The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032387	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 chromosome, complete genome	4844293	180742	226953	4844293	head,tail,plate,holin,transposase,integrase,capsid,terminase	Salmonella_phage(84.91%)	64	176951:176965	225009:225023
176951:176965	attL	GCCAGCGGCATCCCT	NA	NA	NA	NA
AYB14547.1|180742_181765_-|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
AYB14548.1|182226_183045_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14549.1|183071_183449_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14550.1|183841_184024_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14551.1|184387_184609_-	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AYB14552.1|184821_185829_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
AYB14553.1|186113_186683_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
AYB14554.1|186682_188245_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	100.0	2.6e-287
AYB14555.1|188231_188819_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AYB14556.1|188821_189901_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
AYB14557.1|189893_190307_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AYB14558.1|190311_190845_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
AYB14559.1|190837_191902_-|plate	baseplate protein	plate	Q8HAC0	Salmonella_phage	95.1	4.2e-188
AYB14560.1|191898_193239_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
AYB14561.1|193272_195201_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.7	0.0e+00
AYB14562.1|195285_195612_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
AYB14563.1|195608_195965_-|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AYB14564.1|195964_197461_-|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	99.8	6.1e-278
AYB14565.1|197450_197615_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
AYB14566.1|197618_198179_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	99.5	8.8e-105
AYB14567.1|198175_198688_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
AYB14568.1|198659_199064_-|head,tail	head-tail adaptor protein	head,tail	A0A192Y6C2	Salmonella_phage	99.3	5.4e-72
AYB14569.1|199060_199384_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
AYB14570.1|199386_199587_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
AYB14571.1|199637_200843_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
AYB14572.1|202725_202908_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
AYB14573.1|202919_204653_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
AYB14574.1|204649_205153_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	3.6e-89
AYB14575.1|205270_205621_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	8.0e-64
AYB14576.1|205748_206183_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14577.1|206551_206824_-	peptidase	NA	Q8SBD8	Shigella_phage	77.6	3.8e-29
AYB14578.1|206708_207101_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	92.3	1.6e-57
AYB14579.1|207084_207561_-	lysozyme	NA	Q8SBE0	Shigella_phage	96.8	1.7e-85
AYB14580.1|207564_207918_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	88.7	1.0e-50
AYB14581.1|208049_208292_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14582.1|208360_208549_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14583.1|208580_209333_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	2.4e-134
AYB18785.1|209346_210336_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	3.0e-188
AYB14584.1|210343_211249_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	2.8e-161
AYB14585.1|211220_211610_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
AYB14586.1|211618_212500_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	1.1e-170
AYB14587.1|212496_212970_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	93.8	6.6e-53
AYB14588.1|212966_213941_-	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	98.1	1.2e-165
AYB14589.1|213937_214162_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AYB14590.1|214158_215301_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.6	1.6e-182
AYB14591.1|215297_215852_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	5.9e-101
AYB14592.1|215880_216105_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AYB14593.1|216043_216229_-	amino acid permease	NA	NA	NA	NA	NA
AYB14594.1|216202_216898_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
AYB14595.1|217102_217288_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
AYB18786.1|217215_217467_+	hypothetical protein	NA	NA	NA	NA	NA
AYB14596.1|217447_217744_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	98.0	1.1e-50
AYB14597.1|217661_217907_-	hypothetical protein	NA	NA	NA	NA	NA
AYB14598.1|218443_218815_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AYB14599.1|218872_219700_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	97.5	1.0e-149
AYB14600.1|219836_220376_+	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AYB14601.1|220446_221184_+	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	86.3	1.8e-52
AYB14602.1|221183_221657_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.3	5.0e-69
AYB14603.1|221660_222410_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	83.6	1.1e-46
AYB14604.1|222406_222976_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	91.0	5.8e-104
AYB14605.1|223000_223243_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	98.8	2.1e-39
AYB14606.1|223244_224234_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AYB14607.1|224525_225323_+	protein MtfA	NA	NA	NA	NA	NA
225009:225023	attR	GCCAGCGGCATCCCT	NA	NA	NA	NA
AYB18787.1|225678_226953_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.1	8.2e-74
>prophage 2
CP032387	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 chromosome, complete genome	4844293	339881	350388	4844293		Enterobacteria_phage(37.5%)	10	NA	NA
AYB14719.1|339881_341195_-	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYB14720.1|341221_342301_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
AYB14721.1|342305_343079_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYB14722.1|343094_344069_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AYB14723.1|344074_344626_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AYB18794.1|344626_345505_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AYB14724.1|345552_346452_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AYB14725.1|346451_347537_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYB14726.1|347913_348807_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYB14727.1|348984_350388_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 3
CP032387	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 chromosome, complete genome	4844293	417585	426756	4844293	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYB14779.1|417585_419619_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	2.1e-55
AYB14780.1|419859_420318_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	71.2	7.1e-52
AYB14781.1|420489_421020_+	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYB14782.1|421076_421544_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	8.8e-74
AYB14783.1|421590_422310_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYB14784.1|422306_423992_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.4e-278
AYB14785.1|424214_424946_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	2.2e-100
AYB14786.1|425005_425113_+	protein YohO	NA	NA	NA	NA	NA
AYB14787.1|425093_425825_-	ABC transporter permease	NA	NA	NA	NA	NA
AYB14788.1|425808_426756_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 4
CP032387	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 chromosome, complete genome	4844293	662953	668992	4844293		Salmonella_virus(50.0%)	6	NA	NA
AYB15007.1|662953_663895_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
AYB15008.1|665137_665527_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
AYB15009.1|665495_665750_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
AYB15010.1|665767_667690_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	76.9	8.1e-299
AYB15011.1|668679_668823_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
AYB15012.1|668761_668992_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	5.4e-08
>prophage 5
CP032387	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 chromosome, complete genome	4844293	898971	997870	4844293	lysis,head,tail,plate,portal,transposase,integrase,capsid,tRNA	Salmonella_phage(72.0%)	90	981552:981567	994819:994834
AYB15200.1|898971_899709_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AYB15201.1|899838_901173_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AYB18809.1|901190_902090_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYB15202.1|902192_902780_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AYB15203.1|902841_903225_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	71.8	6.1e-33
AYB15204.1|903543_904233_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AYB15205.1|904348_905386_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AYB15206.1|905589_906009_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AYB15207.1|906081_906762_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AYB15208.1|906815_909476_+	protein lysine acetyltransferase Pat	NA	NA	NA	NA	NA
AYB15209.1|909590_910946_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AYB15210.1|910990_911314_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
AYB15211.1|911310_912612_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
AYB15212.1|912715_913171_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
AYB15213.1|918951_921525_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
AYB15214.1|921654_922386_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AYB15215.1|922382_923363_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AYB15216.1|923494_924232_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AYB15217.1|924503_924842_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AYB18810.1|924945_924993_+	hypothetical protein	NA	NA	NA	NA	NA
AYB15218.1|925092_926253_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AYB15219.1|926213_927122_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AYB15220.1|927179_928301_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYB15221.1|928310_929381_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AYB15222.1|929820_930339_+	YfiR family protein	NA	NA	NA	NA	NA
AYB15223.1|930331_931552_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
AYB15224.1|931709_932057_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYB15225.1|932097_932865_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYB15226.1|932909_933458_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYB15227.1|933476_933725_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYB15228.1|933977_935339_-	signal recognition particle protein	NA	NA	NA	NA	NA
AYB15229.1|935504_936296_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYB15230.1|936360_937602_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYB15231.1|937722_938328_+	cytoplasmic protein	NA	NA	NA	NA	NA
AYB18811.1|938362_938953_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYB15232.1|939076_939955_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYB15233.1|940040_941702_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AYB15234.1|941850_942189_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYB15235.1|942354_942645_-	RnfH family protein	NA	NA	NA	NA	NA
AYB15236.1|942634_943111_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYB18812.1|943260_943743_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AYB15237.1|944357_955577_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AYB15238.1|955641_957051_+	type I secretion protein TolC	NA	NA	NA	NA	NA
AYB18813.1|959230_960394_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYB18814.1|960945_961164_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AYB15239.1|961232_962333_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	9.0e-194
AYB15240.1|962329_962815_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AYB15241.1|962811_965619_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.0	0.0e+00
AYB15242.1|965611_965731_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
AYB15243.1|965745_966048_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
AYB15244.1|966102_966618_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYB15245.1|966627_967800_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
AYB15246.1|967930_968458_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AYB15247.1|968460_970146_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	50.6	3.5e-128
AYB15248.1|970142_970748_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
AYB15249.1|970740_971649_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.0	7.2e-157
AYB15250.1|971635_971995_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	91.5	3.5e-54
AYB15251.1|971991_972570_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.8e-92
AYB15252.1|972665_973532_+	hypothetical protein	NA	NA	NA	NA	NA
AYB15253.1|973558_974005_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	3.1e-60
AYB15254.1|973997_974429_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
AYB15255.1|974391_974595_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	8.9e-23
AYB15256.1|974524_974953_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	1.3e-47
AYB15257.1|974949_975327_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	5.1e-16
AYB18815.1|975328_975802_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYB15258.1|975821_976037_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYB15259.1|976040_976244_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYB15260.1|976243_976708_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
AYB15261.1|976803_977454_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYB15262.1|977457_978516_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	4.9e-181
AYB15263.1|978532_979366_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	5.9e-121
AYB15264.1|979508_981275_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
AYB15265.1|981274_982306_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.0	5.0e-170
981552:981567	attL	TCAGCCAGCAGGCTTT	NA	NA	NA	NA
AYB15266.1|983085_984240_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYB15267.1|984732_985539_+	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	6.2e-51
AYB15268.1|985649_985949_+	hypothetical protein	NA	NA	NA	NA	NA
AYB15269.1|986017_986206_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
AYB15270.1|986361_988758_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.9	0.0e+00
AYB15271.1|988754_989612_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	99.6	1.5e-164
AYB15272.1|989608_989836_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
AYB15273.1|989835_990069_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
AYB15274.1|990136_990478_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
AYB15275.1|990697_991156_+	hypothetical protein	NA	NA	NA	NA	NA
AYB15276.1|991103_991337_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
AYB15277.1|991890_992130_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
AYB15278.1|992246_992879_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.1e-66
AYB15279.1|992882_993908_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	99.1	9.2e-201
AYB15280.1|994167_994761_+	hypothetical protein	NA	NA	NA	NA	NA
AYB15281.1|995159_995963_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
994819:994834	attR	AAAGCCTGCTGGCTGA	NA	NA	NA	NA
AYB15282.1|996758_997870_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
>prophage 6
CP032387	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 chromosome, complete genome	4844293	3499659	3545296	4844293	coat,lysis,tail,protease,portal,holin,integrase,terminase	Salmonella_phage(71.64%)	68	3499602:3499642	3545590:3545630
3499602:3499642	attL	TCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGC	NA	NA	NA	NA
AYB17503.1|3499659_3500823_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	97.1	1.0e-219
AYB17504.1|3500678_3501050_-	DNA-binding protein	NA	B9UDM0	Salmonella_phage	80.5	2.1e-46
AYB18912.1|3501052_3501397_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	97.4	1.1e-57
AYB17505.1|3501474_3501786_-	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	99.0	7.9e-55
AYB17506.1|3501867_3502197_-	ASCH domain-containing protein	NA	Q9XJG9	Enterobacteria_phage	94.2	1.0e-52
AYB17507.1|3502141_3503224_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.2	6.5e-80
AYB17508.1|3503220_3503514_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	99.0	4.2e-50
AYB17509.1|3503898_3504480_-	Eae-like protein	NA	A0A0N6WGF1	Salmonella_phage	71.5	5.2e-68
AYB17510.1|3504476_3504647_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AYB17511.1|3504657_3504951_-	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	100.0	5.5e-50
AYB17512.1|3504966_3505515_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
AYB17513.1|3505523_3506030_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	3.8e-91
AYB17514.1|3506030_3506738_-	recombinase	NA	E7C9Q0	Salmonella_phage	89.8	9.7e-125
AYB17515.1|3506746_3506935_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
AYB17516.1|3506931_3507045_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
AYB17517.1|3507037_3507178_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	2.0e-18
AYB17518.1|3507501_3507801_-	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	99.0	3.3e-50
AYB17519.1|3507840_3508041_-	restriction endonuclease	NA	A0A1R3Y5S4	Salmonella_virus	100.0	1.0e-31
AYB17520.1|3508119_3508452_-	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	100.0	2.2e-55
AYB17521.1|3508815_3509025_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	5.5e-28
AYB17522.1|3509060_3509984_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	100.0	1.5e-181
AYB17523.1|3510072_3510762_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
AYB17524.1|3510872_3511088_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
AYB17525.1|3511198_3511480_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AYB17526.1|3511514_3511661_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AYB17527.1|3512469_3513846_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
AYB17528.1|3513901_3514360_+	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	3.0e-79
AYB17529.1|3514356_3515229_+	hypothetical protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
AYB17530.1|3515225_3515399_+	protein ninD	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
AYB17531.1|3515365_3515548_+	NinE family protein	NA	Q716C5	Shigella_phage	96.7	1.8e-27
AYB17532.1|3515544_3515721_+	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.8e-27
AYB17533.1|3515683_3515980_+	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	98.9	7.5e-47
AYB17534.1|3515976_3516372_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	96.9	2.9e-70
AYB17535.1|3516368_3516572_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	94.0	5.7e-30
AYB17536.1|3516641_3517130_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
AYB17537.1|3517176_3517374_+	hypothetical protein	NA	C6ZR63	Salmonella_phage	96.2	5.0e-23
AYB17538.1|3517509_3517836_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
AYB17539.1|3517819_3518257_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
AYB17540.1|3518253_3518724_+|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	87.2	1.2e-62
AYB17541.1|3518758_3518983_+	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	90.3	7.2e-26
AYB17542.1|3518936_3519467_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	4.0e-91
AYB17543.1|3519725_3519968_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AYB17544.1|3519971_3520361_+	hypothetical protein	NA	C6ZR72	Salmonella_phage	99.2	1.5e-74
AYB17545.1|3520360_3520765_+	Decoration protein	NA	C6ZR73	Salmonella_phage	100.0	5.3e-67
AYB17546.1|3520768_3521257_+	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AYB17547.1|3521234_3522734_+|terminase	terminase	terminase	A8CGE0	Salmonella_phage	99.8	6.9e-306
AYB17548.1|3522733_3524911_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.3	0.0e+00
AYB17549.1|3524924_3525836_+	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
AYB17550.1|3525835_3527128_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.8	1.1e-243
AYB17551.1|3527168_3527729_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.9	1.4e-102
AYB17552.1|3527712_3528213_+	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
AYB17553.1|3528172_3529591_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.3	3.3e-273
AYB17554.1|3529594_3530296_+|tail	phage tail protein	tail	B8K1I3	Salmonella_phage	98.3	8.8e-70
AYB17555.1|3530295_3530751_+	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
AYB17556.1|3530753_3531443_+	DNA transfer protein	NA	E7C9U4	Salmonella_phage	99.6	1.2e-108
AYB17557.1|3531453_3532758_+	acyltransferase	NA	E7C9U5	Salmonella_phage	96.3	7.8e-213
AYB17558.1|3532757_3534671_+	DNA transfer protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
AYB17559.1|3534688_3535018_-	hypothetical protein	NA	NA	NA	NA	NA
AYB17560.1|3535048_3535414_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
AYB18913.1|3535427_3535607_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
AYB17561.1|3535706_3535958_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
AYB17562.1|3536093_3538097_+	endorhamnosidase	NA	E7C9U9	Salmonella_phage	99.9	0.0e+00
AYB17563.1|3538155_3539613_-	hypothetical protein	NA	E7C9N7	Salmonella_phage	99.8	1.7e-240
AYB17564.1|3539602_3540535_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
AYB17565.1|3540531_3540894_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AYB17566.1|3542377_3544030_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	38.0	1.5e-83
AYB17567.1|3544010_3544937_-	glycosyltransferase	NA	I1TED8	Salmonella_phage	96.7	1.4e-168
AYB17568.1|3544933_3545296_-	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
3545590:3545630	attR	TCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGC	NA	NA	NA	NA
>prophage 7
CP032387	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 chromosome, complete genome	4844293	3882754	3890067	4844293	protease,integrase	Dickeya_phage(16.67%)	7	3884005:3884019	3894998:3895012
AYB17865.1|3882754_3883873_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	8.1e-09
AYB17866.1|3883869_3885816_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-39
3884005:3884019	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYB17867.1|3885945_3886167_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYB17868.1|3886490_3886811_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYB17869.1|3886841_3889118_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AYB17870.1|3889330_3889528_-	hypothetical protein	NA	NA	NA	NA	NA
AYB17871.1|3889689_3890067_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
3894998:3895012	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 8
CP032387	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 chromosome, complete genome	4844293	3961036	4021584	4844293	tail,protease,holin,terminase	Salmonella_phage(54.55%)	66	NA	NA
AYB17924.1|3961036_3962329_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.3e-252
AYB17925.1|3962373_3962622_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYB17926.1|3962662_3962902_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AYB17927.1|3964066_3967255_-	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	74.0	0.0e+00
AYB17928.1|3967964_3968369_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYB17929.1|3968498_3968735_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
AYB17930.1|3968700_3969075_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYB17931.1|3969159_3970143_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AYB17932.1|3970145_3970895_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYB17933.1|3970905_3971253_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYB17934.1|3971249_3971774_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYB17935.1|3971773_3972247_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	4.7e-67
AYB17936.1|3972250_3972823_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYB17937.1|3972916_3973183_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYB17938.1|3973338_3973578_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYB17939.1|3973567_3973873_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYB17940.1|3973912_3974515_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
AYB17941.1|3974514_3974721_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AYB17942.1|3974723_3975335_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AYB17943.1|3975331_3975478_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AYB17944.1|3975467_3976265_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.4e-150
AYB17945.1|3976663_3977011_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.3e-45
AYB17946.1|3977013_3977628_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	1.2e-107
AYB17947.1|3977624_3978176_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYB17948.1|3978165_3978579_+	hypothetical protein	NA	NA	NA	NA	NA
AYB17949.1|3978640_3979615_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	37.3	1.6e-29
AYB17950.1|3979604_3980876_+	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.3	1.1e-83
AYB17951.1|3980875_3982306_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	2.6e-92
AYB17952.1|3982277_3983153_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.5	1.5e-55
AYB17953.1|3983153_3984728_+	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	2.2e-20
AYB17954.1|3984748_3985621_+	hypothetical protein	NA	NA	NA	NA	NA
AYB17955.1|3985638_3986670_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.2	2.5e-73
AYB17956.1|3986734_3987220_+	hypothetical protein	NA	NA	NA	NA	NA
AYB17957.1|3987232_3987658_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18935.1|3987675_3988086_+	hypothetical protein	NA	NA	NA	NA	NA
AYB17958.1|3988069_3989008_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.9	2.9e-52
AYB17959.1|3989012_3990407_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.0	1.2e-70
AYB17960.1|3990410_3990848_+	hypothetical protein	NA	NA	NA	NA	NA
AYB17961.1|3990847_3991435_+	hypothetical protein	NA	NA	NA	NA	NA
AYB17962.1|3991558_3993613_+	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	36.3	7.7e-21
AYB17963.1|3993612_3994110_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.0	8.9e-24
AYB17964.1|3994325_3994601_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	33.3	1.6e-06
AYB17965.1|3994600_3995653_+	hypothetical protein	NA	NA	NA	NA	NA
AYB17966.1|3995649_3996366_+	hypothetical protein	NA	NA	NA	NA	NA
AYB17967.1|3996362_3996695_+	hypothetical protein	NA	NA	NA	NA	NA
AYB17968.1|3996691_3997918_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	63.6	3.2e-147
AYB17969.1|3997901_3998528_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
AYB17970.1|3998524_4000234_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
AYB17971.1|4000233_4000815_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AYB17972.1|4000818_4001067_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
AYB17973.1|4001292_4002261_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	3.3e-192
AYB17974.1|4002908_4003535_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AYB17975.1|4003894_4004581_-	virulence protein	NA	NA	NA	NA	NA
AYB17976.1|4004851_4005043_-	DinI family protein	NA	S4TNM0	Salmonella_phage	93.7	1.8e-25
AYB17977.1|4005469_4008082_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AYB17978.1|4008289_4009300_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AYB17979.1|4009465_4010008_+	cell division protein ZapC	NA	NA	NA	NA	NA
AYB17980.1|4010004_4011114_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYB17981.1|4011212_4013321_+	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AYB17982.1|4013333_4015241_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AYB17983.1|4015255_4016509_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AYB17984.1|4016513_4018154_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AYB17985.1|4018150_4018714_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AYB17986.1|4018969_4019137_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYB17987.1|4019236_4019755_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AYB17988.1|4019823_4021584_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 9
CP032387	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 chromosome, complete genome	4844293	4234302	4310538	4844293	lysis,tail,protease,portal,holin,integrase,terminase	Enterobacteria_phage(26.09%)	84	4235383:4235412	4283156:4283185
AYB18202.1|4234302_4235382_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	1.5e-100
AYB18203.1|4235356_4235635_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.8e-10
4235383:4235412	attL	TGATCAACTTCTCCAGCAATGCACTCGGTT	NA	NA	NA	NA
AYB18946.1|4235695_4235932_-	hypothetical protein	NA	NA	NA	NA	NA
AYB18204.1|4236222_4236408_-	DUF1187 family protein	NA	NA	NA	NA	NA
AYB18205.1|4236454_4237285_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	2.5e-103
AYB18206.1|4237277_4239968_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	72.8	4.0e-118
AYB18207.1|4240108_4240444_-	hypothetical protein	NA	NA	NA	NA	NA
AYB18208.1|4240519_4240726_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AYB18209.1|4240729_4241005_-	hypothetical protein	NA	NA	NA	NA	NA
AYB18210.1|4241353_4241620_-	hypothetical protein	NA	NA	NA	NA	NA
AYB18211.1|4242022_4242421_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
AYB18212.1|4242519_4242774_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AYB18213.1|4242760_4243255_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18214.1|4243301_4244300_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.1e-121
AYB18215.1|4244292_4244754_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.5	3.5e-67
AYB18216.1|4244766_4245162_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
AYB18217.1|4245448_4246579_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AYB18218.1|4246975_4248955_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
AYB18219.1|4248972_4249164_-	hypothetical protein	NA	NA	NA	NA	NA
AYB18220.1|4249586_4249892_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18221.1|4249955_4250555_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
AYB18222.1|4250551_4250779_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AYB18223.1|4250908_4251598_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AYB18947.1|4251694_4252219_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18224.1|4252592_4253042_-	hypothetical protein	NA	NA	NA	NA	NA
AYB18225.1|4253402_4254089_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AYB18948.1|4254364_4254694_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AYB18226.1|4254677_4255130_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AYB18949.1|4255147_4255627_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AYB18227.1|4255834_4256368_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	7.8e-34
AYB18228.1|4256324_4258463_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AYB18229.1|4258459_4258666_+	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AYB18950.1|4258692_4260210_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	4.9e-174
AYB18951.1|4260133_4262215_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AYB18230.1|4262305_4262629_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AYB18231.1|4262621_4262921_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AYB18232.1|4262901_4263468_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
AYB18233.1|4263464_4263866_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
AYB18234.1|4263877_4264627_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	4.8e-90
AYB18235.1|4264672_4265071_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AYB18236.1|4265067_4265397_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AYB18952.1|4265476_4268464_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	2.8e-266
AYB18237.1|4268460_4268793_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
AYB18238.1|4268891_4269389_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.9	1.4e-16
AYB18239.1|4269505_4270039_-	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AYB18240.1|4270128_4270824_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AYB18241.1|4270833_4271565_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	1.0e-113
AYB18242.1|4271468_4272173_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
AYB18243.1|4274733_4275597_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
AYB18244.1|4275635_4275878_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18245.1|4275931_4278349_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.8	4.7e-86
AYB18246.1|4278348_4278918_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	3.4e-96
AYB18247.1|4279119_4279842_-	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AYB18248.1|4280321_4281122_-	hypothetical protein	NA	NA	NA	NA	NA
AYB18249.1|4282075_4283155_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.1e-98
AYB18250.1|4284288_4284576_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.9	1.6e-38
4283156:4283185	attR	TGATCAACTTCTCCAGCAATGCACTCGGTT	NA	NA	NA	NA
AYB18251.1|4284572_4285106_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	3.2e-11
AYB18252.1|4285362_4285530_-	lytic enzyme	NA	NA	NA	NA	NA
AYB18253.1|4285594_4285786_-	hypothetical protein	NA	NA	NA	NA	NA
AYB18254.1|4287244_4287445_-	phage virulence factor	NA	NA	NA	NA	NA
AYB18255.1|4287646_4287751_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYB18256.1|4288012_4288138_+	arsenic transporter	NA	NA	NA	NA	NA
AYB18257.1|4288266_4288533_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18258.1|4289285_4289900_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AYB18259.1|4289909_4290068_-	hypothetical protein	NA	NA	NA	NA	NA
AYB18953.1|4291734_4291935_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18260.1|4294243_4294384_-	hypothetical protein	NA	NA	NA	NA	NA
AYB18261.1|4294549_4294819_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
AYB18262.1|4294865_4295060_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18263.1|4295188_4295608_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYB18264.1|4295980_4296457_-	hypothetical protein	NA	NA	NA	NA	NA
AYB18265.1|4296838_4297180_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AYB18266.1|4297863_4298586_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AYB18267.1|4298870_4299035_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18268.1|4299258_4299909_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
AYB18269.1|4299927_4300119_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYB18270.1|4300229_4300469_-	DUF1480 family protein	NA	NA	NA	NA	NA
AYB18954.1|4300583_4302023_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AYB18271.1|4302100_4304740_-	PqiB family protein	NA	NA	NA	NA	NA
AYB18272.1|4304702_4305986_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYB18273.1|4306027_4306612_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AYB18274.1|4306709_4307396_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYB18275.1|4307415_4309464_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AYB18276.1|4309656_4310538_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 1
CP032388	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence	124532	0	8545	124532	tail,head	Colwellia_phage(33.33%)	12	NA	NA
AYB18982.1|232_514_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18983.1|488_1163_+	thymidylate kinase	NA	NA	NA	NA	NA
AYB19124.1|1230_1662_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18984.1|1646_1979_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18985.1|1987_2488_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
AYB18986.1|2491_3919_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
AYB18987.1|3918_4575_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18988.1|4630_5248_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AYB18989.1|5248_5455_+	hypothetical protein	NA	NA	NA	NA	NA
AYB18990.1|5459_5759_+	ASCH domain-containing protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
AYB18991.1|5849_6338_-	hypothetical protein	NA	NA	NA	NA	NA
AYB18992.1|6352_8545_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
>prophage 2
CP032388	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence	124532	22284	71955	124532	integrase,transposase	Escherichia_phage(29.41%)	52	17090:17110	83374:83394
17090:17110	attL	AACTTTCACATGTGAAAGTTT	NA	NA	NA	NA
AYB19009.1|22284_23547_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AYB19010.1|23870_25016_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
AYB19011.1|25636_26341_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB19012.1|26331_26514_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19013.1|26435_26921_+	Abi family protein	NA	A3QSC6	Clostridium_virus	31.0	6.4e-11
AYB19014.1|27079_28207_-	hypothetical protein	NA	J9Q803	Salmonella_phage	28.7	1.1e-26
AYB19015.1|29284_29929_-	resolvase	NA	A0A1V0E035	Clostridioides_phage	27.8	7.5e-07
AYB19016.1|34278_35019_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.3	6.2e-05
AYB19017.1|35073_35637_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
AYB19018.1|35753_36206_+	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
AYB19019.1|36993_37260_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
AYB19125.1|37507_37585_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AYB19020.1|37565_38447_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AYB19021.1|38458_38674_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19022.1|39665_39839_-	hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	72.6	1.1e-16
AYB19023.1|40485_41280_-	hypothetical protein	NA	NA	NA	NA	NA
AYB19126.1|41315_41975_-	fimbrial protein	NA	NA	NA	NA	NA
AYB19024.1|43433_43706_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19025.1|43941_44739_+	fimbrial protein	NA	NA	NA	NA	NA
AYB19026.1|44766_45531_+	fimbrial protein	NA	NA	NA	NA	NA
AYB19027.1|45517_45793_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19028.1|45792_46506_+	fimbrial protein	NA	NA	NA	NA	NA
AYB19029.1|46630_47215_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19030.1|47287_47500_+	faeA-like family protein	NA	NA	NA	NA	NA
AYB19031.1|47947_48796_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19032.1|48870_49158_-	hypothetical protein	NA	NA	NA	NA	NA
AYB19033.1|49365_49794_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AYB19034.1|49790_50021_-	virulence-associated protein vagC	NA	NA	NA	NA	NA
AYB19035.1|50765_50984_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
AYB19036.1|50985_51291_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
AYB19037.1|51292_51583_+	cytoplasmic protein	NA	NA	NA	NA	NA
AYB19038.1|51579_52101_+	cytoplasmic protein	NA	NA	NA	NA	NA
AYB19039.1|52135_52918_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
AYB19040.1|53642_54152_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
AYB19041.1|54693_55254_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AYB19042.1|55320_55680_-	Virulence protein VsdF	NA	A0A077SLN2	Escherichia_phage	76.7	3.0e-42
AYB19043.1|55736_56162_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
AYB19044.1|56288_56939_-	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
AYB19045.1|57199_57925_-	type III secretion system effector phosphothreonine lyase SpvC	NA	NA	NA	NA	NA
AYB19046.1|58205_59987_-	SPI-2 type III secretion system effector NAD(+)--protein-arginine ADP-ribosyltransferase SpvB	NA	NA	NA	NA	NA
AYB19047.1|60168_60936_-	Virulence protein SpvA	NA	NA	NA	NA	NA
AYB19048.1|61109_61274_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
AYB19049.1|61447_62341_-	virulence genes transcriptional activator SpvR	NA	NA	NA	NA	NA
AYB19050.1|63490_64195_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB19051.1|64841_65867_+	AAA family ATPase	NA	NA	NA	NA	NA
AYB19052.1|66673_67378_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB19053.1|67530_68346_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AYB19054.1|68535_69240_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB19127.1|69275_69539_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19055.1|69531_70068_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19056.1|70070_71081_+|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
AYB19057.1|71085_71955_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
83374:83394	attR	AAACTTTCACATGTGAAAGTT	NA	NA	NA	NA
>prophage 3
CP032388	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence	124532	75125	76637	124532		Pseudoalteromonas_phage(100.0%)	1	NA	NA
AYB19062.1|75125_76637_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
>prophage 4
CP032388	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence	124532	83965	87712	124532		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
AYB19067.1|83965_84238_+	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
AYB19068.1|84237_84771_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
AYB19069.1|84781_85390_+	transcriptional regulator	NA	NA	NA	NA	NA
AYB19128.1|85386_85938_+	regulator	NA	NA	NA	NA	NA
AYB19070.1|85997_86417_-	DNA-binding protein	NA	NA	NA	NA	NA
AYB19071.1|86418_86712_-	hypothetical protein	NA	NA	NA	NA	NA
AYB19072.1|86728_87712_-	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
>prophage 5
CP032388	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence	124532	91615	92731	124532		unidentified_phage(100.0%)	1	NA	NA
AYB19077.1|91615_92731_-	phosphohydrolase	NA	H7BVI4	unidentified_phage	29.1	6.4e-46
>prophage 6
CP032388	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence	124532	96372	102227	124532		Wolbachia_phage(25.0%)	11	NA	NA
AYB19083.1|96372_97350_+	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.1e-17
AYB19084.1|97365_98226_+	DsbA family protein	NA	NA	NA	NA	NA
AYB19085.1|98259_98688_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19086.1|98744_99104_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
AYB19087.1|99103_99550_+	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
AYB19088.1|99546_100065_+	nitrite reductase	NA	NA	NA	NA	NA
AYB19089.1|100064_100295_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19090.1|100281_101139_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19091.1|101164_101353_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19092.1|101369_101897_+	nuclease	NA	O64020	Bacillus_phage	37.0	1.3e-09
AYB19093.1|101954_102227_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
>prophage 7
CP032388	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence	124532	105856	108992	124532	transposase	Escherichia_phage(66.67%)	4	NA	NA
AYB19102.1|105856_106318_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
AYB19103.1|106320_106818_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19104.1|107032_107737_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYB19105.1|108287_108992_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 8
CP032388	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence	124532	113197	114412	124532		Salmonella_phage(100.0%)	1	NA	NA
AYB19111.1|113197_114412_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
>prophage 9
CP032388	Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence	124532	119246	122824	124532		Pandoravirus(33.33%)	4	NA	NA
AYB19118.1|119246_120062_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AYB19119.1|120368_120680_+	hypothetical protein	NA	NA	NA	NA	NA
AYB19120.1|120853_121639_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
AYB19121.1|121642_122824_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
