The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024908	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L chromosome, complete genome	4753669	599299	672617	4753669	tRNA,portal,tail,plate,capsid,transposase,terminase,head,lysis,integrase	Salmonella_phage(49.41%)	94	588582:588612	678309:678339
588582:588612	attL	TGTAGGCCGGGTAAGCGCAGCGCCACCCGGC	NA	NA	NA	NA
AWR71196.1|599299_600506_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	2.6e-101
AWR67373.1|600669_601017_+	hypothetical protein	NA	NA	NA	NA	NA
AWR67374.1|601019_602021_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	1.0e-191
AWR67375.1|602020_602596_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.7	3.1e-60
AWR67376.1|602725_602989_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
AWR67377.1|603019_603529_+	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	96.4	2.0e-87
AWR67378.1|603536_603737_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	3.3e-30
AWR67379.1|603700_604039_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
AWR67380.1|604106_604334_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	96.0	5.8e-31
AWR67381.1|604333_604555_+	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	91.8	1.0e-32
AWR67382.1|604556_606773_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.8	0.0e+00
AWR67383.1|606891_607332_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	96.4	1.0e-68
AWR67384.1|607414_608146_+	hypothetical protein	NA	Q37850	Escherichia_phage	95.1	2.1e-130
AWR67385.1|608142_608334_-	hypothetical protein	NA	A0A0M4R4Y4	Salmonella_phage	83.3	3.8e-07
AWR67386.1|608319_608502_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71197.1|608679_609684_-	hypothetical protein	NA	NA	NA	NA	NA
AWR67387.1|609761_610808_-|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	95.1	1.2e-190
AWR67388.1|610809_612579_-	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	99.5	0.0e+00
AWR67389.1|612744_613599_+|capsid	capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	98.2	1.8e-157
AWR67390.1|613674_614742_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	97.7	2.3e-194
AWR67391.1|614746_615496_+|terminase	terminase	terminase	A0A218M4L0	Erwinia_phage	96.0	1.1e-113
AWR67392.1|615589_616099_+|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	98.2	4.3e-90
AWR67393.1|616098_616302_+|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	95.5	2.6e-30
AWR67394.1|616292_616514_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	98.6	8.4e-35
AWR67395.1|616497_617010_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	97.6	7.8e-92
AWR67396.1|617006_617438_+	lysA protein	NA	A0A218M4L6	Erwinia_phage	86.0	1.8e-65
AWR67397.1|617437_617848_+	protein lysB	NA	A0A218M4K2	Erwinia_phage	93.4	4.2e-64
AWR67398.1|617819_617993_+|lysis	phage lysis protein	lysis	O80311	Escherichia_phage	96.5	1.8e-24
AWR67399.1|617955_618423_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	100.0	1.4e-84
AWR67400.1|618415_618865_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	96.6	8.7e-71
AWR67401.1|618933_619569_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	98.1	7.2e-111
AWR67402.1|619565_619913_+|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	97.4	8.0e-56
AWR67403.1|619919_620828_+|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	85.4	1.0e-139
AWR67404.1|620820_621351_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.4	1.3e-89
AWR67405.1|621362_623393_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.0	1.5e-90
AWR67406.1|623404_623809_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	44.0	2.6e-21
AWR67407.1|623932_625120_+|tail	phage tail protein	tail	Q37844	Escherichia_phage	96.5	1.0e-214
AWR67408.1|625135_625654_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	6.5e-94
AWR67409.1|625716_626052_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	98.2	5.2e-52
AWR67410.1|626066_626204_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	97.8	1.2e-18
AWR67411.1|626196_628638_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	94.6	0.0e+00
AWR67412.1|628650_629136_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	95.7	4.1e-82
AWR67413.1|629132_630302_+	hypothetical protein	NA	A0A218M4J7	Erwinia_phage	97.2	1.2e-207
AWR67414.1|630368_630587_+	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	100.0	4.3e-39
AWR67415.1|630830_631916_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	60.5	2.6e-121
AWR67416.1|631938_632553_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	39.0	1.4e-34
AWR67417.1|632653_632890_+	regulator	NA	NA	NA	NA	NA
AWR67418.1|632924_633434_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	86.4	7.6e-79
AWR67419.1|633441_633666_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	73.0	1.8e-24
AWR67420.1|633655_633856_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	70.8	4.3e-22
AWR67421.1|633925_634159_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	68.8	2.3e-19
AWR67422.1|634158_634386_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	80.0	5.4e-29
AWR67423.1|634382_635255_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.3	1.1e-106
AWR67424.1|638533_639229_+	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	75.0	7.9e-95
AWR67425.1|639389_639578_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.0	3.7e-23
AWR67426.1|639588_639822_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	88.3	5.4e-32
AWR67427.1|640108_640327_+	multidrug ABC transporter ATPase	NA	NA	NA	NA	NA
AWR67428.1|640326_641169_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	47.7	2.9e-59
AWR67429.1|641178_641412_+	hypothetical protein	NA	NA	NA	NA	NA
AWR67430.1|641381_643127_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AWR67431.1|643163_644225_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	81.8	4.5e-158
AWR67432.1|644224_645988_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	87.7	3.2e-312
AWR67433.1|646137_646965_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	67.4	4.1e-74
AWR67434.1|646980_648129_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	67.0	1.9e-130
AWR67435.1|648132_648786_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	56.1	3.0e-56
AWR67436.1|648884_649352_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
AWR67437.1|649351_649555_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AWR67438.1|649558_649774_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
AWR67439.1|649754_650270_+	lysozyme	NA	E5G6N1	Salmonella_phage	75.9	2.4e-72
AWR67440.1|650266_650695_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	84.3	1.2e-56
AWR67441.1|650624_650828_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	91.0	1.8e-28
AWR67442.1|650790_651222_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	3.5e-69
AWR67443.1|651214_651661_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	78.4	1.7e-58
AWR67444.1|651729_652308_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.4	2.0e-104
AWR67445.1|652304_652664_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.8	2.3e-53
AWR67446.1|652650_653559_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	92.4	8.0e-148
AWR67447.1|653551_654157_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	93.5	1.8e-111
AWR67448.1|655640_656114_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	59.6	6.6e-53
AWR67449.1|656915_657251_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	65.8	1.9e-06
AWR67450.1|657376_657964_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	85.8	1.1e-84
AWR67451.1|658022_658775_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	50.6	1.5e-62
AWR67452.1|658855_660028_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	9.5e-210
AWR67453.1|660037_660553_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
AWR67454.1|660607_660910_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	3.1e-40
AWR67455.1|660924_661044_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
AWR67456.1|661036_664480_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.4	0.0e+00
AWR67457.1|664479_664965_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	90.1	3.0e-69
AWR67458.1|664961_666062_+	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	91.8	7.1e-183
AWR67459.1|666131_666350_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.6e-25
AWR67460.1|666686_667193_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AWR67461.1|667293_669138_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AWR67462.1|669290_671036_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
AWR67463.1|671151_671367_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWR67464.1|671603_672617_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	6.3e-109
678309:678339	attR	TGTAGGCCGGGTAAGCGCAGCGCCACCCGGC	NA	NA	NA	NA
>prophage 2
CP024908	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L chromosome, complete genome	4753669	1029817	1130012	4753669	tRNA,portal,holin,tail,plate,capsid,terminase,head,protease,integrase	Escherichia_phage(20.59%)	114	1097600:1097615	1126332:1126347
AWR67796.1|1029817_1032445_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	1.7e-81
AWR67797.1|1032686_1032872_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AWR67798.1|1034062_1034629_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AWR67799.1|1034625_1035054_+	DedA family protein	NA	NA	NA	NA	NA
AWR67800.1|1035137_1036682_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AWR67801.1|1036834_1037350_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AWR71205.1|1037403_1038168_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWR67802.1|1038154_1039810_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
AWR67803.1|1039976_1041524_-	multidrug efflux MFS transporter subunit EmrB	NA	NA	NA	NA	NA
AWR67804.1|1041540_1042713_-	multidrug export protein EmrA	NA	NA	NA	NA	NA
AWR67805.1|1042843_1043374_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
AWR67806.1|1043688_1044873_-	MFS transporter	NA	NA	NA	NA	NA
AWR67807.1|1045063_1046059_-	proline/glycine betaine ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
AWR67808.1|1046068_1047133_-	proline/glycine betaine ABC transporter permease ProW	NA	NA	NA	NA	NA
AWR67809.1|1047125_1048328_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.3	3.2e-27
AWR67810.1|1048661_1049621_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.1	5.7e-136
AWR67811.1|1049630_1051775_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.8	7.8e-202
AWR67812.1|1051747_1052158_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.3	3.0e-17
AWR67813.1|1052154_1052394_-	NrdH-redoxin	NA	A0A0M7REK7	Lactobacillus_phage	43.2	9.8e-13
AWR67814.1|1052637_1052964_-	hypothetical protein	NA	NA	NA	NA	NA
AWR67815.1|1053122_1053467_+	hypothetical protein	NA	NA	NA	NA	NA
AWR67816.1|1053499_1053949_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
AWR67817.1|1054445_1054850_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
AWR67818.1|1054887_1055067_-	hypothetical protein	NA	NA	NA	NA	NA
AWR67819.1|1055149_1055668_-	hypothetical protein	NA	NA	NA	NA	NA
AWR67820.1|1055847_1056006_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AWR67821.1|1056002_1056932_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWR67822.1|1057252_1057858_+	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	25.2	1.6e-06
AWR67823.1|1057966_1059508_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AWR71206.1|1059504_1060923_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AWR67824.1|1060934_1062515_+	xanthine permease	NA	NA	NA	NA	NA
AWR67825.1|1062511_1063468_+	carbamate kinase	NA	NA	NA	NA	NA
AWR67826.1|1063469_1064849_+	deaminase	NA	NA	NA	NA	NA
AWR67827.1|1066512_1067361_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.5	6.4e-139
AWR67828.1|1067370_1068582_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	85.7	5.8e-194
AWR67829.1|1068625_1068952_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	6.1e-50
AWR67830.1|1068948_1069293_+|head,tail	head-tail adaptor protein	head,tail	Q7Y406	Yersinia_phage	57.3	1.1e-25
AWR67831.1|1069273_1069657_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	57.5	2.8e-41
AWR67832.1|1069659_1070064_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	72.7	9.7e-45
AWR67833.1|1070096_1070549_+|tail	phage tail protein	tail	Q7Y403	Yersinia_phage	76.7	9.1e-60
AWR67834.1|1070612_1070975_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	55.2	1.1e-26
AWR71207.1|1070995_1071214_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	59.7	2.0e-20
AWR67835.1|1071213_1074543_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	66.5	0.0e+00
AWR67836.1|1074545_1074884_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	77.7	9.2e-49
AWR67837.1|1074880_1075636_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	92.4	1.0e-135
AWR67838.1|1075637_1076348_+	peptidase P60	NA	K7PJV6	Enterobacteria_phage	96.2	1.5e-141
AWR67839.1|1076376_1076724_+	hypothetical protein	NA	NA	NA	NA	NA
AWR67840.1|1076750_1077341_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	85.2	3.8e-90
AWR67841.1|1077395_1081193_+	DUF1983 domain-containing protein	NA	K7PHL5	Enterobacterial_phage	83.5	0.0e+00
AWR67842.1|1081236_1081551_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	71.6	6.4e-36
AWR67843.1|1081551_1082223_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	70.9	1.1e-85
AWR67844.1|1082330_1082564_+	cor protein	NA	E4WL42	Enterobacteria_phage	75.3	2.5e-29
AWR67845.1|1082621_1083749_+	hypothetical protein	NA	A0A2I6PID3	Escherichia_phage	37.3	2.1e-52
AWR67846.1|1084002_1084356_-	hypothetical protein	NA	NA	NA	NA	NA
AWR67847.1|1085119_1085542_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	47.2	1.8e-25
AWR67848.1|1085628_1085868_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	89.9	2.2e-33
AWR67849.1|1086591_1087074_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
AWR67850.1|1087191_1087668_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWR67851.1|1087657_1087945_+	RnfH family protein	NA	NA	NA	NA	NA
AWR67852.1|1088006_1088345_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWR67853.1|1088326_1088509_-	hypothetical protein	NA	NA	NA	NA	NA
AWR67854.1|1088483_1090145_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AWR67855.1|1090230_1091109_-	NAD(+) kinase	NA	NA	NA	NA	NA
AWR67856.1|1091207_1091825_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWR67857.1|1091877_1093164_-	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AWR71208.1|1093183_1093975_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWR67858.1|1094141_1095503_+	signal recognition particle protein	NA	NA	NA	NA	NA
AWR67859.1|1095619_1095868_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWR67860.1|1095883_1096423_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWR67861.1|1096454_1097222_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWR67862.1|1097265_1097613_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
1097600:1097615	attL	AGCGTCTGAACTAAGA	NA	NA	NA	NA
AWR67863.1|1097772_1097991_-	transcriptional regulator	NA	Q37973	Salmonella_virus	80.6	2.1e-30
AWR67864.1|1098068_1099214_-	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	78.6	3.8e-155
AWR67865.1|1099213_1099693_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	84.3	2.6e-73
AWR67866.1|1099708_1102252_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	70.2	1.2e-217
AWR67867.1|1102244_1102364_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	6.7e-15
AWR67868.1|1102396_1102672_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	83.5	2.8e-35
AWR67869.1|1102733_1103252_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	90.7	4.5e-87
AWR67870.1|1103265_1104456_-|tail	phage tail protein	tail	Q7Y4D1	Escherichia_virus	89.9	4.5e-207
AWR67871.1|1104580_1104985_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	51.1	2.6e-29
AWR67872.1|1104996_1107183_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.5	4.8e-90
AWR67873.1|1107194_1107725_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	85.8	2.6e-90
AWR67874.1|1107717_1108626_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	81.1	1.1e-133
AWR67875.1|1108629_1108977_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	74.8	3.8e-42
AWR67876.1|1108973_1109615_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	80.3	8.9e-93
AWR67877.1|1109683_1110133_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	1.8e-47
AWR67878.1|1110125_1110593_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	85.8	2.2e-72
AWR71209.1|1110555_1110798_-|holin	holin	holin	S4TNY4	Salmonella_phage	69.6	1.7e-25
AWR67879.1|1110700_1111114_-	protein lysB	NA	A0A0F7LDJ6	Escherichia_phage	68.6	7.1e-43
AWR67880.1|1111110_1111608_-	lysozyme	NA	O80309	Escherichia_phage	91.4	2.4e-85
AWR67881.1|1111594_1111891_-|holin	holin	holin	O80308	Escherichia_phage	88.8	2.3e-40
AWR67882.1|1111895_1112099_-|tail	phage tail protein	tail	Q858W3	Yersinia_virus	82.1	1.6e-24
AWR67883.1|1112098_1112599_-|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	67.4	1.8e-56
AWR67884.1|1112698_1113460_-|terminase	terminase	terminase	A0A218M4L0	Erwinia_phage	66.8	7.3e-78
AWR67885.1|1113463_1114537_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	79.3	1.6e-158
AWR67886.1|1114597_1115452_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	70.1	3.4e-108
AWR67887.1|1115617_1117387_+	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	85.9	6.5e-303
AWR67888.1|1117388_1118411_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.6	6.0e-168
AWR67889.1|1119110_1119344_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	1.8e-35
AWR67890.1|1119347_1119530_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	70.7	6.5e-17
AWR67891.1|1119745_1119973_+	hypothetical protein	NA	NA	NA	NA	NA
AWR67892.1|1119991_1122385_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	85.8	0.0e+00
AWR67893.1|1122362_1122644_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	69.9	1.5e-28
AWR67894.1|1122644_1122872_-	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	61.3	2.6e-15
AWR67895.1|1122937_1123276_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	75.9	2.4e-41
AWR67896.1|1123239_1123440_-	DUF2724 domain-containing protein	NA	A0A218M4I1	Erwinia_phage	75.8	5.7e-22
AWR67897.1|1123447_1123957_-	hypothetical protein	NA	Q6K1F8	Salmonella_virus	85.8	1.9e-77
AWR67898.1|1123988_1124219_-	hypothetical protein	NA	NA	NA	NA	NA
AWR67899.1|1124338_1125199_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	43.8	3.5e-68
AWR67900.1|1125201_1126233_+|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	79.8	1.4e-164
AWR67901.1|1126477_1126882_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
1126332:1126347	attR	AGCGTCTGAACTAAGA	NA	NA	NA	NA
AWR67902.1|1126920_1128291_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AWR67903.1|1128293_1128779_-	hypothetical protein	NA	NA	NA	NA	NA
AWR67904.1|1128791_1130012_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
>prophage 3
CP024908	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L chromosome, complete genome	4753669	1614165	1623015	4753669		Enterobacteria_phage(28.57%)	7	NA	NA
AWR68319.1|1614165_1615230_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
AWR68320.1|1615245_1616112_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.3	2.8e-110
AWR68321.1|1616124_1617015_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	31.3	4.8e-28
AWR68322.1|1617025_1617574_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	9.1e-54
AWR68323.1|1617709_1619116_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
AWR68324.1|1619369_1620536_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	1.2e-111
AWR68325.1|1622010_1623015_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	3.3e-33
>prophage 4
CP024908	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L chromosome, complete genome	4753669	1724037	1744155	4753669	holin,integrase	Pectobacterium_phage(33.33%)	25	1718427:1718442	1753296:1753311
1718427:1718442	attL	TCGATCCTGAGCTGGT	NA	NA	NA	NA
AWR68415.1|1724037_1725054_-|integrase	integrase	integrase	H9C152	Pectobacterium_phage	64.0	2.8e-125
AWR68416.1|1725037_1725286_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	39.5	6.4e-07
AWR68417.1|1725221_1725446_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	56.3	1.7e-11
AWR68418.1|1725496_1725679_-	hypothetical protein	NA	NA	NA	NA	NA
AWR68419.1|1725681_1726242_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	56.3	2.9e-47
AWR71220.1|1726238_1728431_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.9	6.5e-103
AWR68420.1|1728481_1728805_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71221.1|1729356_1729770_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	61.9	2.0e-37
AWR68421.1|1729838_1730033_+	hypothetical protein	NA	NA	NA	NA	NA
AWR68422.1|1731259_1732018_+	hypothetical protein	NA	NA	NA	NA	NA
AWR68423.1|1732017_1732428_+	hypothetical protein	NA	NA	NA	NA	NA
AWR68424.1|1732488_1732830_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	51.8	3.7e-21
AWR68425.1|1732826_1734437_+	transcriptional regulator	NA	A0A2H4JCA3	uncultured_Caudovirales_phage	70.3	8.4e-225
AWR68426.1|1734457_1736704_+	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	46.0	3.8e-66
AWR68427.1|1736733_1738215_-	hypothetical protein	NA	NA	NA	NA	NA
AWR68428.1|1738211_1739153_-	glycosyltransferase	NA	U5P087	Shigella_phage	91.7	5.5e-160
AWR68429.1|1739149_1739512_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	75.0	3.5e-46
AWR68430.1|1739661_1739892_+|holin	holin	holin	A5LH82	Enterobacteria_phage	71.0	2.9e-22
AWR68431.1|1739872_1740412_+	lysozyme	NA	H6WRZ4	Salmonella_phage	89.3	2.2e-92
AWR68432.1|1740408_1740768_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	45.5	2.4e-15
AWR68433.1|1741339_1741441_+	DNA invertase	NA	NA	NA	NA	NA
AWR68434.1|1741519_1741843_+	hypothetical protein	NA	NA	NA	NA	NA
AWR68435.1|1741872_1742799_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWR68436.1|1742804_1743275_-	hypothetical protein	NA	NA	NA	NA	NA
AWR68437.1|1743438_1744155_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	1.0e-12
1753296:1753311	attR	TCGATCCTGAGCTGGT	NA	NA	NA	NA
>prophage 5
CP024908	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L chromosome, complete genome	4753669	1791630	1842642	4753669	tRNA,portal,holin,tail,capsid,terminase,head,protease,integrase	Enterobacteria_phage(22.92%)	64	1789052:1789071	1827485:1827504
1789052:1789071	attL	AGCCCGTTAATGGGCTTTTT	NA	NA	NA	NA
AWR68481.1|1791630_1793364_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	37.0	8.8e-87
AWR68482.1|1793602_1794163_+	VOC family protein	NA	NA	NA	NA	NA
AWR68483.1|1794241_1794985_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWR68484.1|1794965_1795349_+	hypothetical protein	NA	NA	NA	NA	NA
AWR68485.1|1795245_1796217_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AWR68486.1|1796213_1796957_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
AWR68487.1|1796997_1797393_-	hypothetical protein	NA	NA	NA	NA	NA
AWR68488.1|1797444_1798218_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	8.6e-58
AWR68489.1|1798196_1799510_-|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	86.0	2.7e-221
AWR68490.1|1799565_1799802_-	excisionase	NA	Q8W657	Enterobacteria_phage	85.9	8.1e-36
AWR68491.1|1799844_1800672_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.4	5.5e-111
AWR68492.1|1800668_1800863_-	hypothetical protein	NA	NA	NA	NA	NA
AWR68493.1|1800862_1801270_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	48.5	6.1e-23
AWR68494.1|1801266_1801488_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	66.7	1.4e-18
AWR71223.1|1801487_1801844_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	88.3	1.1e-47
AWR68495.1|1801824_1802028_-	hypothetical protein	NA	NA	NA	NA	NA
AWR68496.1|1802164_1802824_-	AP2 domain-containing protein	NA	L0AQZ0	Klebsiella_phage	44.0	2.4e-45
AWR68497.1|1803314_1803527_-	hypothetical protein	NA	NA	NA	NA	NA
AWR68498.1|1803717_1804407_-	phage repressor protein	NA	K7PK07	Enterobacteria_phage	64.8	4.6e-71
AWR68499.1|1804518_1804746_+	transcriptional regulator	NA	NA	NA	NA	NA
AWR68500.1|1804771_1805068_+	transcriptional regulator	NA	NA	NA	NA	NA
AWR68501.1|1805064_1805976_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	60.2	1.1e-91
AWR68502.1|1805991_1806873_+	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	62.0	2.0e-79
AWR68503.1|1806869_1808249_+	helicase	NA	Q8W640	Enterobacteria_phage	67.5	3.2e-172
AWR68504.1|1808276_1809059_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.4	1.3e-109
AWR68505.1|1809257_1809839_+	endonuclease	NA	A0A2I7RSG2	Vibrio_phage	43.2	7.2e-25
AWR68506.1|1809885_1810113_-	hypothetical protein	NA	NA	NA	NA	NA
AWR68507.1|1810618_1811008_+	hypothetical protein	NA	G8C7V8	Escherichia_phage	99.2	8.9e-64
AWR68508.1|1810997_1811276_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	97.8	4.7e-43
AWR68509.1|1811275_1811818_+	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	74.3	6.2e-79
AWR68510.1|1811814_1812090_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	80.2	1.0e-29
AWR68511.1|1812040_1812220_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	80.0	4.0e-19
AWR71224.1|1812286_1812544_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	52.7	5.1e-15
AWR68512.1|1812782_1813247_-|protease	retroviral-like aspartic protease	protease	NA	NA	NA	NA
AWR68513.1|1813507_1814305_+	DUF1983 domain-containing protein	NA	S4TNN5	Salmonella_phage	52.8	3.5e-54
AWR68514.1|1814307_1814541_+	hypothetical protein	NA	NA	NA	NA	NA
AWR68515.1|1814581_1816039_+	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	93.2	7.3e-276
AWR68516.1|1815998_1816676_+	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	37.0	1.7e-14
AWR71225.1|1817242_1817611_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	86.9	1.9e-55
AWR68517.1|1817718_1818213_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
AWR68518.1|1818209_1819871_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	98.7	0.0e+00
AWR68519.1|1819929_1821864_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	98.3	0.0e+00
AWR68520.1|1821900_1822068_+	hypothetical protein	NA	S4TR49	Salmonella_phage	89.1	4.0e-21
AWR68521.1|1822067_1823426_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	93.1	8.6e-247
AWR68522.1|1823422_1824466_+|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	83.9	1.2e-102
AWR68523.1|1824462_1824789_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	89.8	5.8e-48
AWR68524.1|1824797_1825148_+|head,tail	head-tail adaptor protein	head,tail	S4TND9	Salmonella_phage	90.5	1.7e-53
AWR68525.1|1825144_1825594_+	hypothetical protein	NA	K7P6X4	Enterobacteria_phage	98.7	2.2e-74
AWR68526.1|1825590_1825938_+	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	96.5	5.5e-57
AWR68527.1|1825997_1826441_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	94.5	1.6e-72
AWR68528.1|1826449_1826833_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	92.9	1.3e-62
AWR68529.1|1826841_1827120_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	8.1e-43
AWR71226.1|1827171_1827465_+	hypothetical protein	NA	NA	NA	NA	NA
AWR68530.1|1827523_1830826_+|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	81.6	0.0e+00
1827485:1827504	attR	AGCCCGTTAATGGGCTTTTT	NA	NA	NA	NA
AWR68531.1|1830828_1831167_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
AWR68532.1|1831163_1831922_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.2	2.5e-94
AWR68533.1|1831924_1832635_+	peptidase P60	NA	F1C573	Cronobacter_phage	70.2	1.3e-97
AWR68534.1|1832634_1833222_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	4.7e-48
AWR68535.1|1833274_1837114_+	host specificity protein	NA	Q9MCR7	Enterobacteria_phage	61.5	0.0e+00
AWR68536.1|1837115_1838081_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.2	8.2e-58
AWR71227.1|1838700_1839279_+	hypothetical protein	NA	A0A2I6PD03	Escherichia_phage	54.4	9.3e-33
AWR68537.1|1839409_1839676_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	94.3	1.4e-39
AWR68538.1|1840040_1840607_-	hydrolase	NA	NA	NA	NA	NA
AWR68539.1|1840869_1842642_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
CP024908	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L chromosome, complete genome	4753669	2058506	2113477	4753669	portal,holin,tail,plate,capsid,transposase,terminase,head,protease,integrase	Escherichia_phage(23.08%)	63	2057208:2057222	2100798:2100812
2057208:2057222	attL	ACTTTCGTCATTTTC	NA	NA	NA	NA
AWR68725.1|2058506_2059517_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	76.7	2.1e-149
AWR68726.1|2059613_2059910_-	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	70.1	9.6e-34
AWR68727.1|2060045_2060321_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	82.2	3.7e-40
AWR68728.1|2060487_2060988_+	replication protein B	NA	M1SV55	Escherichia_phage	75.3	4.8e-70
AWR68729.1|2061054_2061273_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	62.1	2.2e-11
AWR68730.1|2061295_2061559_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	60.5	6.7e-23
AWR68731.1|2061560_2063858_+	replication endonuclease	NA	Q858T4	Yersinia_virus	74.9	0.0e+00
AWR71235.1|2063990_2064218_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	60.0	9.3e-13
AWR68732.1|2064744_2065865_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AWR68733.1|2065877_2066066_+	hypothetical protein	NA	NA	NA	NA	NA
AWR68734.1|2066337_2066658_+	hypothetical protein	NA	NA	NA	NA	NA
AWR68735.1|2066659_2067253_+	hypothetical protein	NA	NA	NA	NA	NA
AWR68736.1|2067504_2069163_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
AWR68737.1|2069192_2070218_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.6	7.1e-169
AWR68738.1|2070219_2071989_-	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	85.7	1.9e-302
AWR68739.1|2072155_2073010_+|capsid	capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	73.6	1.4e-117
AWR68740.1|2073065_2074160_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	81.1	7.9e-166
AWR68741.1|2074163_2074919_+|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	68.5	1.2e-80
AWR68742.1|2075018_2075525_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	71.4	8.3e-62
AWR68743.1|2075524_2075728_+|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	80.6	1.1e-25
AWR68744.1|2075718_2075940_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	75.3	1.4e-26
AWR68745.1|2075923_2076433_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	86.3	4.9e-78
AWR68746.1|2076429_2076855_+	protein lysB	NA	O80310	Escherichia_phage	68.6	3.0e-44
AWR68747.1|2076742_2076988_+|holin	holin	holin	S4TNY4	Salmonella_phage	77.8	1.0e-28
AWR68748.1|2076950_2077418_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	72.3	1.3e-61
AWR68749.1|2077410_2077869_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	63.8	1.1e-44
AWR68750.1|2077961_2079485_-	ATP-binding protein	NA	NA	NA	NA	NA
AWR68751.1|2079766_2080408_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	82.6	1.3e-96
AWR68752.1|2080404_2080755_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	70.7	6.9e-39
AWR68753.1|2080760_2081669_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	83.1	1.7e-137
AWR68754.1|2081661_2082192_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	5.3e-91
AWR68755.1|2082203_2084036_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.0	2.2e-91
AWR68756.1|2084038_2084554_+|tail	tail assembly chaperone	tail	F1BUK2	Cronobacter_phage	38.3	7.5e-18
AWR68757.1|2084928_2086122_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	1.4e-184
AWR68758.1|2086134_2086653_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	82.0	5.9e-79
AWR68759.1|2086709_2087003_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	72.4	1.7e-27
AWR68760.1|2087035_2087158_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	92.3	2.0e-14
AWR68761.1|2087147_2089595_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	57.8	8.9e-218
AWR68762.1|2089608_2090073_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	74.8	1.4e-60
AWR68763.1|2090069_2091239_+	hypothetical protein	NA	Q6K1G4	Salmonella_virus	74.6	8.1e-161
AWR68764.1|2091315_2091537_+	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.9	3.5e-25
AWR68765.1|2091718_2092657_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AWR68766.1|2092820_2093117_-	hypothetical protein	NA	NA	NA	NA	NA
AWR68767.1|2093338_2094067_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
AWR68768.1|2094105_2094501_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
AWR68769.1|2094599_2096786_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AWR68770.1|2096966_2097506_-	septation protein A	NA	NA	NA	NA	NA
AWR68771.1|2097519_2098263_-	UPF0259 family protein	NA	NA	NA	NA	NA
AWR68772.1|2098288_2098693_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AWR68773.1|2098975_2099608_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
AWR68774.1|2099894_2100128_-	SirA-like protein	NA	NA	NA	NA	NA
AWR68775.1|2100124_2101336_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
2100798:2100812	attR	ACTTTCGTCATTTTC	NA	NA	NA	NA
AWR68776.1|2101510_2102320_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AWR68777.1|2102319_2103513_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AWR68778.1|2103523_2104882_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.0	5.0e-37
AWR68779.1|2104885_2106481_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.3	1.2e-50
AWR68780.1|2106480_2108043_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
AWR68781.1|2108321_2109203_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
AWR68782.1|2109199_2109820_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AWR68783.1|2109917_2110793_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
AWR68784.1|2110829_2111420_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AWR68785.1|2111416_2112178_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
AWR68786.1|2112430_2113477_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.2	1.3e-19
>prophage 7
CP024908	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L chromosome, complete genome	4753669	2489790	2496798	4753669	integrase	Escherichia_phage(100.0%)	8	NA	NA
AWR69113.1|2489790_2490507_-	HNH endonuclease	NA	A0A1I9SEA5	Escherichia_phage	46.5	1.0e-33
AWR69114.1|2490675_2492040_-|integrase	integrase	integrase	NA	NA	NA	NA
AWR69115.1|2492271_2493381_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	47.3	2.5e-87
AWR69116.1|2493391_2494009_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.1	1.0e-74
AWR69117.1|2494010_2494865_+	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	34.6	7.6e-23
AWR69118.1|2494909_2495524_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.7	8.7e-29
AWR69119.1|2495633_2495945_+	DNA damage-inducible SOS regulon protein	NA	NA	NA	NA	NA
AWR69120.1|2496120_2496798_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.1	5.5e-77
>prophage 8
CP024908	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L chromosome, complete genome	4753669	2673409	2714825	4753669	transposase,tail,tRNA,integrase	Escherichia_phage(29.73%)	51	2675300:2675319	2710064:2710083
AWR69279.1|2673409_2673874_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	36.7	2.3e-13
AWR69280.1|2673946_2674702_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	26.2	1.7e-10
AWR69281.1|2674701_2675253_-	glutathione peroxidase	NA	NA	NA	NA	NA
2675300:2675319	attL	TTTAATAGTAGCCAGATAAA	NA	NA	NA	NA
AWR69282.1|2675636_2676308_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.0	2.4e-80
AWR69283.1|2676374_2676782_-	tolA family protein	NA	NA	NA	NA	NA
AWR69284.1|2676924_2678193_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.7	4.4e-229
AWR69285.1|2678192_2678513_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.8	3.3e-24
AWR69286.1|2678512_2678752_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	72.2	9.1e-27
AWR69287.1|2679122_2680250_-	hypothetical protein	NA	A0A2I6PID3	Escherichia_phage	36.2	5.6e-50
AWR69288.1|2680308_2680542_-	cor protein	NA	E4WL42	Enterobacteria_phage	77.6	3.9e-30
AWR69289.1|2680649_2681321_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	2.2e-86
AWR69290.1|2681321_2681636_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	63.7	7.3e-32
AWR69291.1|2681679_2685546_-	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	76.8	0.0e+00
AWR69292.1|2685601_2686201_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	92.5	1.9e-97
AWR69293.1|2686188_2686920_-	peptidase P60	NA	G8C7R2	Escherichia_phage	96.3	2.0e-149
AWR69294.1|2686932_2687706_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	95.7	2.7e-144
AWR69295.1|2687702_2688053_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	92.2	2.3e-55
AWR69296.1|2688107_2688440_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69297.1|2688436_2689402_-	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	40.9	1.3e-10
AWR69298.1|2689467_2689692_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69299.1|2689697_2691620_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	48.5	1.3e-150
AWR69300.1|2691679_2692800_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AWR69301.1|2692849_2693212_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69302.1|2693803_2694325_-	hypothetical protein	NA	I6R9C4	Salmonella_phage	45.0	1.7e-30
AWR69303.1|2694608_2694806_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69304.1|2695544_2695850_-	hypothetical protein	NA	A0A2H4A316	Salmonella_phage	77.6	2.8e-12
AWR69305.1|2695846_2696317_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69306.1|2696313_2696766_-	hypothetical protein	NA	A0A076G839	Escherichia_phage	40.3	6.6e-10
AWR69307.1|2696762_2697023_-	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	72.3	3.1e-28
AWR69308.1|2697026_2697713_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69309.1|2697724_2698417_-	phage replication protein	NA	G8C7U6	Escherichia_phage	60.9	2.4e-80
AWR71258.1|2698400_2699393_-	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	1.4e-49
AWR69310.1|2699830_2700373_-	regulator	NA	M9NZI6	Enterobacteria_phage	55.6	5.6e-48
AWR69311.1|2700375_2700609_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	59.5	1.5e-18
AWR69312.1|2700712_2701108_+	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	71.8	2.9e-46
AWR69313.1|2701419_2701878_+	hypothetical protein	NA	NA	NA	NA	NA
AWR69314.1|2701864_2702245_+	hypothetical protein	NA	NA	NA	NA	NA
AWR69315.1|2702616_2702967_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	51.7	6.0e-27
AWR71259.1|2702956_2703154_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69316.1|2703168_2703354_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWR69317.1|2703363_2703522_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	76.9	4.8e-16
AWR69318.1|2703607_2703895_+	DNA breaking-rejoining protein	NA	H6WRX2	Salmonella_phage	67.4	4.2e-34
AWR69319.1|2704017_2707086_+	exodeoxyribonuclease	NA	K7PJT5	Enterobacteria_phage	70.1	0.0e+00
AWR71260.1|2707097_2708210_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	76.7	1.7e-160
AWR69320.1|2708244_2708484_+	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	69.2	2.1e-23
AWR69321.1|2708548_2708764_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	60.6	2.2e-19
AWR69322.1|2708763_2709984_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	51.9	9.8e-117
AWR69323.1|2710050_2711031_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2710064:2710083	attR	TTTAATAGTAGCCAGATAAA	NA	NA	NA	NA
AWR69324.1|2711134_2711434_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AWR69325.1|2711438_2713826_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWR69326.1|2713841_2714825_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	43.2	9.9e-35
>prophage 9
CP024908	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L chromosome, complete genome	4753669	2771064	2830393	4753669	tRNA,portal,holin,tail,capsid,terminase,head,protease	Enterobacterial_phage(32.69%)	79	NA	NA
AWR69383.1|2771064_2772348_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
AWR69384.1|2772610_2772931_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.1	8.2e-23
AWR69385.1|2772930_2773170_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	78.2	8.8e-30
AWR69386.1|2773269_2773536_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	92.0	4.4e-38
AWR71265.1|2773667_2774030_-	hypothetical protein	NA	A0A2I6PD03	Escherichia_phage	57.0	3.1e-26
AWR69387.1|2774853_2775087_-	cor protein	NA	E4WL42	Enterobacteria_phage	77.6	3.9e-30
AWR69388.1|2775194_2775866_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	2.2e-86
AWR69389.1|2775866_2776181_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	63.7	7.3e-32
AWR71266.1|2776224_2780073_-	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	61.1	0.0e+00
AWR69390.1|2780126_2780711_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	52.1	9.7e-54
AWR69391.1|2780710_2781421_-	peptidase P60	NA	F1C573	Cronobacter_phage	69.8	5.0e-97
AWR69392.1|2781423_2782182_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	3.9e-95
AWR69393.1|2782178_2782517_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	58.9	4.7e-37
AWR69394.1|2786057_2786393_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	93.7	4.0e-52
AWR69395.1|2786448_2786727_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	6.2e-43
AWR69396.1|2786735_2787119_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
AWR69397.1|2787127_2787571_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	92.4	3.9e-71
AWR69398.1|2787630_2787978_-	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	93.9	2.7e-56
AWR69399.1|2787974_2788424_-	hypothetical protein	NA	K7P6X4	Enterobacteria_phage	98.7	1.7e-74
AWR69400.1|2788420_2788759_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	4.3e-38
AWR69401.1|2788767_2789094_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	81.5	3.4e-48
AWR69402.1|2789137_2790349_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.7	2.8e-196
AWR69403.1|2790358_2791207_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.4	2.7e-137
AWR69404.1|2791220_2792525_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	92.9	1.4e-233
AWR69405.1|2792524_2794261_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	100.0	0.0e+00
AWR69406.1|2794260_2794734_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.7	1.3e-85
AWR69407.1|2794890_2795241_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	1.2e-51
AWR69408.1|2795240_2795831_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	81.1	1.8e-95
AWR69409.1|2795996_2796254_+	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	96.3	9.2e-33
AWR69410.1|2796554_2798012_-	glycosyltransferase	NA	S4TSQ9	Salmonella_phage	89.9	1.8e-266
AWR69411.1|2798069_2798675_+	hypothetical protein	NA	NA	NA	NA	NA
AWR69412.1|2798732_2798912_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	81.4	7.8e-15
AWR71267.1|2798868_2799138_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	82.0	2.0e-30
AWR69413.1|2799145_2799775_-	endolysin	NA	G8C7W0	Escherichia_phage	89.0	9.3e-103
AWR69414.1|2799774_2800056_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	2.8e-43
AWR69415.1|2800042_2800438_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	96.9	3.8e-62
AWR69416.1|2800593_2801172_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	53.9	7.3e-46
AWR69417.1|2801184_2802174_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	85.1	2.4e-166
AWR69418.1|2802170_2802560_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	94.6	1.7e-67
AWR69419.1|2802556_2802877_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	75.5	1.2e-42
AWR69420.1|2802873_2803101_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69421.1|2803097_2803757_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.3	1.1e-98
AWR69422.1|2803756_2804251_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69423.1|2804247_2805174_-	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	56.0	4.0e-70
AWR69424.1|2805130_2805343_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	63.5	5.6e-12
AWR69425.1|2805583_2806054_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	96.8	8.5e-77
AWR69426.1|2806095_2806314_-	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	60.3	4.9e-11
AWR69427.1|2806412_2807132_+	LexA family transcriptional repressor	NA	A0A2R2X2B0	Escherichia_phage	63.3	4.1e-78
AWR69428.1|2808343_2809171_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	87.8	7.9e-126
AWR69429.1|2809167_2809659_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	38.0	2.8e-06
AWR69430.1|2809768_2810326_+	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	69.7	2.0e-61
AWR69431.1|2810318_2810519_+	hypothetical protein	NA	NA	NA	NA	NA
AWR69432.1|2811422_2811707_+	DUF4752 domain-containing protein	NA	A0A2H5BFM0	Salmonella_phage	44.1	5.2e-21
AWR69433.1|2811773_2812043_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	74.2	6.9e-31
AWR69434.1|2812075_2812339_+	hypothetical protein	NA	NA	NA	NA	NA
AWR69435.1|2813676_2814177_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AWR71268.1|2814197_2814299_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69436.1|2814586_2815918_+	MFS transporter	NA	NA	NA	NA	NA
AWR69437.1|2815933_2817970_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
AWR69438.1|2818076_2818523_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWR69439.1|2818506_2819298_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWR69440.1|2819397_2820585_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AWR69441.1|2820616_2821324_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69442.1|2821474_2821819_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWR69443.1|2821819_2822125_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69444.1|2822205_2822460_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AWR69445.1|2822472_2822655_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69446.1|2822772_2823801_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	2.2e-13
AWR69447.1|2823846_2823945_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71269.1|2823945_2824020_+	hypothetical protein	NA	NA	NA	NA	NA
AWR69448.1|2824073_2824322_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AWR71270.1|2824350_2824536_-	hypothetical protein	NA	NA	NA	NA	NA
AWR69449.1|2824694_2824787_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
AWR69450.1|2824911_2826411_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWR69451.1|2826415_2826661_-	DUF2543 domain-containing protein	NA	NA	NA	NA	NA
AWR69452.1|2826736_2827987_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	92.6	2.3e-20
AWR69453.1|2828104_2828767_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AWR69454.1|2828766_2829240_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AWR69455.1|2829280_2830393_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
CP024908	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L chromosome, complete genome	4753669	3449922	3499784	4753669	holin,tail,terminase,lysis,integrase	Salmonella_phage(25.4%)	72	3449576:3449627	3499793:3499844
3449576:3449627	attL	TTTTAAATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWR70005.1|3449922_3451191_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	90.5	6.4e-228
AWR70006.1|3451611_3451974_+	GtrA family protein	NA	U5P0S6	Shigella_phage	84.2	2.0e-49
AWR70007.1|3451970_3452903_+	glycosyltransferase	NA	U5P087	Shigella_phage	92.1	8.5e-161
AWR70008.1|3452912_3454415_+	hypothetical protein	NA	Q8LTG0	Salmonella_phage	26.6	9.5e-37
AWR70009.1|3454460_3456665_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	61.4	1.1e-38
AWR70010.1|3456722_3459200_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.2	0.0e+00
AWR70011.1|3459186_3459552_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	90.8	1.6e-62
AWR70012.1|3459565_3460036_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
AWR70013.1|3460035_3460533_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.9	1.9e-87
AWR70014.1|3460574_3460802_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71290.1|3460812_3464316_-	hypothetical protein	NA	R9TMK1	Aeromonas_phage	51.7	1.7e-209
AWR70015.1|3464377_3465061_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	62.3	1.2e-79
AWR70016.1|3465119_3465881_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	69.0	2.4e-73
AWR70017.1|3465937_3466321_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	57.5	1.3e-38
AWR70018.1|3466360_3466903_-	HNH endonuclease	NA	Q7Y5F9	Xanthomonas_virus	43.7	1.9e-32
AWR70019.1|3467005_3467374_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	63.9	8.8e-37
AWR70020.1|3467376_3467733_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	56.4	2.7e-27
AWR70021.1|3467884_3468055_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	50.0	2.2e-11
AWR71291.1|3468054_3468456_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	78.2	4.6e-55
AWR70022.1|3468499_3469048_-	HNH endonuclease	NA	A0A2D2W633	Pectobacterium_phage	35.9	1.3e-20
AWR70023.1|3469140_3469434_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	88.7	8.5e-43
AWR70024.1|3469443_3470520_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.9	5.9e-190
AWR70025.1|3470538_3470988_-	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.9	3.2e-65
AWR70026.1|3471000_3472266_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	91.9	2.0e-221
AWR70027.1|3473961_3475311_-	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	87.3	1.1e-230
AWR70028.1|3475676_3476930_-|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	97.3	5.2e-214
AWR70029.1|3476926_3477382_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	81.3	4.0e-63
AWR70030.1|3477412_3478051_-	hypothetical protein	NA	I6S676	Salmonella_phage	92.5	1.8e-114
AWR70031.1|3478054_3478255_-	hypothetical protein	NA	NA	NA	NA	NA
AWR70032.1|3478258_3478477_-	hypothetical protein	NA	NA	NA	NA	NA
AWR70033.1|3478826_3479513_-	hypothetical protein	NA	A0A192Y918	Salmonella_phage	99.1	1.8e-123
AWR70034.1|3479710_3480184_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	54.1	1.6e-38
AWR70035.1|3480180_3480621_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	81.9	4.2e-62
AWR70036.1|3480607_3480925_-|holin	holin	holin	E7C9S8	Salmonella_phage	86.7	8.9e-46
AWR70037.1|3481050_3481284_+	hypothetical protein	NA	NA	NA	NA	NA
AWR70038.1|3481417_3482107_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	1.4e-56
AWR70039.1|3482106_3482244_-	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	71.0	1.9e-05
AWR70040.1|3482240_3482852_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	69.0	3.7e-40
AWR70041.1|3482844_3483513_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	95.5	1.3e-126
AWR70042.1|3483509_3483680_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	85.7	1.0e-19
AWR70043.1|3483672_3484122_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.2	2.5e-33
AWR70044.1|3484341_3484635_-	DUF4752 domain-containing protein	NA	K7PHN1	Enterobacterial_phage	43.5	7.0e-21
AWR70045.1|3484634_3485252_-	hypothetical protein	NA	G8C7V0	Escherichia_phage	68.3	1.9e-55
AWR70046.1|3485248_3485434_-	hypothetical protein	NA	K7P7P5	Enterobacteria_phage	91.8	1.6e-26
AWR70047.1|3485430_3485775_-	hypothetical protein	NA	K7P7C5	Enterobacteria_phage	56.8	2.8e-21
AWR70048.1|3485771_3486068_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	63.0	7.1e-29
AWR70049.1|3486064_3486379_-	protein ren	NA	O48423	Enterobacteria_phage	54.7	2.1e-18
AWR70050.1|3486368_3487742_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	63.8	5.8e-166
AWR70051.1|3487738_3488824_-	DNA replication protein	NA	E5AGE9	Erwinia_phage	45.4	1.5e-84
AWR70052.1|3489052_3489619_-	hypothetical protein	NA	NA	NA	NA	NA
AWR70053.1|3489648_3489900_-	transcriptional regulator	NA	G8C7U2	Escherichia_phage	54.7	9.0e-17
AWR70054.1|3490027_3490720_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	53.3	1.1e-59
AWR70055.1|3490733_3491108_-	hypothetical protein	NA	NA	NA	NA	NA
AWR70056.1|3491533_3491875_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	98.2	3.0e-55
AWR71292.1|3492429_3492624_+	hypothetical protein	NA	NA	NA	NA	NA
AWR70057.1|3492775_3492985_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	2.0e-33
AWR70058.1|3493056_3493341_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	91.5	8.0e-46
AWR70059.1|3493350_3494265_+	DNA recombinase	NA	G8C7T0	Escherichia_phage	100.0	6.1e-172
AWR70060.1|3494261_3494744_+	hypothetical protein	NA	G8C7S9	Escherichia_phage	99.4	8.4e-80
AWR70061.1|3494752_3495181_+	regulator	NA	M9NYX4	Enterobacteria_phage	94.4	4.9e-71
AWR70062.1|3495177_3495330_+	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	44.2	2.1e-05
AWR70063.1|3495326_3495986_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	93.2	1.2e-121
AWR70064.1|3495982_3496201_+	hypothetical protein	NA	NA	NA	NA	NA
AWR70065.1|3496197_3496494_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	66.7	1.4e-29
AWR70066.1|3496490_3496682_+	hypothetical protein	NA	A0A0P0ZC60	Stx2-converting_phage	66.1	2.4e-14
AWR70067.1|3496678_3497038_+	DUF2591 domain-containing protein	NA	J7I4M3	Pseudomonas_phage	36.1	6.2e-11
AWR70068.1|3497138_3497354_+	hypothetical protein	NA	M1FQT7	Enterobacteria_phage	61.4	1.3e-16
AWR70069.1|3497353_3497749_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	38.8	3.4e-10
AWR70070.1|3497726_3497966_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	70.5	3.5e-26
AWR70071.1|3497975_3498302_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	81.9	5.0e-44
AWR71293.1|3498408_3498744_+	DNA-binding protein	NA	NA	NA	NA	NA
AWR71294.1|3498740_3499784_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	99.1	5.3e-204
3499793:3499844	attR	TTTTAAATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 1
CP024909	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUEC_L, complete sequence	108404	0	107660	108404	integrase,protease,tail,capsid,terminase	Salmonella_phage(94.74%)	127	1058:1080	108283:108305
AWR71336.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
1058:1080	attL	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
AWR71337.1|1624_1837_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
AWR71338.1|1836_2172_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	98.2	2.0e-56
AWR71339.1|2168_2348_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	96.6	1.6e-20
AWR71456.1|2388_2664_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	2.7e-46
AWR71457.1|2732_3143_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	1.1e-75
AWR71340.1|3658_4489_-|protease	serine protease	protease	J9Q7Z4	Salmonella_phage	99.3	1.1e-127
AWR71341.1|4492_4693_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	93.9	9.3e-25
AWR71342.1|4784_5861_-	recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AWR71343.1|5863_6130_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AWR71344.1|6129_7074_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.7	4.0e-182
AWR71345.1|7134_8163_-	regulator	NA	J9Q7Z3	Salmonella_phage	99.7	1.3e-165
AWR71346.1|8282_8756_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	99.3	1.3e-72
AWR71347.1|8934_9186_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71348.1|9258_9822_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	66.1	9.0e-65
AWR71349.1|9851_10295_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.8e-72
AWR71350.1|10291_13810_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.7	0.0e+00
AWR71351.1|13784_13988_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	98.5	1.2e-32
AWR71352.1|13990_15226_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.8	6.0e-239
AWR71353.1|15322_17731_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	92.1	0.0e+00
AWR71354.1|17840_18053_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71355.1|18316_18703_+	transcriptional regulator	NA	NA	NA	NA	NA
AWR71356.1|18694_19801_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	32.6	5.6e-26
AWR71357.1|19972_20389_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71358.1|20379_20904_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71359.1|21000_21246_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	43.6	2.9e-12
AWR71360.1|21245_21611_-	hypothetical protein	NA	K7PH35	Enterobacteria_phage	65.6	1.5e-36
AWR71361.1|21626_21830_-	hypothetical protein	NA	A0A0B6VT64	Edwardsiella_phage	49.2	4.4e-06
AWR71362.1|21840_22674_-	phosphate starvation protein PhoH	NA	W8D063	Erwinia_phage	65.1	7.0e-90
AWR71363.1|22821_24054_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71364.1|25059_25365_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	98.0	1.2e-47
AWR71365.1|25361_25514_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	100.0	4.0e-20
AWR71458.1|25513_25720_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	100.0	2.8e-32
AWR71366.1|25709_25886_-	hypothetical protein	NA	J9Q729	Salmonella_phage	93.1	1.3e-22
AWR71367.1|25885_27208_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.3	2.8e-258
AWR71459.1|27242_27500_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	96.5	1.2e-35
AWR71460.1|27410_27752_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71368.1|27800_28595_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	76.5	2.1e-112
AWR71369.1|28781_30035_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AWR71370.1|30026_31238_-	DNA primase	NA	J9Q720	Salmonella_phage	93.8	3.7e-209
AWR71371.1|31300_32641_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	99.3	1.5e-246
AWR71372.1|32701_33427_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	97.9	2.7e-138
AWR71373.1|33691_34489_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	26.4	7.3e-12
AWR71374.1|34529_34889_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AWR71375.1|34888_35554_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	95.0	4.7e-113
AWR71376.1|35882_36152_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWR71377.1|36155_36680_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWR71378.1|36706_37048_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	80.6	6.9e-28
AWR71379.1|37116_37809_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	96.1	3.9e-126
AWR71380.1|37822_38146_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	8.0e-50
AWR71381.1|39366_39798_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	53.8	1.5e-16
AWR71382.1|48670_49261_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	91.8	9.0e-100
AWR71383.1|49248_50046_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	95.1	3.5e-155
AWR71384.1|50038_50770_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	3.9e-137
AWR71385.1|50826_51162_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	99.1	5.2e-60
AWR71386.1|51203_55787_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	91.2	0.0e+00
AWR71387.1|55794_56064_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AWR71388.1|56144_56462_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	97.1	1.7e-49
AWR71389.1|56521_57268_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	98.4	6.8e-129
AWR71390.1|57342_57726_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AWR71391.1|57727_58201_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AWR71392.1|58191_58536_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AWR71393.1|58633_59467_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	1.3e-152
AWR71394.1|59466_59901_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	8.1e-74
AWR71395.1|59944_60868_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	99.7	9.6e-157
AWR71396.1|60942_61818_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	99.7	8.5e-163
AWR71397.1|61844_62738_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	91.6	3.3e-138
AWR71398.1|62760_64335_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	98.9	3.5e-300
AWR71399.1|64368_65625_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
AWR71400.1|65627_66269_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	98.1	3.4e-108
AWR71401.1|66464_66731_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AWR71402.1|66740_67640_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	8.2e-169
AWR71403.1|67636_67891_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AWR71404.1|67883_68522_-	ABC transporter	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
AWR71405.1|68518_69187_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	99.1	4.3e-114
AWR71406.1|69186_69885_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	99.1	2.5e-125
AWR71407.1|69949_71509_+	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	99.4	9.8e-295
AWR71408.1|71511_71790_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	1.3e-40
AWR71409.1|71855_72380_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71410.1|72423_73224_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	39.0	9.3e-07
AWR71411.1|73338_73851_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	68.2	3.1e-56
AWR71412.1|74168_74819_+	hypothetical protein	NA	J9Q754	Salmonella_phage	98.6	3.5e-113
AWR71413.1|74869_75073_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	97.0	8.3e-29
AWR71414.1|75714_76197_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	7.1e-87
AWR71415.1|76209_76443_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71461.1|76402_76690_-	ABC transporter	NA	J9Q753	Salmonella_phage	97.8	6.6e-48
AWR71416.1|76810_77206_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	66.2	1.2e-42
AWR71417.1|77334_77646_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	96.1	7.9e-47
AWR71418.1|77786_78005_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AWR71419.1|78009_78231_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	98.6	1.4e-34
AWR71420.1|79870_80176_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71462.1|80213_80531_-	hypothetical protein	NA	J9Q750	Salmonella_phage	83.8	3.9e-49
AWR71421.1|80530_80767_-	hypothetical protein	NA	J9Q7H8	Salmonella_phage	97.4	1.6e-39
AWR71422.1|80852_81119_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	3.1e-31
AWR71423.1|81305_81509_+	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	97.0	6.8e-31
AWR71424.1|81564_82263_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	91.8	2.0e-114
AWR71425.1|82301_82853_-	hypothetical protein	NA	J9Q748	Salmonella_phage	92.3	2.3e-97
AWR71426.1|82849_83491_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	99.1	1.4e-114
AWR71427.1|83582_83954_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	99.2	7.2e-63
AWR71428.1|83956_84238_-	hypothetical protein	NA	J9Q801	Salmonella_phage	97.8	3.6e-46
AWR71429.1|84234_84924_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	87.7	5.2e-107
AWR71430.1|84981_86685_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	99.3	0.0e+00
AWR71431.1|86808_87381_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AWR71432.1|87489_88332_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AWR71433.1|88440_88629_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AWR71434.1|88638_89133_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	98.2	2.1e-81
AWR71435.1|89275_89884_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AWR71436.1|90479_90710_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AWR71437.1|90913_91507_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	98.5	1.9e-110
AWR71438.1|91692_92619_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	92.9	3.7e-108
AWR71439.1|92663_93221_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AWR71440.1|93230_93650_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
AWR71441.1|93713_94358_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AWR71442.1|94357_94834_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AWR71443.1|94830_95244_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AWR71444.1|95245_96361_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.9	2.4e-218
AWR71445.1|96538_97408_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	98.3	3.9e-160
AWR71446.1|97490_98633_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
AWR71447.1|98740_101056_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AWR71448.1|101133_101703_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
AWR71449.1|101714_102461_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.4	3.4e-136
AWR71450.1|102450_104367_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AWR71451.1|104363_104600_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AWR71452.1|104596_105682_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	98.6	5.9e-206
AWR71453.1|105910_106414_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	98.2	5.5e-90
AWR71454.1|106445_106940_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	98.2	7.8e-89
AWR71455.1|107015_107660_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.6	6.3e-123
108283:108305	attR	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
>prophage 1
CP024910	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence	351806	60352	104033	351806	transposase,integrase	Acinetobacter_phage(16.67%)	49	89633:89646	107272:107285
AWR71506.1|60352_61473_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AWR71507.1|61774_62032_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71508.1|62105_62642_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71509.1|62658_63105_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71510.1|63177_64158_+	DNA replication protein	NA	NA	NA	NA	NA
AWR71511.1|64167_65073_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71512.1|65008_65353_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71513.1|65374_66550_-	recombinase	NA	NA	NA	NA	NA
AWR71514.1|66719_66932_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71515.1|67292_68375_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71516.1|68540_70040_-	kinase	NA	NA	NA	NA	NA
AWR71517.1|70065_71703_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
AWR71518.1|71702_72743_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71519.1|72827_73466_-	tellurium resistance protein TerY	NA	NA	NA	NA	NA
AWR71520.1|73465_74107_-	tellurium resistance protein TerX	NA	NA	NA	NA	NA
AWR71521.1|74129_74768_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AWR71522.1|75230_75698_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
AWR71523.1|75715_76924_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AWR71524.1|76934_77891_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
AWR71525.1|77890_78970_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
AWR71526.1|78971_79745_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71527.1|79737_80880_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
AWR71528.1|80889_81948_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AWR71529.1|82268_82850_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
AWR71530.1|82849_84007_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AWR71531.1|84029_84485_+	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AWR71532.1|84507_85548_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
AWR71533.1|85596_86175_+	tellurium resistance protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
AWR71534.1|86243_86819_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
AWR71535.1|87247_88489_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
AWR71536.1|88851_89058_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71537.1|88967_90176_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
89633:89646	attL	CCTGAACGATATCC	NA	NA	NA	NA
AWR71538.1|90598_90790_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71539.1|90881_91223_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71540.1|92209_92464_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71541.1|93123_94128_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWR71542.1|94206_94764_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AWR71543.1|94757_95129_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71544.1|95125_95626_-|transposase	transposase	transposase	NA	NA	NA	NA
AWR71545.1|95622_95949_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71546.1|96203_96560_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AWR71547.1|96549_96951_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AWR71548.1|96947_97238_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AWR71549.1|97406_97586_+	transcriptional regulator	NA	NA	NA	NA	NA
AWR71550.1|97693_100579_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.4e-190
AWR71551.1|100704_101319_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
AWR71552.1|101384_102188_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AWR71553.1|102187_103024_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AWR71554.1|102995_104033_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	43.4	7.7e-62
107272:107285	attR	CCTGAACGATATCC	NA	NA	NA	NA
>prophage 2
CP024910	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence	351806	108949	146657	351806	transposase	Escherichia_phage(37.5%)	36	NA	NA
AWR71563.1|108949_109714_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWR71564.1|110301_113268_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
AWR71565.1|113346_114351_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWR71566.1|116289_117276_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71567.1|118196_118589_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71568.1|118567_118879_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71569.1|119247_119904_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71570.1|120209_121418_+|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AWR71571.1|121856_122525_+	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
AWR71572.1|122637_123843_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
AWR71573.1|123921_124548_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWR71574.1|124525_125212_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWR71575.1|125219_125606_-	amino acid-binding protein	NA	NA	NA	NA	NA
AWR71576.1|125598_125919_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWR71577.1|126363_127569_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
AWR71578.1|127934_129143_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AWR71795.1|129263_129761_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71579.1|129765_131154_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71796.1|131554_131848_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWR71580.1|131852_133178_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AWR71581.1|133238_133445_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71582.1|133545_133956_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71583.1|133968_134784_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.2	2.5e-15
AWR71584.1|135036_135462_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71585.1|136010_136319_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71586.1|136334_137192_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
AWR71587.1|137253_137457_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71588.1|137798_138203_-	DNA-binding protein	NA	NA	NA	NA	NA
AWR71589.1|138380_138674_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71590.1|138699_138936_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71591.1|138976_139432_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71592.1|139546_139669_+	ABC transporter	NA	NA	NA	NA	NA
AWR71593.1|139707_140688_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AWR71594.1|140733_141357_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71595.1|141414_141795_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71596.1|145952_146657_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
CP024910	Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence	351806	191994	286074	351806	transposase,protease,integrase	uncultured_Caudovirales_phage(32.0%)	94	210879:210893	226003:226017
AWR71635.1|191994_192699_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWR71636.1|192864_193341_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AWR71637.1|193417_195037_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AWR71638.1|195225_196194_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
AWR71639.1|196232_197579_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
AWR71640.1|197796_198231_+	copper-binding protein	NA	NA	NA	NA	NA
AWR71641.1|198488_199604_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AWR71642.1|199726_199999_+	transcriptional repressor RcnR	NA	NA	NA	NA	NA
AWR71643.1|200464_201283_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AWR71644.1|201279_202485_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AWR71645.1|202548_202752_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71646.1|202764_204084_-	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
AWR71647.1|204106_204274_-	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
AWR71648.1|204334_205762_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
AWR71649.1|205976_206492_+	nuclease	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
AWR71650.1|206494_207391_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71651.1|207438_207753_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71652.1|207826_208084_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71653.1|208142_208376_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71654.1|208421_208676_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71655.1|208713_209001_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71799.1|209070_209268_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71656.1|209408_209684_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71657.1|210175_211654_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
210879:210893	attL	CGATGATGACCGCCA	NA	NA	NA	NA
AWR71658.1|211672_212500_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
AWR71659.1|212559_212985_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
AWR71660.1|212997_214287_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
AWR71661.1|214332_214653_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
AWR71662.1|214739_215444_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
AWR71663.1|215476_216880_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWR71664.1|217071_217389_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71665.1|217411_217717_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71666.1|217761_218433_+|protease	serine protease	protease	NA	NA	NA	NA
AWR71667.1|218890_219298_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71668.1|219348_219666_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71669.1|219664_219793_+	ABC transporter	NA	NA	NA	NA	NA
AWR71670.1|221242_221734_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71671.1|222292_224008_-|integrase	integrase	integrase	NA	NA	NA	NA
AWR71672.1|224117_227147_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
226003:226017	attR	TGGCGGTCATCATCG	NA	NA	NA	NA
AWR71673.1|227253_228279_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AWR71674.1|228275_229055_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AWR71675.1|229441_230323_+	carbapenem-hydrolyzing class A beta-lactamase KPC-4	NA	A0A1B0VBP7	Salmonella_phage	52.5	1.1e-74
AWR71676.1|230572_231892_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AWR71677.1|232909_236245_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71678.1|236467_236821_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71679.1|236974_237529_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71680.1|238553_238988_+	peptidase	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
AWR71681.1|238971_240231_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.5	1.5e-96
AWR71682.1|240276_241086_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71683.1|241192_241804_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71800.1|241863_242124_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71684.1|242319_242712_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71685.1|242736_243486_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AWR71686.1|243633_244173_+	lytic transglycosylase	NA	NA	NA	NA	NA
AWR71687.1|244255_244813_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71688.1|244936_245998_+	HNH endonuclease	NA	NA	NA	NA	NA
AWR71689.1|246007_246514_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71690.1|246581_247790_-|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AWR71691.1|247974_251925_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AWR71692.1|251933_253349_-	conjugal transfer protein	NA	NA	NA	NA	NA
AWR71693.1|253338_254385_-	thioredoxin family protein	NA	NA	NA	NA	NA
AWR71694.1|254976_255489_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71695.1|255490_256291_-	trhR	NA	NA	NA	NA	NA
AWR71696.1|257050_257536_+	plasmid transfer protein	NA	NA	NA	NA	NA
AWR71697.1|257532_258270_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71698.1|258279_261426_+	helicase	NA	NA	NA	NA	NA
AWR71699.1|261425_263510_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71700.1|263509_264619_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71701.1|264605_265268_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
AWR71702.1|265278_266460_+	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	7.5e-13
AWR71801.1|266992_268199_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	2.6e-101
AWR71703.1|268820_269174_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71704.1|269239_269524_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71705.1|269880_270180_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71706.1|270612_270981_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71707.1|271202_271739_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71708.1|271806_272244_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71709.1|272288_272585_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71710.1|272719_273421_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71711.1|273735_274017_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71712.1|274082_275267_-	DNA-binding protein	NA	NA	NA	NA	NA
AWR71713.1|275683_275878_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71714.1|276370_277315_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71715.1|277410_278013_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
AWR71716.1|278072_278423_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71717.1|278469_278673_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71718.1|278954_279275_+	hypothetical protein	NA	NA	NA	NA	NA
AWR71719.1|279883_280042_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AWR71720.1|280113_280401_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AWR71721.1|280400_280640_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AWR71722.1|280902_281826_-	cation transporter	NA	NA	NA	NA	NA
AWR71802.1|282025_282598_-	hypothetical protein	NA	NA	NA	NA	NA
AWR71723.1|283073_284312_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
AWR71724.1|284733_286074_-|transposase	transposase	transposase	NA	NA	NA	NA
