The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
CP032364	Lachnoanaerobaculum umeaense strain DSM 23576 = CCUG 58757 chromosome, complete genome	2810441	559398	567649	2810441	integrase	Clostridium_phage(33.33%)	10	559307:559325	568361:568379
559307:559325	attL	TATATCAGATGAGGGTAAA	NA	NA	NA	NA
AYA98872.1|559398_560457_-|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	40.1	1.5e-68
AYA98873.1|560905_561295_-	XRE family transcriptional regulator	NA	A0A1B2LRS2	Wolbachia_phage	36.9	1.4e-08
AYA98874.1|561467_561671_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB00781.1|561798_561990_+	hypothetical protein	NA	Q8SBM7	Clostridium_phage	49.1	8.4e-07
AYA98875.1|562001_564194_+	DNA primase	NA	H9YQD3	environmental_Halophage	27.0	9.6e-22
AYA98876.1|564618_564813_+	hypothetical protein	NA	NA	NA	NA	NA
AYA98877.1|564921_565185_+	hypothetical protein	NA	NA	NA	NA	NA
AYA98878.1|565341_565686_+	hypothetical protein	NA	NA	NA	NA	NA
AYA98879.1|566377_566779_+	hypothetical protein	NA	Q5YA71	Bacillus_phage	43.6	4.6e-07
AYA98880.1|566797_567649_+	hypothetical protein	NA	A0A2H4JBI0	uncultured_Caudovirales_phage	47.5	1.1e-63
568361:568379	attR	TATATCAGATGAGGGTAAA	NA	NA	NA	NA
>prophage 3
CP032364	Lachnoanaerobaculum umeaense strain DSM 23576 = CCUG 58757 chromosome, complete genome	2810441	917469	927575	2810441	integrase	Bacillus_phage(33.33%)	8	918640:918660	920480:920500
AYA99198.1|917469_918672_+	restriction endonuclease subunit S	NA	A0A1V0SLK8	Klosneuvirus	31.0	5.3e-22
918640:918660	attL	GGCGAACTTGATGTCTCAAAC	NA	NA	NA	NA
AYA99199.1|918927_919911_+|integrase	integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	28.6	1.5e-35
AYA99200.1|919925_920471_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYA99201.1|920467_921061_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
920480:920500	attR	GTTTGAGACATCAAGTTCGCC	NA	NA	NA	NA
AYA99202.1|921215_924365_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.9	1.2e-65
AYA99203.1|924659_925844_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.6	1.2e-154
AYA99204.1|925843_926875_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.8	6.3e-24
AYA99205.1|926885_927575_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.7	2.0e-37
>prophage 4
CP032364	Lachnoanaerobaculum umeaense strain DSM 23576 = CCUG 58757 chromosome, complete genome	2810441	1051927	1060091	2810441	integrase	Clostridium_phage(33.33%)	9	1051907:1051924	1060694:1060711
1051907:1051924	attL	TGATAATAAAATGATAAT	NA	NA	NA	NA
AYA99314.1|1051927_1052986_-|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	40.1	1.5e-68
AYA99315.1|1053432_1054026_-	XRE family transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	28.8	1.6e-08
AYA99316.1|1054187_1054382_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB00804.1|1054499_1054691_+	hypothetical protein	NA	Q8SBM7	Clostridium_phage	49.1	6.4e-07
AYA99317.1|1054703_1056902_+	DNA primase	NA	H9YQD3	environmental_Halophage	25.7	3.0e-15
AYA99318.1|1057363_1057627_+	hypothetical protein	NA	NA	NA	NA	NA
AYA99319.1|1057783_1058128_+	hypothetical protein	NA	NA	NA	NA	NA
AYA99320.1|1058819_1059221_+	hypothetical protein	NA	Q5YA71	Bacillus_phage	43.6	4.6e-07
AYA99321.1|1059239_1060091_+	hypothetical protein	NA	A0A2H4JBI0	uncultured_Caudovirales_phage	47.5	1.1e-63
1060694:1060711	attR	TGATAATAAAATGATAAT	NA	NA	NA	NA
>prophage 5
CP032364	Lachnoanaerobaculum umeaense strain DSM 23576 = CCUG 58757 chromosome, complete genome	2810441	1905638	1991064	2810441	transposase,holin,portal,coat,terminase,tail,tRNA	Clostridium_phage(38.46%)	100	NA	NA
AYB00002.1|1905638_1906922_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	26.5	5.5e-09
AYB00003.1|1907243_1907531_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00004.1|1907520_1908468_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYB00005.1|1908539_1909322_-	RNA methyltransferase	NA	NA	NA	NA	NA
AYB00006.1|1909345_1911277_-	NAD(+) synthase	NA	NA	NA	NA	NA
AYB00007.1|1911273_1911822_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	44.7	3.0e-17
AYB00008.1|1911937_1912717_+	hypothetical protein	NA	NA	NA	NA	NA
AYB00009.1|1912757_1913255_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AYB00010.1|1913251_1914412_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYB00011.1|1914408_1914891_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AYB00012.1|1914862_1915465_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00013.1|1915464_1917075_-	vancomycin resistance protein	NA	NA	NA	NA	NA
AYB00014.1|1917290_1917998_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AYB00015.1|1917994_1918624_-	endonuclease III	NA	NA	NA	NA	NA
AYB00016.1|1918620_1919115_-	cytidine deaminase	NA	G8DFT3	Emiliania_huxleyi_virus	57.6	3.5e-49
AYB00017.1|1919122_1920211_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	37.3	1.5e-47
AYB00018.1|1920211_1921207_-	DNA polymerase III	NA	NA	NA	NA	NA
AYB00019.1|1921251_1921557_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AYB00020.1|1921564_1922701_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.6	9.2e-85
AYB00021.1|1922708_1925099_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.6	2.7e-25
AYB00022.1|1926193_1927585_-	thioether cross-link-forming SCIFF peptide maturase	NA	NA	NA	NA	NA
AYB00023.1|1927663_1927810_-	six-cysteine peptide SCIFF	NA	NA	NA	NA	NA
AYB00024.1|1927958_1930301_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00025.1|1930305_1930671_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00026.1|1930670_1932650_-	serine/threonine protein kinase	NA	A0A0H4Y184	Salmon_gill_poxvirus	32.6	9.0e-19
AYB00027.1|1932660_1933419_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AYB00028.1|1933422_1934766_-	FHA domain-containing protein	NA	NA	NA	NA	NA
AYB00029.1|1934775_1935834_-	AAA family ATPase	NA	NA	NA	NA	NA
AYB00030.1|1935843_1937136_-	WG repeat-containing protein	NA	NA	NA	NA	NA
AYB00031.1|1937145_1937769_-	prepilin peptidase	NA	NA	NA	NA	NA
AYB00032.1|1937779_1939093_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00033.1|1939196_1940048_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00034.1|1940080_1943905_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00035.1|1943910_1944597_-	pilus assembly protein	NA	NA	NA	NA	NA
AYB00036.1|1944625_1944856_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00037.1|1944928_1945783_-	secretion protein F	NA	NA	NA	NA	NA
AYB00038.1|1945788_1946592_-	kinase	NA	NA	NA	NA	NA
AYB00039.1|1946591_1947830_-	CpaF family protein	NA	NA	NA	NA	NA
AYB00040.1|1948299_1949052_-	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AYB00041.1|1949303_1950221_-	cell surface protein	NA	H7BVE5	unidentified_phage	41.2	9.3e-27
AYB00042.1|1950230_1950530_-	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
AYB00043.1|1950617_1951058_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
AYB00044.1|1951035_1951239_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00045.1|1951342_1951786_-|holin	holin	holin	A0A090D848	Clostridium_phage	45.9	1.1e-17
AYB00046.1|1952002_1952383_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00047.1|1952392_1954093_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00048.1|1954094_1954469_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00049.1|1954476_1955022_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
AYB00050.1|1955014_1956082_-|tail	phage tail protein	tail	A0A0A8WJT7	Clostridium_phage	45.8	2.2e-80
AYB00051.1|1956081_1956477_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	54.3	3.3e-29
AYB00052.1|1956481_1956781_-	DUF2577 domain-containing protein	NA	A0A0A8WJ65	Clostridium_phage	34.7	5.2e-11
AYB00053.1|1956773_1957739_-	hydrolase	NA	H7BVH4	unidentified_phage	46.3	4.9e-79
AYB00054.1|1957735_1958407_-	LysM peptidoglycan-binding domain-containing protein	NA	X5J9Z8	Clostridium_phage	45.8	6.5e-38
AYB00055.1|1958406_1960374_-|tail	tail tape measure protein	tail	H7BWD9	unidentified_phage	43.6	1.2e-95
AYB00056.1|1960385_1960568_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00057.1|1960567_1960996_-|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	50.7	6.4e-31
AYB00058.1|1961011_1961488_-	hypothetical protein	NA	A0A0A8WJ62	Clostridium_phage	47.1	8.2e-35
AYB00059.1|1961501_1962812_-|tail	phage tail protein	tail	X5JAJ1	Clostridium_phage	50.8	9.6e-118
AYB00060.1|1962986_1963412_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00061.1|1963398_1963845_-	HK97 gp10 family phage protein	NA	A0A0A8WFV8	Clostridium_phage	43.6	4.2e-25
AYB00062.1|1963844_1964216_-	hypothetical protein	NA	X5JAV9	Clostridium_phage	47.9	1.2e-20
AYB00063.1|1964209_1964626_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00064.1|1964644_1965643_-|coat	coat protein	coat	A0A0A7RVZ1	Clostridium_phage	65.1	1.2e-112
AYB00065.1|1965661_1966279_-	hypothetical protein	NA	A0A0A7S0J5	Clostridium_phage	50.2	2.4e-50
AYB00066.1|1966575_1968237_-	hypothetical protein	NA	X5JAI9	Clostridium_phage	53.3	9.6e-107
AYB00067.1|1968223_1969669_-|portal	phage portal protein	portal	A0A0A7S0I9	Clostridium_phage	49.5	8.0e-134
AYB00068.1|1969680_1970964_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0S2MVC1	Bacillus_phage	61.9	1.3e-151
AYB00069.1|1970947_1971355_-	hypothetical protein	NA	A0A1S5SEB0	Streptococcus_phage	35.6	4.1e-11
AYB00070.1|1971410_1972037_-	DUF4417 domain-containing protein	NA	H7BVQ9	unidentified_phage	52.7	3.7e-59
AYB00071.1|1972039_1972462_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00072.1|1972651_1973356_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
AYB00073.1|1973348_1973762_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00074.1|1973906_1974158_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00075.1|1974157_1974412_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00076.1|1974422_1974743_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00077.1|1974732_1975032_-	hypothetical protein	NA	M4NJS1	Sulfitobacter_phage	44.7	1.1e-13
AYB00078.1|1975028_1975247_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00079.1|1975395_1975869_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00080.1|1975865_1977236_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	55.6	4.5e-142
AYB00081.1|1977216_1977498_-	VRR-NUC domain-containing protein	NA	A0A1W6JQA8	Corynebacterium_phage	51.1	2.3e-21
AYB00082.1|1977756_1980141_-	virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	44.1	2.5e-196
AYB00083.1|1980144_1982106_-	hypothetical protein	NA	H7BVQ1	unidentified_phage	54.4	4.2e-202
AYB00084.1|1982102_1982741_-	DUF2815 family protein	NA	W8CPL2	Croceibacter_phage	45.8	4.6e-33
AYB00085.1|1982733_1983894_-	DUF2800 domain-containing protein	NA	H7BVP9	unidentified_phage	44.7	5.2e-83
AYB00086.1|1983893_1984262_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00087.1|1984281_1984512_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00088.1|1984499_1984952_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00089.1|1984948_1985683_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AYB00090.1|1985683_1985953_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00091.1|1985963_1986188_-	triacylglycerol lipase	NA	NA	NA	NA	NA
AYB00092.1|1986285_1986510_+	hypothetical protein	NA	NA	NA	NA	NA
AYB00093.1|1986472_1986718_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00094.1|1986726_1987506_-	hypothetical protein	NA	A0A2H4JCR9	uncultured_Caudovirales_phage	59.0	9.5e-73
AYB00095.1|1987509_1987701_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB00096.1|1987828_1988032_+	hypothetical protein	NA	NA	NA	NA	NA
AYB00097.1|1988159_1988357_-	XRE family transcriptional regulator	NA	A0A1S5SDM7	Streptococcus_phage	44.3	3.2e-09
AYB00098.1|1988565_1988985_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB00099.1|1988981_1989398_+	ImmA/IrrE family metallo-endopeptidase	NA	S6B1N5	Thermus_phage	39.6	1.3e-12
AYB00100.1|1989579_1989930_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5S7K2	Streptococcus_phage	47.0	1.9e-17
AYB00101.1|1990086_1991064_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	54.6	2.3e-100
>prophage 6
CP032364	Lachnoanaerobaculum umeaense strain DSM 23576 = CCUG 58757 chromosome, complete genome	2810441	2102239	2153828	2810441	transposase,holin,tail,portal,head,integrase,protease,terminase,plate	Faecalibacterium_phage(41.38%)	73	2109997:2110019	2154329:2154351
AYB00188.1|2102239_2103994_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	27.6	2.2e-45
AYB00189.1|2104000_2104198_+	hypothetical protein	NA	NA	NA	NA	NA
AYB00190.1|2104274_2104673_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00840.1|2104736_2105897_-|holin	choline-binding protein A	holin	NA	NA	NA	NA
AYB00191.1|2106616_2108239_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AYB00192.1|2108253_2109639_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
2109997:2110019	attL	ATTATCTCTTTGAGAACTGTGGA	NA	NA	NA	NA
AYB00193.1|2110092_2110323_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB00194.1|2110537_2110798_+	hypothetical protein	NA	NA	NA	NA	NA
AYB00195.1|2110857_2111700_+	recombinase family protein	NA	A0A097BYD1	Leuconostoc_phage	38.6	1.1e-39
AYB00196.1|2111793_2112225_-|holin	holin	holin	A0A0N7GFE6	Paenibacillus_phage	41.1	1.5e-16
AYB00197.1|2112249_2113167_-	cell surface protein	NA	H7BVE5	unidentified_phage	41.4	6.4e-28
AYB00198.1|2113221_2113620_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1L2JY34	Aeribacillus_phage	41.7	3.5e-23
AYB00199.1|2113677_2113878_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	55.6	1.3e-13
AYB00200.1|2114097_2114475_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00201.1|2114485_2116087_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00202.1|2116088_2116868_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00203.1|2116871_2117438_-|tail	phage tail protein I	tail	A0A2K9V433	Faecalibacterium_phage	31.2	5.0e-15
AYB00204.1|2117415_2118552_-|plate	baseplate J/gp47 family protein	plate	A0A2K9V320	Faecalibacterium_phage	39.5	1.3e-70
AYB00205.1|2118544_2118844_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00206.1|2118843_2119242_-|tail	phage tail protein	tail	A0A2K9V465	Faecalibacterium_phage	31.9	1.1e-08
AYB00207.1|2119244_2119634_-	hypothetical protein	NA	A0A2K9V325	Faecalibacterium_phage	39.1	3.2e-13
AYB00208.1|2119630_2120893_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	42.4	3.6e-05
AYB00209.1|2120892_2121099_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYB00841.1|2121099_2124519_-|tail	phage tail tape measure protein	tail	Q0SPL2	Clostridium_phage	49.1	9.9e-74
AYB00210.1|2124684_2125020_-|tail	phage tail assembly protein	tail	A0A2K9V324	Faecalibacterium_phage	33.7	5.6e-06
AYB00211.1|2125100_2125616_-|tail	phage tail protein	tail	A0A2K9V323	Faecalibacterium_phage	40.7	3.1e-32
AYB00212.1|2125615_2127070_-|tail	phage tail sheath family protein	tail	A0A2K9V328	Faecalibacterium_phage	46.2	1.0e-128
AYB00213.1|2127056_2127419_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00214.1|2127418_2127886_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00215.1|2127882_2128521_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00216.1|2128520_2128850_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00217.1|2128849_2129137_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00218.1|2129138_2129468_-	DUF2190 family protein	NA	NA	NA	NA	NA
AYB00219.1|2129482_2130964_-	hypothetical protein	NA	A0A2K9V304	Faecalibacterium_phage	42.8	3.7e-118
AYB00220.1|2131121_2131703_-|head,protease	caudovirus prohead protease	head,protease	A0A2K9V308	Faecalibacterium_phage	55.1	4.5e-43
AYB00221.1|2131695_2133162_-|portal	phage portal protein	portal	A0A2K9V303	Faecalibacterium_phage	53.1	9.0e-149
AYB00222.1|2133164_2133395_-	peptidylprolyl isomerase	NA	A0A2K9V311	Faecalibacterium_phage	59.2	1.8e-11
AYB00223.1|2133385_2135209_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V301	Faecalibacterium_phage	51.6	6.1e-163
AYB00224.1|2135096_2135729_-	DNA-packaging protein	NA	NA	NA	NA	NA
AYB00225.1|2136103_2136502_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1L2JY34	Aeribacillus_phage	42.5	5.8e-26
AYB00226.1|2136562_2136745_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AYB00227.1|2136819_2137221_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00228.1|2137242_2137500_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00229.1|2137502_2138105_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00230.1|2138131_2138551_-	single-stranded DNA-binding protein	NA	A0A2H4J8K2	uncultured_Caudovirales_phage	68.3	2.6e-37
AYB00231.1|2138547_2139162_-	HNH endonuclease	NA	A0A1V0E8E4	Vibrio_phage	36.2	4.6e-22
AYB00842.1|2139158_2139404_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00232.1|2139473_2140469_-	site-specific recombinase	NA	A0A218KCA5	Bacillus_phage	37.0	6.3e-05
AYB00233.1|2140483_2141533_-	hypothetical protein	NA	A0A1W6JNC2	Staphylococcus_phage	24.4	4.6e-06
AYB00234.1|2141529_2142180_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00235.1|2142311_2142653_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00843.1|2142694_2143093_-	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	42.0	1.8e-19
AYB00236.1|2143169_2143679_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00237.1|2143591_2144389_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00238.1|2144542_2144839_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00239.1|2144814_2145198_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00240.1|2145194_2145389_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00241.1|2145426_2145621_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00242.1|2145645_2146578_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	46.8	6.2e-79
AYB00243.1|2146606_2146801_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00244.1|2146889_2147192_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00245.1|2147542_2147794_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00246.1|2147815_2148043_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00247.1|2148063_2148252_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00248.1|2148260_2148497_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB00249.1|2148661_2148994_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB00250.1|2149176_2149509_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB00251.1|2149669_2149894_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYB00252.1|2150050_2150773_+	helix-turn-helix domain-containing protein	NA	A0A139ZPI6	Marinitoga_camini_virus	29.5	2.1e-18
AYB00253.1|2150798_2151668_+	ATP-binding protein	NA	NA	NA	NA	NA
AYB00254.1|2151667_2152039_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
AYB00255.1|2152028_2152613_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AYB00256.1|2152781_2153828_+|integrase	site-specific integrase	integrase	H7BVE3	unidentified_phage	61.4	1.6e-131
2154329:2154351	attR	ATTATCTCTTTGAGAACTGTGGA	NA	NA	NA	NA
>prophage 7
CP032364	Lachnoanaerobaculum umeaense strain DSM 23576 = CCUG 58757 chromosome, complete genome	2810441	2508429	2574203	2810441	transposase,protease,tRNA	Planktothrix_phage(23.08%)	58	NA	NA
AYB00537.1|2508429_2509818_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AYB00538.1|2510134_2511010_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AYB00539.1|2511223_2511820_-	hypothetical protein	NA	A0A0H3UZG2	Geobacillus_virus	40.2	1.2e-06
AYB00540.1|2512078_2512591_-	protein-disulfide isomerase	NA	NA	NA	NA	NA
AYB00541.1|2512727_2513108_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
AYB00542.1|2513379_2513961_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00543.1|2514015_2515254_-	AI-2E family transporter	NA	NA	NA	NA	NA
AYB00544.1|2515255_2516554_-	M18 family aminopeptidase	NA	NA	NA	NA	NA
AYB00545.1|2516574_2517171_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AYB00546.1|2517215_2519510_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	41.2	4.7e-160
AYB00547.1|2519565_2520849_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.7	2.7e-133
AYB00548.1|2520858_2521440_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.6	2.5e-54
AYB00549.1|2521520_2522807_-	trigger factor	NA	NA	NA	NA	NA
AYB00550.1|2522933_2523443_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00551.1|2523671_2525060_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AYB00552.1|2525300_2525774_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
AYB00553.1|2527520_2528372_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
AYB00554.1|2528368_2529379_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYB00555.1|2529372_2530323_-	ABC transporter permease	NA	NA	NA	NA	NA
AYB00556.1|2530325_2531837_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	7.6e-18
AYB00557.1|2531836_2532865_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYB00558.1|2532874_2533684_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
AYB00559.1|2533696_2534878_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AYB00560.1|2535236_2535719_-	nucleoside deaminase	NA	NA	NA	NA	NA
AYB00561.1|2535735_2536788_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYB00562.1|2536819_2537749_-	ABC transporter permease	NA	NA	NA	NA	NA
AYB00563.1|2537745_2538813_-	ABC transporter permease	NA	NA	NA	NA	NA
AYB00564.1|2538805_2540335_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.9	3.5e-10
AYB00565.1|2540406_2541216_-	response regulator	NA	NA	NA	NA	NA
AYB00566.1|2541306_2542794_-	histidine kinase	NA	NA	NA	NA	NA
AYB00858.1|2542963_2544028_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYB00567.1|2544050_2545643_-	ATPase	NA	NA	NA	NA	NA
AYB00568.1|2545652_2546345_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
AYB00569.1|2546355_2547786_-	L-arabinose isomerase	NA	NA	NA	NA	NA
AYB00570.1|2548721_2549558_+	PRD domain-containing protein	NA	NA	NA	NA	NA
AYB00571.1|2549561_2550038_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AYB00572.1|2550098_2551541_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
AYB00573.1|2551580_2552915_-	NADH oxidase	NA	NA	NA	NA	NA
AYB00574.1|2553078_2553735_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00575.1|2553739_2554288_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	L7TIP4	Escherichia_phage	47.8	7.0e-38
AYB00576.1|2554287_2555316_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0G2SSM2	Proteus_phage	35.8	9.7e-49
AYB00577.1|2555573_2556800_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	35.5	3.3e-64
AYB00578.1|2556879_2559048_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2H5BH09	Vibrio_virus	37.8	4.9e-127
AYB00579.1|2559473_2560433_+	ABC transporter permease	NA	NA	NA	NA	NA
AYB00580.1|2560422_2561217_+	ABC transporter permease	NA	NA	NA	NA	NA
AYB00581.1|2561247_2562819_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYB00582.1|2562818_2563583_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	8.3e-21
AYB00583.1|2563596_2564349_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	5.5e-17
AYB00584.1|2564430_2566188_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
AYB00585.1|2566565_2567015_+	DUF3290 domain-containing protein	NA	NA	NA	NA	NA
AYB00586.1|2567018_2567654_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYB00587.1|2567774_2568572_-	hypothetical protein	NA	NA	NA	NA	NA
AYB00588.1|2568665_2569517_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYB00589.1|2569541_2570315_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.1	6.0e-35
AYB00590.1|2570334_2571006_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYB00591.1|2570986_2571646_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYB00592.1|2572163_2573027_-|transposase	transposase	transposase	NA	NA	NA	NA
AYB00593.1|2573321_2574203_-|transposase	transposase	transposase	NA	NA	NA	NA
