879906_2880119_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AYB23718.1|2880129_2880318_+	cold-shock protein	NA	NA	NA	NA	NA
AYB21760.1|2882437_2882749_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21761.1|2882828_2883524_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AYB21762.1|2883597_2885028_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
AYB21763.1|2885008_2885479_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AYB21764.1|2885467_2886388_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AYB21765.1|2886557_2887475_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AYB21766.1|2887491_2887737_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AYB21767.1|2887901_2889614_+	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
>prophage 217
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2917313	2918066	4846886		Bacillus_virus(100.0%)	1	NA	NA
AYB21802.1|2917313_2918066_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	35.0	4.9e-26
>prophage 218
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2942261	2946403	4846886		Bacillus_thuringiensis_phage(66.67%)	4	NA	NA
AYB21827.1|2942261_2943923_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.0	4.4e-11
AYB21828.1|2944083_2944950_+	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
AYB21829.1|2944946_2945996_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AYB21830.1|2946013_2946403_+	two-component system response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	2.2e-06
>prophage 219
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2954354	2960914	4846886	tRNA	Tupanvirus(33.33%)	8	NA	NA
AYB21837.1|2954354_2956088_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	3.7e-85
AYB21838.1|2956324_2956894_+	VOC family protein	NA	NA	NA	NA	NA
AYB21839.1|2956913_2957660_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AYB21840.1|2957637_2957847_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21841.1|2957895_2958867_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AYB21842.1|2958863_2959607_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	5.4e-25
AYB21843.1|2959647_2960043_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21844.1|2960095_2960914_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	4.5e-57
>prophage 220
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2964935	2965457	4846886		Bacillus_virus(100.0%)	1	NA	NA
AYB21849.1|2964935_2965457_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 221
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2969560	2974545	4846886		Bacillus_phage(33.33%)	5	NA	NA
AYB21853.1|2969560_2970571_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.4	2.4e-07
AYB21854.1|2970649_2971435_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AYB21855.1|2971431_2972187_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	8.5e-18
AYB23721.1|2972250_2973210_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AYB21856.1|2973225_2974545_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
>prophage 222
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2978482	2979958	4846886		Cyanophage(100.0%)	1	NA	NA
AYB21862.1|2978482_2979958_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	5.8e-79
>prophage 223
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	2987856	3067949	4846886	protease,holin,lysis,terminase,tail,portal,integrase	Enterobacteria_phage(25.0%)	91	2992794:2992823	3040567:3040596
AYB21870.1|2987856_2988555_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
AYB21871.1|2988578_2989235_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AYB21872.1|2989342_2989573_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
AYB21873.1|2989710_2990085_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AYB21874.1|2990085_2990961_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21875.1|2990977_2991331_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AYB23722.1|2991388_2991508_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21876.1|2991713_2992793_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	1.5e-100
AYB21877.1|2992767_2993046_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.8e-10
2992794:2992823	attL	TGATCAACTTCTCCAGCAATGCACTCGGTT	NA	NA	NA	NA
AYB23723.1|2993106_2993343_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21878.1|2993633_2993819_-	DUF1187 family protein	NA	NA	NA	NA	NA
AYB21879.1|2993865_2994696_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	2.5e-103
AYB21880.1|2994688_2997379_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	72.8	4.0e-118
AYB21881.1|2997519_2997855_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21882.1|2997930_2998137_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AYB21883.1|2998140_2998416_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21884.1|2998764_2999031_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21885.1|2999433_2999832_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
AYB21886.1|2999930_3000185_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AYB21887.1|3000171_3000666_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21888.1|3000712_3001711_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.1e-121
AYB21889.1|3001703_3002165_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.5	3.5e-67
AYB21890.1|3002177_3002573_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
AYB21891.1|3002859_3003990_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AYB21892.1|3004386_3006366_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
AYB21893.1|3006383_3006575_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21894.1|3006997_3007303_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21895.1|3007366_3007966_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
AYB21896.1|3007962_3008190_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AYB21897.1|3008319_3009009_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AYB23724.1|3009105_3009630_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21898.1|3010003_3010453_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21899.1|3010813_3011500_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AYB23725.1|3011775_3012105_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AYB21900.1|3012088_3012541_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AYB23726.1|3012558_3013038_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AYB21901.1|3013245_3013779_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	7.8e-34
AYB21902.1|3013735_3015874_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AYB21903.1|3015870_3016077_+	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AYB23727.1|3016103_3017621_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	4.9e-174
AYB23728.1|3017544_3019626_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AYB21904.1|3019716_3020040_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AYB21905.1|3020032_3020332_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AYB21906.1|3020312_3020879_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
AYB21907.1|3020875_3021277_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
AYB21908.1|3021288_3022038_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	4.8e-90
AYB21909.1|3022083_3022482_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AYB21910.1|3022478_3022808_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AYB23729.1|3022887_3025875_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	2.8e-266
AYB21911.1|3025871_3026204_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
AYB21912.1|3026302_3026800_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.9	1.4e-16
AYB21913.1|3026916_3027450_-	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AYB21914.1|3027539_3028235_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AYB21915.1|3028244_3028976_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	1.0e-113
AYB21916.1|3028879_3029584_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
AYB21917.1|3032144_3033008_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
AYB21918.1|3033046_3033289_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21919.1|3033342_3035760_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.8	4.7e-86
AYB21920.1|3035759_3036329_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	3.4e-96
AYB21921.1|3036530_3037253_-	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AYB21922.1|3037732_3038533_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21923.1|3039486_3040566_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.1e-98
AYB21924.1|3041699_3041987_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.9	1.6e-38
3040567:3040596	attR	TGATCAACTTCTCCAGCAATGCACTCGGTT	NA	NA	NA	NA
AYB21925.1|3041983_3042517_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	3.2e-11
AYB21926.1|3042773_3042941_-	lytic enzyme	NA	NA	NA	NA	NA
AYB21927.1|3043005_3043197_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21928.1|3044655_3044856_-	phage virulence factor	NA	NA	NA	NA	NA
AYB21929.1|3045057_3045162_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYB21930.1|3045423_3045549_+	arsenic transporter	NA	NA	NA	NA	NA
AYB21931.1|3045677_3045944_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21932.1|3046696_3047311_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AYB21933.1|3047320_3047479_-	hypothetical protein	NA	NA	NA	NA	NA
AYB23730.1|3049145_3049346_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21934.1|3051654_3051795_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21935.1|3051960_3052230_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
AYB21936.1|3052276_3052471_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21937.1|3052599_3053019_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB21938.1|3053391_3053868_-	hypothetical protein	NA	NA	NA	NA	NA
AYB21939.1|3054249_3054591_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AYB21940.1|3055274_3055997_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AYB21941.1|3056281_3056446_+	hypothetical protein	NA	NA	NA	NA	NA
AYB21942.1|3056669_3057320_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
AYB21943.1|3057338_3057530_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYB21944.1|3057640_3057880_-	DUF1480 family protein	NA	NA	NA	NA	NA
AYB23731.1|3057994_3059434_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AYB21945.1|3059511_3062151_-	PqiB family protein	NA	NA	NA	NA	NA
AYB21946.1|3062113_3063397_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYB21947.1|3063438_3064023_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AYB21948.1|3064120_3064807_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYB21949.1|3064826_3066875_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AYB21950.1|3067067_3067949_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 224
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3072251	3072461	4846886		Morganella_phage(100.0%)	1	NA	NA
AYB21957.1|3072251_3072461_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 225
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3079948	3081508	4846886		Moraxella_phage(100.0%)	1	NA	NA
AYB21966.1|3079948_3081508_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
>prophage 226
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3085478	3092790	4846886	tRNA	Pandoravirus(33.33%)	8	NA	NA
AYB21970.1|3085478_3086843_-	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.5	3.6e-43
AYB21971.1|3086923_3087103_+	YoaH family protein	NA	NA	NA	NA	NA
AYB21972.1|3087108_3087453_-	RidA family protein	NA	NA	NA	NA	NA
AYB21973.1|3087583_3089494_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
AYB21974.1|3089551_3090247_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYB21975.1|3090318_3090900_+	Slp family lipoprotein	NA	NA	NA	NA	NA
AYB21976.1|3090878_3091085_-	hypothetical protein	NA	NA	NA	NA	NA
AYB23732.1|3091104_3092790_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
>prophage 227
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3128343	3131101	4846886		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AYB22013.1|3128343_3130029_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	2.3e-23
AYB23735.1|3130153_3131101_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 228
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3134448	3140106	4846886		Pseudomonas_phage(33.33%)	7	NA	NA
AYB22017.1|3134448_3135531_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	8.7e-08
AYB22018.1|3135530_3136364_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYB22019.1|3136360_3136750_+	protein sirB2	NA	NA	NA	NA	NA
AYB22020.1|3136753_3137563_+	protein sirB1	NA	NA	NA	NA	NA
AYB22021.1|3137600_3138455_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	1.9e-45
AYB22022.1|3138508_3139609_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AYB23736.1|3139875_3140106_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	40.0	4.2e-05
>prophage 229
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3150445	3151984	4846886		Escherichia_phage(100.0%)	1	NA	NA
AYB22029.1|3150445_3151984_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	4.8e-20
>prophage 230
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3156485	3162893	4846886		Synechococcus_phage(33.33%)	7	NA	NA
AYB22034.1|3156485_3157328_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	7.5e-15
AYB22035.1|3157378_3157837_-	YchJ family protein	NA	NA	NA	NA	NA
AYB22036.1|3157947_3158853_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
AYB22037.1|3158943_3159957_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
AYB22038.1|3160159_3161068_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	8.2e-60
AYB22039.1|3161199_3161613_-	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AYB22040.1|3162275_3162893_+	thymidine kinase	NA	A0A023W530	Serratia_phage	54.2	2.7e-54
>prophage 231
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3171263	3174156	4846886		Planktothrix_phage(33.33%)	3	NA	NA
AYB22046.1|3171263_3172271_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.3	1.7e-13
AYB22047.1|3172267_3173272_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	8.1e-16
AYB22048.1|3173319_3174156_+	voltage-gated potassium channel	NA	A0A1B0Y2S3	Lactobacillus_phage	42.4	1.0e-08
>prophage 232
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3185825	3188783	4846886		Acinetobacter_phage(100.0%)	2	NA	NA
AYB22063.1|3185825_3187184_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	2.3e-37
AYB22064.1|3187187_3188783_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	39.1	2.0e-53
>prophage 233
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3193764	3199103	4846886	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
AYB22070.1|3193764_3194526_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.2	7.5e-06
AYB22071.1|3194763_3195810_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.5	1.6e-19
AYB22072.1|3195851_3196103_-	DUF2498 family protein	NA	NA	NA	NA	NA
AYB22073.1|3196505_3199103_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.4	4.1e-88
>prophage 234
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3204195	3204786	4846886		Staphylococcus_phage(100.0%)	1	NA	NA
AYB22078.1|3204195_3204786_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.9e-42
>prophage 235
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3210370	3214549	4846886		Bacillus_virus(50.0%)	3	NA	NA
AYB23740.1|3210370_3212353_-	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	31.5	2.9e-17
AYB22088.1|3212367_3212589_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22089.1|3212614_3214549_-	exoribonuclease 2	NA	A0A2H4UVB7	Bodo_saltans_virus	23.5	6.5e-06
>prophage 236
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3219926	3220733	4846886		Bacillus_virus(100.0%)	1	NA	NA
AYB22096.1|3219926_3220733_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
>prophage 237
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3239221	3240091	4846886		Staphylococcus_phage(100.0%)	1	NA	NA
AYB22115.1|3239221_3240091_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	3.0e-51
>prophage 238
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3243642	3244500	4846886		Streptococcus_phage(100.0%)	1	NA	NA
AYB22120.1|3243642_3244500_-	helix-turn-helix domain-containing protein	NA	A0A1B0RXG1	Streptococcus_phage	28.1	2.0e-07
>prophage 239
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3254718	3262766	4846886	tRNA	Streptococcus_phage(20.0%)	11	NA	NA
AYB22133.1|3254718_3255234_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	2.3e-22
AYB22134.1|3255491_3256055_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AYB22135.1|3256035_3256215_+	hypothetical protein	NA	NA	NA	NA	NA
AYB22136.1|3256465_3257620_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.8	1.2e-10
AYB22137.1|3257765_3258749_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AYB22138.1|3259024_3259207_+	hypothetical protein	NA	NA	NA	NA	NA
AYB22139.1|3259235_3260609_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	7.3e-52
AYB22140.1|3260652_3261588_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
AYB22141.1|3261798_3261951_+	multidrug transporter	NA	NA	NA	NA	NA
AYB22142.1|3261943_3262282_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AYB22143.1|3262331_3262766_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
>prophage 240
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3267878	3268868	4846886		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYB22148.1|3267878_3268868_-	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	42.5	1.2e-69
>prophage 241
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3273660	3279074	4846886		Klosneuvirus(50.0%)	3	NA	NA
AYB23743.1|3273660_3277563_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	28.8	5.5e-52
AYB22154.1|3277626_3278427_+	YdcF family protein	NA	NA	NA	NA	NA
AYB22155.1|3278543_3279074_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	3.5e-18
>prophage 242
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3282834	3283566	4846886		Planktothrix_phage(100.0%)	1	NA	NA
AYB22159.1|3282834_3283566_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.4e-24
>prophage 243
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3290104	3297194	4846886		Synechococcus_phage(33.33%)	6	NA	NA
AYB22164.1|3290104_3291223_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.1	6.8e-32
AYB22165.1|3291177_3291393_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22166.1|3291391_3293017_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	8.5e-07
AYB22167.1|3293077_3294001_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB22168.1|3294293_3295637_+	VOC family protein	NA	NA	NA	NA	NA
AYB22169.1|3295685_3297194_+	carboxylesterase/lipase family protein	NA	L7Y5U6	Megavirus	38.3	7.1e-32
>prophage 244
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3313230	3315195	4846886	protease	Phage_TP(100.0%)	1	NA	NA
AYB22187.1|3313230_3315195_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	26.7	8.6e-22
>prophage 245
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3332790	3334911	4846886		Salmonella_phage(100.0%)	1	NA	NA
AYB22204.1|3332790_3334911_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	3.7e-135
>prophage 246
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3342851	3344396	4846886		Escherichia_phage(100.0%)	1	NA	NA
AYB22213.1|3342851_3344396_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	8.3e-20
>prophage 247
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3352559	3354848	4846886	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
AYB22218.1|3352559_3353567_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.5	7.8e-144
AYB22219.1|3353639_3354848_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 248
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3361352	3362363	4846886		Tupanvirus(100.0%)	1	NA	NA
AYB22226.1|3361352_3362363_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	8.6e-26
>prophage 249
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3391839	3392958	4846886		Enterobacteria_phage(100.0%)	1	NA	NA
AYB22253.1|3391839_3392958_-	porin	NA	Q1MVN1	Enterobacteria_phage	58.5	1.6e-113
>prophage 250
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3401841	3402276	4846886		Streptococcus_phage(100.0%)	1	NA	NA
AYB22263.1|3401841_3402276_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.1e-09
>prophage 251
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3410410	3429693	4846886		Escherichia_phage(40.0%)	18	NA	NA
AYB22272.1|3410410_3410614_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
AYB22273.1|3410680_3412147_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	31.4	1.6e-41
AYB22274.1|3412290_3413670_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.4	2.5e-28
AYB22275.1|3414753_3415968_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.7	2.0e-45
AYB22276.1|3416089_3416416_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.0	1.7e-23
AYB22277.1|3416568_3416910_+	DUF1283 family protein	NA	NA	NA	NA	NA
AYB22278.1|3416945_3417506_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AYB22279.1|3417546_3418257_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AYB22280.1|3418360_3418669_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AYB22281.1|3418825_3421264_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.2e-219
AYB22282.1|3421362_3423798_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.2	1.7e-205
AYB22283.1|3423808_3424426_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	1.6e-75
AYB22284.1|3424427_3425285_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AYB22285.1|3425327_3425942_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.3	2.5e-28
AYB22286.1|3426246_3426957_+	osmoprotectant import permease OsmY	NA	NA	NA	NA	NA
AYB22287.1|3426985_3427888_+	osmoprotectant ABC transporter substrate-binding protein OsmX	NA	NA	NA	NA	NA
AYB22288.1|3427897_3428545_+	osmoprotectant ABC transporter permease OsmW	NA	NA	NA	NA	NA
AYB22289.1|3428544_3429693_+	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.9	2.2e-25
>prophage 252
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3447409	3451832	4846886		Enterobacteria_phage(50.0%)	3	NA	NA
AYB22305.1|3447409_3448561_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.8	2.1e-116
AYB22306.1|3448713_3450420_+	amidohydrolase	NA	NA	NA	NA	NA
AYB22307.1|3450530_3451832_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.0	4.4e-14
>prophage 253
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3473401	3474676	4846886	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AYB22326.1|3473401_3474676_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 254
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3481599	3482121	4846886		Salmonella_phage(100.0%)	1	NA	NA
AYB22335.1|3481599_3482121_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	60.3	2.3e-51
>prophage 255
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3487196	3494620	4846886		Streptococcus_phage(20.0%)	8	NA	NA
AYB22343.1|3487196_3488051_+	peptidoglycan endopeptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.0	1.2e-15
AYB22344.1|3488177_3488759_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.5	5.3e-44
AYB22345.1|3488841_3488931_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AYB22346.1|3489226_3490252_+	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.1e-31
AYB22347.1|3490248_3491181_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB22348.1|3491293_3492499_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AYB22349.1|3492788_3493937_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.9	2.5e-85
AYB22350.1|3493978_3494620_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.3	8.8e-24
>prophage 256
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3518512	3521275	4846886		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AYB22381.1|3518512_3521275_+	hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.2	7.9e-29
>prophage 257
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3540731	3543941	4846886		environmental_halophage(50.0%)	3	NA	NA
AYB22399.1|3540731_3541952_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.8	2.9e-92
AYB22400.1|3541948_3543220_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AYB22401.1|3543194_3543941_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.2	2.5e-06
>prophage 258
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3565931	3585560	4846886	tRNA	Tupanvirus(22.22%)	19	NA	NA
AYB22420.1|3565931_3567572_+	cyclohexanecarboxylate-CoA ligase	NA	A0A1V0SBX8	Catovirus	24.1	2.3e-20
AYB22421.1|3567613_3569992_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	2.5e-172
AYB22422.1|3570328_3571162_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AYB22423.1|3571317_3572364_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.8	3.3e-81
AYB22424.1|3572520_3572712_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
AYB22425.1|3572746_3574189_-	YdiU family protein	NA	NA	NA	NA	NA
AYB22426.1|3574250_3574964_-	anti-FlhDC factor YdiV	NA	NA	NA	NA	NA
AYB22427.1|3575277_3575742_-	lipoprotein	NA	A0A1V0DZX6	Clostridioides_phage	39.4	2.0e-14
AYB22428.1|3575818_3576568_-	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
AYB22429.1|3576567_3577119_-	glutathione peroxidase	NA	NA	NA	NA	NA
AYB22430.1|3577210_3578191_-	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AYB22431.1|3578393_3578693_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYB22432.1|3578697_3581085_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYB22433.1|3581100_3582084_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AYB23756.1|3582220_3582265_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AYB22434.1|3582385_3582742_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AYB22435.1|3582792_3582990_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AYB22436.1|3583085_3583628_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
AYB22437.1|3583631_3585560_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	5.5e-130
>prophage 259
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3598384	3600637	4846886		Tupanvirus(100.0%)	1	NA	NA
AYB22452.1|3598384_3600637_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	49.8	1.7e-143
>prophage 260
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3606804	3607632	4846886		Bacillus_virus(100.0%)	1	NA	NA
AYB22460.1|3606804_3607632_+	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.0e-72
>prophage 261
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3614330	3615557	4846886		Klosneuvirus(100.0%)	1	NA	NA
AYB22468.1|3614330_3615557_-	succinylornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.8	2.1e-26
>prophage 262
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3619144	3621094	4846886		Streptococcus_phage(100.0%)	1	NA	NA
AYB22474.1|3619144_3621094_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.0	1.4e-40
>prophage 263
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3625979	3630104	4846886		Tupanvirus(50.0%)	4	NA	NA
AYB22479.1|3625979_3626636_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.2	7.3e-18
AYB22480.1|3626738_3628097_-	MFS transporter	NA	NA	NA	NA	NA
AYB22481.1|3628232_3628991_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AYB22482.1|3629120_3630104_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.4	9.7e-06
>prophage 264
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3645405	3648825	4846886		Bacillus_phage(100.0%)	3	NA	NA
AYB22495.1|3645405_3646692_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
AYB22496.1|3646836_3647037_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22497.1|3647331_3648825_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.3	2.0e-10
>prophage 265
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3669136	3669667	4846886		Escherichia_phage(100.0%)	1	NA	NA
AYB22527.1|3669136_3669667_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
>prophage 266
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3674293	3677636	4846886		Enterobacterial_phage(50.0%)	5	NA	NA
AYB22532.1|3674293_3674851_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	32.5	2.2e-15
AYB22533.1|3675662_3675926_+	virulence protein PagD	NA	NA	NA	NA	NA
AYB22534.1|3676057_3676270_+	cold-shock protein CspH	NA	NA	NA	NA	NA
AYB22535.1|3676684_3677206_+	lipoprotein	NA	NA	NA	NA	NA
AYB22536.1|3677396_3677636_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
>prophage 267
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3681489	3682740	4846886		Phage_21(100.0%)	1	NA	NA
AYB22540.1|3681489_3682740_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 268
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3686267	3687638	4846886		Bodo_saltans_virus(100.0%)	1	NA	NA
AYB22545.1|3686267_3687638_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	8.5e-109
>prophage 269
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3693958	3695942	4846886		Bacillus_virus(50.0%)	2	NA	NA
AYB22551.1|3693958_3695095_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	2.1e-28
AYB22552.1|3695078_3695942_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.2	2.0e-10
>prophage 270
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3699528	3703254	4846886		Vibrio_phage(50.0%)	4	NA	NA
AYB22556.1|3699528_3700350_-	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	1.0e-21
AYB22557.1|3700368_3701280_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AYB22558.1|3701308_3702553_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AYB22559.1|3702552_3703254_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	2.4e-35
>prophage 271
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3709439	3709697	4846886		Erwinia_phage(100.0%)	1	NA	NA
AYB22563.1|3709439_3709697_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	2.1e-05
>prophage 272
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3722858	3723500	4846886		Pseudomonas_phage(100.0%)	1	NA	NA
AYB22576.1|3722858_3723500_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	35.7	3.2e-26
>prophage 273
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3726774	3727901	4846886		Ralstonia_phage(50.0%)	2	NA	NA
AYB22580.1|3726774_3727011_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AYB22581.1|3727166_3727901_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	1.7e-15
>prophage 274
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3741718	3742669	4846886		Brevibacillus_phage(100.0%)	1	NA	NA
AYB22595.1|3741718_3742669_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.8	2.2e-10
>prophage 275
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3758681	3758927	4846886		Salmonella_phage(100.0%)	1	NA	NA
AYB22615.1|3758681_3758927_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	52.6	4.1e-14
>prophage 276
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3763586	3764507	4846886		Morganella_phage(100.0%)	1	NA	NA
AYB22623.1|3763586_3764507_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.5	1.1e-54
>prophage 277
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3773570	3774110	4846886		Scale_drop_disease_virus(100.0%)	1	NA	NA
AYB22630.1|3773570_3774110_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.7	2.9e-28
>prophage 278
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3778262	3779096	4846886		Pelagibacter_phage(100.0%)	1	NA	NA
AYB22639.1|3778262_3779096_+	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.5	3.3e-39
>prophage 279
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3783756	3835895	4846886	head,holin,transposase,terminase,tail,capsid,plate,integrase	Salmonella_phage(81.82%)	70	3779965:3779979	3828023:3828037
3779965:3779979	attL	GCCAGCGGCATCCCT	NA	NA	NA	NA
AYB22645.1|3783756_3784779_-|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
AYB22646.1|3785240_3786059_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22647.1|3786085_3786463_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22648.1|3786855_3787038_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22649.1|3787401_3787623_-	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AYB22650.1|3787835_3788843_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
AYB22651.1|3789127_3789697_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
AYB22652.1|3789696_3791259_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	100.0	2.6e-287
AYB22653.1|3791245_3791833_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AYB22654.1|3791835_3792915_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
AYB22655.1|3792907_3793321_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AYB22656.1|3793325_3793859_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
AYB22657.1|3793851_3794916_-|plate	baseplate protein	plate	Q8HAC0	Salmonella_phage	95.1	4.2e-188
AYB22658.1|3794912_3796253_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
AYB22659.1|3796286_3798215_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.7	0.0e+00
AYB22660.1|3798299_3798626_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
AYB22661.1|3798622_3798979_-|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AYB22662.1|3798978_3800475_-|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	99.8	6.1e-278
AYB22663.1|3800464_3800629_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
AYB22664.1|3800632_3801193_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	99.5	8.8e-105
AYB22665.1|3801189_3801702_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
AYB22666.1|3801673_3802078_-|head,tail	head-tail adaptor protein	head,tail	A0A192Y6C2	Salmonella_phage	99.3	5.4e-72
AYB22667.1|3802074_3802398_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
AYB22668.1|3802400_3802601_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
AYB22669.1|3802651_3803857_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
AYB22670.1|3805739_3805922_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
AYB22671.1|3805933_3807667_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
AYB22672.1|3807663_3808167_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	3.6e-89
AYB22673.1|3808284_3808635_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	8.0e-64
AYB22674.1|3808762_3809197_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22675.1|3809565_3809838_-	peptidase	NA	Q8SBD8	Shigella_phage	77.6	3.8e-29
AYB22676.1|3809722_3810115_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	92.3	1.6e-57
AYB22677.1|3810098_3810575_-	lysozyme	NA	Q8SBE0	Shigella_phage	96.8	1.7e-85
AYB22678.1|3810578_3810932_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	88.7	1.0e-50
AYB22679.1|3811063_3811306_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22680.1|3811374_3811563_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22681.1|3811594_3812347_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	2.4e-134
AYB23763.1|3812360_3813350_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	3.0e-188
AYB22682.1|3813357_3814263_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	2.8e-161
AYB22683.1|3814234_3814624_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
AYB22684.1|3814632_3815514_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	1.1e-170
AYB22685.1|3815510_3815984_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	93.8	6.6e-53
AYB22686.1|3815980_3816955_-	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	98.1	1.2e-165
AYB22687.1|3816951_3817176_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AYB22688.1|3817172_3818315_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.6	1.6e-182
AYB22689.1|3818311_3818866_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	5.9e-101
AYB22690.1|3818894_3819119_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AYB22691.1|3819057_3819243_-	amino acid permease	NA	NA	NA	NA	NA
AYB22692.1|3819216_3819912_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
AYB22693.1|3820116_3820302_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
AYB23764.1|3820229_3820481_+	hypothetical protein	NA	NA	NA	NA	NA
AYB22694.1|3820461_3820758_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	98.0	1.1e-50
AYB22695.1|3820675_3820921_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22696.1|3821457_3821829_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AYB22697.1|3821886_3822714_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	97.5	1.0e-149
AYB22698.1|3822850_3823390_+	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AYB22699.1|3823460_3824198_+	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	86.3	1.8e-52
AYB22700.1|3824197_3824671_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.3	5.0e-69
AYB22701.1|3824674_3825424_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	83.6	1.1e-46
AYB22702.1|3825420_3825990_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	91.0	5.8e-104
AYB22703.1|3826014_3826257_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	98.8	2.1e-39
AYB22704.1|3826258_3827248_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AYB22705.1|3827539_3828337_+	protein MtfA	NA	NA	NA	NA	NA
3828023:3828037	attR	GCCAGCGGCATCCCT	NA	NA	NA	NA
AYB23765.1|3828692_3829967_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.1	8.2e-74
AYB23766.1|3830038_3830290_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22706.1|3830768_3831266_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22707.1|3831276_3831606_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22708.1|3831627_3832191_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22709.1|3832601_3833483_+	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	42.0	3.3e-29
AYB22710.1|3834056_3835895_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	I1TR70	Cronobacter_phage	49.0	1.0e-32
>prophage 280
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3847417	3848152	4846886		Cellulophaga_phage(100.0%)	1	NA	NA
AYB22724.1|3847417_3848152_+	DNA-binding protein	NA	M1Q742	Cellulophaga_phage	39.3	2.2e-26
>prophage 281
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3853362	3855674	4846886		Stenotrophomonas_phage(50.0%)	3	NA	NA
AYB22731.1|3853362_3853581_-	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	52.8	3.0e-08
AYB22732.1|3853731_3854607_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22733.1|3855149_3855674_+	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
>prophage 282
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3871937	3872753	4846886		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AYB22746.1|3871937_3872753_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.1	4.5e-09
>prophage 283
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3886266	3887061	4846886		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AYB22761.1|3886266_3887061_-	aquaporin	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	27.2	1.2e-11
>prophage 284
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3906762	3911689	4846886		Escherichia_phage(66.67%)	4	NA	NA
AYB22787.1|3906762_3907935_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.9	1.1e-200
AYB22788.1|3908058_3908823_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AYB22789.1|3908819_3909398_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.2	3.9e-23
AYB22790.1|3909412_3911689_-	thiosulfate reductase	NA	A0A077SK27	Escherichia_phage	27.1	2.9e-37
>prophage 285
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3920375	3921275	4846886		Cellulophaga_phage(100.0%)	1	NA	NA
AYB22796.1|3920375_3921275_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	100.0	1.7e-12
>prophage 286
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3928718	3931529	4846886		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
AYB22805.1|3928718_3929885_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.5	2.4e-112
AYB22806.1|3929946_3930135_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22807.1|3930122_3931529_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.2e-36
>prophage 287
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3934613	3936053	4846886		Hokovirus(100.0%)	1	NA	NA
AYB22810.1|3934613_3936053_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	1.3e-54
>prophage 288
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3941006	3953402	4846886		Enterobacteria_phage(33.33%)	12	NA	NA
AYB22815.1|3941006_3942023_-	CDP-paratose 2-epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	27.1	2.1e-24
AYB22816.1|3942019_3942859_-	CDP-paratose synthase	NA	NA	NA	NA	NA
AYB22817.1|3942895_3944209_-	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYB22818.1|3944235_3945315_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
AYB22819.1|3945319_3946093_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYB22820.1|3946108_3947083_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AYB22821.1|3947088_3947640_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AYB22822.1|3947640_3948519_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AYB22823.1|3948566_3949466_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AYB22824.1|3949465_3950551_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYB22825.1|3950927_3951821_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYB22826.1|3951998_3953402_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 289
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3958959	3965665	4846886		Bacillus_phage(25.0%)	6	NA	NA
AYB22831.1|3958959_3960330_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	7.6e-33
AYB22832.1|3960440_3961883_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.5	1.0e-48
AYB22833.1|3961879_3963103_-	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AYB22834.1|3963099_3963573_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AYB22835.1|3963575_3964541_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	6.0e-85
AYB22836.1|3964543_3965665_-	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	6.9e-133
>prophage 290
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3970840	3980140	4846886		Streptococcus_phage(25.0%)	8	NA	NA
AYB22843.1|3970840_3973000_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	5.4e-17
AYB22844.1|3972996_3973446_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AYB22845.1|3973451_3974591_-	polysaccharide export protein	NA	NA	NA	NA	NA
AYB22846.1|3974673_3974910_+	hypothetical protein	NA	NA	NA	NA	NA
AYB22847.1|3975265_3976846_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.1e-38
AYB22848.1|3976931_3978788_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AYB22849.1|3978826_3979408_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	9.3e-33
AYB22850.1|3979498_3980140_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
>prophage 291
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	3990587	3997199	4846886		Bacillus_phage(66.67%)	3	NA	NA
AYB22855.1|3990587_3993668_+	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	23.1	2.7e-62
AYB22856.1|3995076_3996480_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.7	4.7e-30
AYB22857.1|3996476_3997199_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	6.4e-31
>prophage 292
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4001623	4002985	4846886		Phage_TP(100.0%)	1	NA	NA
AYB23773.1|4001623_4002985_+	U32 family peptidase	NA	Q6DW11	Phage_TP	95.6	4.6e-208
>prophage 293
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4020599	4029770	4846886	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYB22878.1|4020599_4022633_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	2.1e-55
AYB22879.1|4022873_4023332_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	71.2	7.1e-52
AYB22880.1|4023503_4024034_+	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYB22881.1|4024090_4024558_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	8.8e-74
AYB22882.1|4024604_4025324_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYB23774.1|4025320_4027006_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.4e-278
AYB22883.1|4027228_4027960_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	2.2e-100
AYB22884.1|4028019_4028127_+	protein YohO	NA	NA	NA	NA	NA
AYB22885.1|4028107_4028839_-	ABC transporter permease	NA	NA	NA	NA	NA
AYB22886.1|4028822_4029770_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 294
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4061009	4061678	4846886		Cellulophaga_phage(100.0%)	1	NA	NA
AYB22913.1|4061009_4061678_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
>prophage 295
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4067117	4069109	4846886		Acinetobacter_phage(100.0%)	1	NA	NA
AYB22920.1|4067117_4069109_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
>prophage 296
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4073226	4074084	4846886		Catovirus(100.0%)	1	NA	NA
AYB22924.1|4073226_4074084_+	endonuclease	NA	A0A1V0SBL9	Catovirus	28.5	9.9e-23
>prophage 297
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4084225	4084798	4846886		Clostridioides_phage(100.0%)	1	NA	NA
AYB22937.1|4084225_4084798_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
>prophage 298
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4090770	4104959	4846886	tail	Salmonella_phage(33.33%)	13	NA	NA
AYB22942.1|4090770_4092360_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	3.2e-19
AYB22943.1|4092363_4092708_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22944.1|4093098_4094289_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
AYB22945.1|4094316_4095012_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AYB22946.1|4095163_4096924_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
AYB22947.1|4097048_4097333_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
AYB22948.1|4097441_4098062_-	hypothetical protein	NA	NA	NA	NA	NA
AYB22949.1|4098089_4099097_-	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
AYB22950.1|4099276_4099504_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
AYB22951.1|4099535_4101296_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
AYB22952.1|4102066_4104373_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	90.1	1.7e-72
AYB22953.1|4104467_4104710_+	hypothetical protein	NA	NA	NA	NA	NA
AYB22954.1|4104596_4104959_-|tail	phage tail protein	tail	S4TUB9	Salmonella_phage	86.5	7.3e-52
>prophage 299
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4114167	4114785	4846886		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYB22965.1|4114167_4114785_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.8e-10
>prophage 300
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4121875	4127693	4846886		Bacillus_phage(33.33%)	5	NA	NA
AYB22974.1|4121875_4123519_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.6	7.5e-11
AYB22975.1|4123594_4124245_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
AYB22976.1|4124247_4125309_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	58.0	1.4e-18
AYB22977.1|4125389_4126442_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AYB22978.1|4126556_4127693_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	6.6e-115
>prophage 301
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4131859	4139072	4846886		Hokovirus(33.33%)	4	NA	NA
AYB22981.1|4131859_4134706_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.4	4.1e-41
AYB22982.1|4134823_4137460_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	4.3e-93
AYB22983.1|4137539_4137770_+	hypothetical protein	NA	NA	NA	NA	NA
AYB22984.1|4137869_4139072_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	36.3	4.6e-58
>prophage 302
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4142512	4149713	4846886		Pseudomonas_phage(50.0%)	6	NA	NA
AYB22988.1|4142512_4144798_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	1.3e-282
AYB22989.1|4144910_4146041_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	8.7e-176
AYB22990.1|4146040_4146295_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	74.6	3.1e-25
AYB22991.1|4146296_4147487_-	MFS transporter	NA	NA	NA	NA	NA
AYB22992.1|4147648_4148527_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB22993.1|4148642_4149713_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 303
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4159326	4160532	4846886		Oenococcus_phage(100.0%)	1	NA	NA
AYB23779.1|4159326_4160532_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	3.5e-26
>prophage 304
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4164179	4169188	4846886		Tupanvirus(50.0%)	4	NA	NA
AYB23006.1|4164179_4164785_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	43.8	1.9e-12
AYB23007.1|4165065_4166223_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.1	6.0e-31
AYB23008.1|4166225_4167209_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	1.7e-34
AYB23009.1|4167205_4169188_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.8	7.9e-23
>prophage 305
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4181755	4182757	4846886		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AYB23024.1|4181755_4182757_+	chemotaxis signal transduction protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.9	1.8e-28
>prophage 306
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4204461	4207733	4846886		Salmonella_phage(50.0%)	3	NA	NA
AYB23044.1|4204461_4205061_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
AYB23045.1|4205152_4206979_-	SLC13 family permease	NA	NA	NA	NA	NA
AYB23046.1|4207055_4207733_-	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.3e-08
>prophage 307
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4218541	4219561	4846886		Enterobacteria_phage(100.0%)	1	NA	NA
AYB23058.1|4218541_4219561_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	3.2e-20
>prophage 308
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4223289	4224063	4846886		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AYB23781.1|4223289_4224063_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.7e-10
>prophage 309
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4235494	4237012	4846886		Mollivirus(100.0%)	1	NA	NA
AYB23075.1|4235494_4237012_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	6.3e-89
>prophage 310
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4243513	4244650	4846886		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYB23083.1|4243513_4244650_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
>prophage 311
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4248073	4248442	4846886		Campylobacter_virus(100.0%)	1	NA	NA
AYB23086.1|4248073_4248442_+	hypothetical protein	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
>prophage 312
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4255699	4256785	4846886		Pandoravirus(100.0%)	1	NA	NA
AYB23095.1|4255699_4256785_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 313
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4265967	4272006	4846886		Salmonella_virus(50.0%)	6	NA	NA
AYB23104.1|4265967_4266909_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
AYB23105.1|4268151_4268541_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
AYB23106.1|4268509_4268764_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
AYB23107.1|4268781_4270704_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	76.9	8.1e-299
AYB23108.1|4271693_4271837_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
AYB23109.1|4271775_4272006_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	5.4e-08
>prophage 314
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4280696	4281617	4846886		Morganella_phage(100.0%)	1	NA	NA
AYB23117.1|4280696_4281617_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
>prophage 315
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4303010	4312860	4846886		Lactobacillus_phage(25.0%)	9	NA	NA
AYB23135.1|4303010_4303937_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	2.0e-08
AYB23136.1|4304026_4305025_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AYB23137.1|4305021_4305240_-	hypothetical protein	NA	NA	NA	NA	NA
AYB23138.1|4305241_4307257_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.6	9.8e-146
AYB23139.1|4307328_4308315_-	cell division protein ZipA	NA	NA	NA	NA	NA
AYB23140.1|4308546_4309308_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AYB23141.1|4309471_4310443_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	9.7e-75
AYB23142.1|4310826_4311084_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AYB23143.1|4311132_4312860_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
>prophage 316
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4317892	4327444	4846886		Streptococcus_phage(20.0%)	11	NA	NA
AYB23152.1|4317892_4318804_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.8	2.9e-57
AYB23153.1|4318871_4319969_-	sulfate/thiosulfate import ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.5	7.0e-29
AYB23154.1|4319958_4320834_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
AYB23155.1|4320833_4321667_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AYB23156.1|4321666_4322683_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYB23157.1|4322840_4323632_-	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
AYB23158.1|4323869_4324769_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	33.3	3.8e-25
AYB23159.1|4324863_4325439_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AYB23160.1|4325500_4325950_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AYB23161.1|4325936_4326473_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AYB23162.1|4326574_4327444_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.8e-17
>prophage 317
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4348058	4349009	4846886		Cyanophage(100.0%)	1	NA	NA
AYB23184.1|4348058_4349009_+	transaldolase A	NA	A0A127KNC6	Cyanophage	30.3	8.2e-10
>prophage 318
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4367632	4368346	4846886		Synechococcus_phage(100.0%)	1	NA	NA
AYB23198.1|4367632_4368346_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.5	9.1e-38
>prophage 319
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4371684	4372824	4846886		Streptococcus_phage(100.0%)	1	NA	NA
AYB23203.1|4371684_4372824_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.8	7.2e-45
>prophage 320
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4378407	4383681	4846886		uncultured_Caudovirales_phage(25.0%)	7	NA	NA
AYB23208.1|4378407_4378767_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	1.1e-18
AYB23209.1|4378793_4379519_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AYB23210.1|4379589_4380879_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.6	5.1e-63
AYB23211.1|4380966_4381593_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYB23212.1|4381791_4381971_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23213.1|4382005_4383043_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.8	2.9e-69
AYB23214.1|4383042_4383681_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	43.4	7.4e-31
>prophage 321
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4390143	4390335	4846886		Escherichia_phage(100.0%)	1	NA	NA
AYB23219.1|4390143_4390335_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
>prophage 322
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4393535	4402334	4846886		Klosneuvirus(33.33%)	3	NA	NA
AYB23222.1|4393535_4395002_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
AYB23223.1|4395162_4396512_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.6	4.4e-41
AYB23224.1|4396673_4402334_-	fibronectin-binding autotransporter adhesin ShdA	NA	A0A2L1IV18	Escherichia_phage	26.7	4.2e-29
>prophage 323
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4428647	4433896	4846886		Escherichia_phage(66.67%)	5	NA	NA
AYB23235.1|4428647_4429079_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	1.1e-17
AYB23236.1|4429199_4430063_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AYB23237.1|4430062_4430872_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AYB23238.1|4430864_4431494_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.9	3.6e-62
AYB23239.1|4431490_4433896_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	38.5	6.6e-141
>prophage 324
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4444694	4451259	4846886		Mycoplasma_phage(20.0%)	8	NA	NA
AYB23245.1|4444694_4445978_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	1.2e-35
AYB23246.1|4446155_4446356_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
AYB23247.1|4446367_4446703_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AYB23248.1|4446704_4448555_-	molecular chaperone HscA	NA	A0A167RF67	Powai_lake_megavirus	39.1	2.7e-102
AYB23249.1|4448567_4449083_-	co-chaperone protein HscB	NA	NA	NA	NA	NA
AYB23250.1|4449278_4449602_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
AYB23251.1|4449630_4450017_-	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
AYB23252.1|4450044_4451259_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
>prophage 325
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4462123	4463377	4846886		Aeromonas_phage(100.0%)	1	NA	NA
AYB23263.1|4462123_4463377_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
>prophage 326
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4470592	4480584	4846886		Bacillus_phage(50.0%)	6	NA	NA
AYB23268.1|4470592_4472053_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.3e-46
AYB23269.1|4472101_4472440_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AYB23270.1|4472516_4473854_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
AYB23271.1|4473850_4474615_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AYB23272.1|4474616_4476002_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.5e-15
AYB23273.1|4476696_4480584_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	8.0e-128
>prophage 327
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4489168	4497014	4846886		Lactobacillus_phage(25.0%)	9	NA	NA
AYB23283.1|4489168_4490095_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
AYB23284.1|4490132_4490393_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
AYB23285.1|4490504_4490885_-	holo-ACP synthase	NA	NA	NA	NA	NA
AYB23286.1|4490884_4491616_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AYB23287.1|4491627_4492356_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AYB23288.1|4492367_4493273_-	GTPase Era	NA	NA	NA	NA	NA
AYB23787.1|4493269_4493950_-	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
AYB23289.1|4494223_4495198_-	S26 family signal peptidase	NA	NA	NA	NA	NA
AYB23290.1|4495214_4497014_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
>prophage 328
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4501986	4606822	4846886	head,lysis,transposase,tail,capsid,portal,plate,tRNA,integrase	Salmonella_phage(70.59%)	94	4572172:4572190	4616493:4616511
AYB23298.1|4501986_4502724_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AYB23299.1|4502853_4504188_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AYB23788.1|4504205_4505105_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB23300.1|4505207_4505795_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AYB23301.1|4505856_4506240_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	71.8	6.1e-33
AYB23302.1|4506558_4507248_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AYB23303.1|4507363_4508401_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AYB23304.1|4508604_4509024_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AYB23305.1|4509096_4509777_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AYB23306.1|4509830_4512491_+	protein lysine acetyltransferase Pat	NA	NA	NA	NA	NA
AYB23307.1|4512605_4513961_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AYB23308.1|4514005_4514329_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
AYB23309.1|4514325_4515627_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
AYB23310.1|4515730_4516186_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
AYB23311.1|4521966_4524540_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
AYB23312.1|4524669_4525401_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AYB23313.1|4525397_4526378_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AYB23314.1|4526509_4527247_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AYB23315.1|4527518_4527857_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AYB23789.1|4527960_4528008_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23316.1|4528107_4529268_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AYB23317.1|4529228_4530137_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AYB23318.1|4530194_4531316_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYB23319.1|4531325_4532396_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AYB23320.1|4532835_4533354_+	YfiR family protein	NA	NA	NA	NA	NA
AYB23321.1|4533346_4534567_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
AYB23322.1|4534724_4535072_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYB23323.1|4535112_4535880_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYB23324.1|4535924_4536473_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYB23325.1|4536491_4536740_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYB23326.1|4536992_4538354_-	signal recognition particle protein	NA	NA	NA	NA	NA
AYB23327.1|4538519_4539311_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYB23328.1|4539375_4540617_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYB23329.1|4540737_4541343_+	cytoplasmic protein	NA	NA	NA	NA	NA
AYB23790.1|4541377_4541968_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYB23330.1|4542091_4542970_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYB23331.1|4543055_4544717_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AYB23332.1|4544865_4545204_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYB23333.1|4545369_4545660_-	RnfH family protein	NA	NA	NA	NA	NA
AYB23334.1|4545649_4546126_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYB23791.1|4546275_4546758_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AYB23335.1|4547372_4558592_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AYB23336.1|4558656_4560066_+	type I secretion protein TolC	NA	NA	NA	NA	NA
AYB23792.1|4562245_4563409_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYB23793.1|4563960_4564179_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AYB23337.1|4564247_4565348_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	9.0e-194
AYB23338.1|4565344_4565830_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AYB23339.1|4565826_4568634_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.0	0.0e+00
AYB23340.1|4568626_4568746_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
AYB23341.1|4568760_4569063_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
AYB23342.1|4569117_4569633_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYB23343.1|4569642_4570815_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
AYB23344.1|4570945_4571473_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AYB23345.1|4571475_4573161_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	50.6	3.5e-128
4572172:4572190	attL	AAACAATACGTTATTGCCA	NA	NA	NA	NA
AYB23346.1|4573157_4573763_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
AYB23347.1|4573755_4574664_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.0	7.2e-157
AYB23348.1|4574650_4575010_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	91.5	3.5e-54
AYB23349.1|4575006_4575585_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.8e-92
AYB23350.1|4575680_4576547_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23351.1|4576573_4577020_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	3.1e-60
AYB23352.1|4577012_4577444_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
AYB23353.1|4577406_4577610_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	8.9e-23
AYB23354.1|4577539_4577968_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	1.3e-47
AYB23355.1|4577964_4578342_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	5.1e-16
AYB23794.1|4578343_4578817_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYB23356.1|4578836_4579052_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYB23357.1|4579055_4579259_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYB23358.1|4579258_4579723_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
AYB23359.1|4579818_4580469_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYB23360.1|4580472_4581531_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	4.9e-181
AYB23361.1|4581547_4582381_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	5.9e-121
AYB23362.1|4582523_4584290_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
AYB23363.1|4584289_4585321_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.0	5.0e-170
AYB23364.1|4586100_4587255_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYB23365.1|4587747_4588554_+	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	6.2e-51
AYB23366.1|4588664_4588964_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23367.1|4589032_4589221_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
AYB23368.1|4589376_4591773_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.9	0.0e+00
AYB23369.1|4591769_4592627_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	99.6	1.5e-164
AYB23370.1|4592623_4592851_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
AYB23371.1|4592850_4593084_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
AYB23372.1|4593151_4593493_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
AYB23373.1|4593712_4594171_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23374.1|4594118_4594352_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
AYB23375.1|4594905_4595145_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
AYB23376.1|4595261_4595894_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.1e-66
AYB23377.1|4595897_4596923_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	99.1	9.2e-201
AYB23378.1|4597182_4597776_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23379.1|4598174_4598978_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
AYB23380.1|4599773_4600885_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
AYB23381.1|4601434_4601716_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23382.1|4601682_4601865_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23383.1|4601969_4603085_+	DUF1205 domain-containing protein	NA	NA	NA	NA	NA
AYB23384.1|4603165_4606822_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	7.9e-45
4616493:4616511	attR	AAACAATACGTTATTGCCA	NA	NA	NA	NA
>prophage 329
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4627187	4631191	4846886		Klosneuvirus(50.0%)	4	NA	NA
AYB23401.1|4627187_4628471_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.1	2.1e-32
AYB23402.1|4628600_4630001_+	GABA permease	NA	NA	NA	NA	NA
AYB23403.1|4630042_4630720_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
AYB23404.1|4630741_4631191_-	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
>prophage 330
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4637688	4642743	4846886		Bacillus_phage(25.0%)	4	NA	NA
AYB23418.1|4637688_4638099_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	3.3e-16
AYB23419.1|4638071_4640216_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.6	9.9e-197
AYB23420.1|4640226_4641186_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.5	5.2e-129
AYB23421.1|4641540_4642743_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
>prophage 331
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4654579	4661814	4846886	tRNA	Acanthocystis_turfacea_Chlorella_virus(20.0%)	8	NA	NA
AYB23432.1|4654579_4655146_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
AYB23433.1|4655979_4656255_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23434.1|4656267_4656453_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AYB23435.1|4656687_4659318_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.1	1.0e-78
AYB23436.1|4659350_4659557_-	hypothetical protein	NA	NA	NA	NA	NA
AYB23437.1|4659553_4660054_-	regulatory protein RecX	NA	NA	NA	NA	NA
AYB23438.1|4660170_4661232_-	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	3.0e-114
AYB23796.1|4661316_4661814_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.6	4.4e-31
>prophage 332
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4667721	4668687	4846886		Tetraselmis_virus(100.0%)	1	NA	NA
AYB23447.1|4667721_4668687_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.5	8.8e-36
>prophage 333
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4692603	4693425	4846886		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYB23472.1|4692603_4693425_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	2.3e-13
>prophage 334
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4726916	4728605	4846886		Vibrio_phage(100.0%)	1	NA	NA
AYB23509.1|4726916_4728605_-	type III secretion system outer membrane ring protein InvG	NA	R9TEZ5	Vibrio_phage	27.8	3.9e-15
>prophage 335
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4732531	4738260	4846886		Escherichia_phage(50.0%)	5	NA	NA
AYB23513.1|4732531_4733188_+	Serine/threonine-protein phosphatase 2	NA	Q71TJ1	Escherichia_phage	47.9	7.8e-52
AYB23514.1|4733359_4733854_-	hypothetical protein	NA	NA	NA	NA	NA
AYB23515.1|4733880_4734549_-	hypothetical protein	NA	NA	NA	NA	NA
AYB23516.1|4735123_4735534_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYB23517.1|4735692_4738260_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.2	1.1e-29
>prophage 336
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4744225	4754652	4846886		Escherichia_phage(50.0%)	12	NA	NA
AYB23523.1|4744225_4744864_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.8e-85
AYB23524.1|4744860_4746123_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.8	1.7e-132
AYB23525.1|4746116_4747040_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.4	1.7e-116
AYB23526.1|4747236_4748001_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.5	1.1e-70
AYB23527.1|4748019_4748424_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYB23528.1|4748594_4749188_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
AYB23529.1|4749187_4750615_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
AYB23530.1|4750625_4750862_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23531.1|4750906_4751899_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AYB23532.1|4751961_4753095_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
AYB23533.1|4753270_4753897_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	4.8e-35
AYB23534.1|4753890_4754652_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.8	1.4e-57
>prophage 337
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4757762	4759794	4846886		Tupanvirus(50.0%)	2	NA	NA
AYB23540.1|4757762_4758368_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.6	1.3e-29
AYB23541.1|4758354_4759794_-	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	26.5	2.7e-33
>prophage 338
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4778900	4782726	4846886		Vibrio_phage(33.33%)	3	NA	NA
AYB23556.1|4778900_4779572_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
AYB23557.1|4779707_4781006_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	3.4e-131
AYB23558.1|4781088_4782726_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	1.2e-154
>prophage 339
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4793778	4799074	4846886		Erysipelothrix_phage(33.33%)	3	NA	NA
AYB23568.1|4793778_4795074_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.3	8.2e-37
AYB23569.1|4795131_4797888_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.4	3.9e-52
AYB23570.1|4797931_4799074_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.6	2.6e-47
>prophage 340
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4806493	4807342	4846886		Vibrio_phage(100.0%)	1	NA	NA
AYB23577.1|4806493_4807342_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 341
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4812208	4813024	4846886		Bacillus_phage(100.0%)	1	NA	NA
AYB23581.1|4812208_4813024_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	30.6	9.2e-10
>prophage 342
CP032390	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 chromosome, complete genome	4846886	4824566	4841145	4846886	tRNA	environmental_halophage(16.67%)	10	NA	NA
AYB23593.1|4824566_4825772_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	7.3e-72
AYB23594.1|4825771_4826215_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AYB23804.1|4826514_4827402_+	EamA family transporter RarD	NA	NA	NA	NA	NA
AYB23595.1|4827453_4828260_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	6.5e-16
AYB23596.1|4828369_4829467_-	murein transglycosylase A	NA	NA	NA	NA	NA
AYB23597.1|4829966_4831220_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	29.4	1.5e-14
AYB23598.1|4831452_4832784_+	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AYB23599.1|4832886_4834722_-	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	25.2	3.2e-18
AYB23600.1|4834718_4838264_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.6	1.4e-09
AYB23601.1|4838256_4841145_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.8	1.3e-61
>prophage 1
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	0	11835	146176	head,tail	Bifidobacterium_phage(20.0%)	16	NA	NA
AYB23806.1|400_1582_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
AYB23807.1|1630_1903_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23808.1|1955_2591_-	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AYB23809.1|3152_3530_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
AYB23810.1|3522_3804_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23811.1|3778_4453_+	thymidylate kinase	NA	NA	NA	NA	NA
AYB23973.1|4520_4952_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23812.1|4936_5269_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23813.1|5277_5778_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
AYB23814.1|5781_7209_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
AYB23815.1|7208_7865_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23816.1|7920_8538_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AYB23817.1|8538_8745_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23818.1|8749_9049_+	ASCH domain-containing protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
AYB23819.1|9139_9628_-	hypothetical protein	NA	NA	NA	NA	NA
AYB23820.1|9642_11835_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
>prophage 2
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	25574	28933	146176	transposase	Salmonella_phage(50.0%)	3	NA	NA
AYB23837.1|25574_26837_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AYB23838.1|27160_28306_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
AYB23839.1|28399_28933_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
>prophage 3
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	48417	53053	146176		Rhizobium_phage(25.0%)	5	NA	NA
AYB23855.1|48417_49386_+	CbbQ/NirQ/NorQ/GpvN family protein	NA	L7TKP0	Rhizobium_phage	32.6	1.2e-29
AYB23856.1|49396_50305_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23857.1|50365_50896_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
AYB23858.1|50990_51980_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
AYB23859.1|52042_53053_+	endonuclease	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
>prophage 4
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	62288	63914	146176		Staphylococcus_phage(100.0%)	1	NA	NA
AYB23874.1|62288_63914_+	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
>prophage 5
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	70475	83110	146176	transposase	Escherichia_phage(33.33%)	13	NA	NA
AYB23884.1|70475_71327_+	NgrC	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
AYB23885.1|71785_72172_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23975.1|72349_74077_+	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
AYB23886.1|74063_74342_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23887.1|74414_74636_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23888.1|74817_75822_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AYB23889.1|75900_78873_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AYB23976.1|78875_79127_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	78.3	2.5e-27
AYB23890.1|79219_79924_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB23891.1|80061_80298_-	mercury resistance protein	NA	NA	NA	NA	NA
AYB23892.1|80294_80660_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AYB23893.1|80771_81410_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
AYB23894.1|81424_83110_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
>prophage 6
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	87421	91675	146176		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYB23902.1|87421_91675_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
>prophage 7
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	94716	96601	146176	integrase	Gordonia_phage(50.0%)	2	93459:93474	98439:98454
93459:93474	attL	TAATTATGATAATTAC	NA	NA	NA	NA
AYB23908.1|94716_95727_+|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
AYB23909.1|95731_96601_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
98439:98454	attR	TAATTATGATAATTAC	NA	NA	NA	NA
>prophage 8
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	99839	101351	146176		Pseudoalteromonas_phage(100.0%)	1	NA	NA
AYB23915.1|99839_101351_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
>prophage 9
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	108679	112426	146176		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
AYB23920.1|108679_108952_+	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
AYB23921.1|108951_109485_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
AYB23922.1|109495_110104_+	transcriptional regulator	NA	NA	NA	NA	NA
AYB23977.1|110100_110652_+	regulator	NA	NA	NA	NA	NA
AYB23923.1|110711_111131_-	DNA-binding protein	NA	NA	NA	NA	NA
AYB23924.1|111132_111426_-	hypothetical protein	NA	NA	NA	NA	NA
AYB23925.1|111442_112426_-	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
>prophage 10
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	116329	117445	146176		unidentified_phage(100.0%)	1	NA	NA
AYB23930.1|116329_117445_-	phosphohydrolase	NA	H7BVI4	unidentified_phage	29.1	6.4e-46
>prophage 11
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	121086	126941	146176		Wolbachia_phage(25.0%)	11	NA	NA
AYB23936.1|121086_122064_+	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.1e-17
AYB23937.1|122079_122940_+	DsbA family protein	NA	NA	NA	NA	NA
AYB23938.1|122973_123402_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23939.1|123458_123818_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
AYB23940.1|123817_124264_+	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
AYB23941.1|124260_124779_+	nitrite reductase	NA	NA	NA	NA	NA
AYB23942.1|124778_125009_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23943.1|124995_125853_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23944.1|125878_126067_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23945.1|126083_126611_+	nuclease	NA	O64020	Bacillus_phage	37.0	1.3e-09
AYB23946.1|126668_126941_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
>prophage 12
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	130570	133706	146176	transposase	Escherichia_phage(66.67%)	4	NA	NA
AYB23955.1|130570_131032_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
AYB23956.1|131034_131532_+	hypothetical protein	NA	NA	NA	NA	NA
AYB23957.1|131746_132451_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB23958.1|133001_133706_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 13
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	138131	139346	146176		Salmonella_phage(100.0%)	1	NA	NA
AYB23964.1|138131_139346_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	2.5e-19
>prophage 14
CP032391	Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence	146176	144180	144996	146176		Pandoravirus(100.0%)	1	NA	NA
AYB23971.1|144180_144996_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
