The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032291	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 chromosome, complete genome	5029558	37401	174421	5029558	transposase,tRNA,capsid,protease,integrase	Enterobacteria_phage(17.86%)	116	103847:103860	175959:175972
AYA10012.1|37401_38754_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AYA10013.1|38792_39179_+	cytochrome b562	NA	NA	NA	NA	NA
AYA10014.1|39496_39835_+	glycine dehydrogenase	NA	NA	NA	NA	NA
AYA10015.1|39845_40208_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10016.1|40210_40510_+	cytoplasmic protein	NA	NA	NA	NA	NA
AYA10017.1|41322_41964_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10018.1|42006_43140_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
AYA10019.1|43123_44242_+	SelA-like pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYA10020.1|44238_44979_+	oxo-acid lyase	NA	NA	NA	NA	NA
AYA10021.1|45004_46141_+	lactonase family protein	NA	NA	NA	NA	NA
AYA10022.1|46160_48071_+	PRD domain-containing protein	NA	NA	NA	NA	NA
AYA10023.1|48103_48568_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2D0YLR2	Vibrio_phage	58.4	1.1e-52
AYA10024.1|48673_50812_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	65.0	7.4e-269
AYA10025.1|51181_51754_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AYA10026.1|51755_54353_-	alpha-mannosidase	NA	NA	NA	NA	NA
AYA10027.1|54363_55761_-	PTS lactose transporter subunit IIB	NA	NA	NA	NA	NA
AYA10028.1|55940_56600_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYA10029.1|56608_57355_-	hypothetical protein	NA	NA	NA	NA	NA
AYA10030.1|57490_59146_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AYA10031.1|59197_60619_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AYA10032.1|60745_61693_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.4	9.3e-14
AYA10033.1|62084_64793_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	28.1	8.5e-36
AYA10034.1|64997_67382_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
AYA10035.1|67433_67820_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AYA10036.1|67893_68355_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AYA10037.1|68367_69300_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	1.3e-52
AYA14429.1|69334_69466_-	PyrBI operon leader peptide	NA	NA	NA	NA	NA
AYA14430.1|69539_70019_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
AYA10038.1|70099_71503_-	YfcC family protein	NA	NA	NA	NA	NA
AYA10039.1|71550_72555_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYA10040.1|73503_74724_-	arginine deiminase	NA	NA	NA	NA	NA
AYA10041.1|74963_75944_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AYA10042.1|75982_76069_-	ABC transporter	NA	NA	NA	NA	NA
AYA10043.1|76398_76620_-	hypothetical protein	NA	NA	NA	NA	NA
AYA10044.1|76599_77052_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AYA10045.1|77275_78184_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AYA10046.1|78198_80166_+	YjhG/YagF family D-xylonate dehydratase	NA	NA	NA	NA	NA
AYA10047.1|80392_81775_+	MFS transporter	NA	NA	NA	NA	NA
AYA10048.1|81786_83397_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AYA10049.1|83401_84160_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AYA10050.1|84359_85517_+|transposase	transposase	transposase	NA	NA	NA	NA
AYA10051.1|85631_86084_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AYA10052.1|86085_86448_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
AYA10053.1|86714_87719_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYA10054.1|87883_88309_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
AYA10055.1|88355_89114_+|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
AYA10056.1|89144_89867_+	topoisomerase II	NA	NA	NA	NA	NA
AYA10057.1|90578_91496_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10058.1|91555_92350_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10059.1|92391_93315_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	96.7	8.1e-172
AYA10060.1|96027_96603_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	36.9	2.4e-20
AYA10061.1|96948_97872_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	96.7	8.1e-172
AYA10062.1|98447_98882_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10063.1|98878_99085_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10064.1|99254_99818_+	hypothetical protein	NA	NA	NA	NA	NA
AYA14431.1|99817_100051_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10065.1|100063_100303_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10066.1|100306_101002_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10067.1|101161_101509_+	hypothetical protein	NA	H9C0S3	Aeromonas_phage	52.7	6.6e-26
AYA10068.1|101576_102572_+|capsid	capsid protein	capsid	A0A088FAD6	Enterobacteria_phage	55.2	2.7e-96
AYA10069.1|102588_103098_+	HNH endonuclease	NA	Q7Y5F9	Xanthomonas_virus	43.7	2.9e-22
AYA10070.1|103116_103542_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10071.1|103525_103825_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10072.1|103797_104226_+	hypothetical protein	NA	A0A2K9VHU9	Pseudomonas_phage	42.6	7.2e-06
103847:103860	attL	ATCTGGAACACCTC	NA	NA	NA	NA
AYA10073.1|104267_105170_-	abortive phage resistance protein	NA	NA	NA	NA	NA
AYA10074.1|105257_106469_-|integrase	integrase	integrase	NA	NA	NA	NA
AYA10075.1|108212_109064_-	hypothetical protein	NA	NA	NA	NA	NA
AYA10076.1|109056_109680_-	hypothetical protein	NA	NA	NA	NA	NA
AYA10077.1|109741_110374_-	hypothetical protein	NA	NA	NA	NA	NA
AYA10078.1|110439_111153_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYA10079.1|111152_114248_-	restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.5	1.2e-54
AYA10080.1|114554_115675_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	5.1e-51
AYA10081.1|117492_118926_-	hypothetical protein	NA	NA	NA	NA	NA
AYA10082.1|118922_120188_-	hypothetical protein	NA	NA	NA	NA	NA
AYA10083.1|120184_122650_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	35.9	6.1e-73
AYA10084.1|122957_123542_-	SAM-dependent methyltransferase	NA	A0A2H4J5G6	uncultured_Caudovirales_phage	48.1	2.8e-13
AYA10085.1|123949_124930_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AYA10086.1|126480_126642_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AYA10087.1|127268_128534_-	hypothetical protein	NA	NA	NA	NA	NA
AYA10088.1|128746_130003_-	MFS transporter	NA	NA	NA	NA	NA
AYA10089.1|130367_131216_+	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
AYA10090.1|131208_132150_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYA10091.1|132186_133443_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AYA10092.1|133439_134516_+	dihydroorotase	NA	NA	NA	NA	NA
AYA10093.1|134680_135577_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYA10094.1|135657_135984_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10095.1|137137_137308_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AYA10096.1|137364_138618_-	MFS transporter	NA	NA	NA	NA	NA
AYA10097.1|138669_141744_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.6	0.0e+00
AYA10098.1|141865_142948_-	lac repressor	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
AYA10099.1|143224_144493_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	30.0	1.0e-47
AYA10100.1|144537_145518_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AYA10101.1|145812_146085_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
AYA10102.1|148911_149340_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
AYA10103.1|149533_150529_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.3	7.0e-20
AYA10104.1|151350_152502_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	37.1	1.2e-26
AYA10105.1|153468_153966_-	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AYA10106.1|153962_155678_-	sodium:proton exchanger	NA	NA	NA	NA	NA
AYA10107.1|155681_156122_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	37.2	5.8e-11
AYA10108.1|156111_157257_-	hypothetical protein	NA	NA	NA	NA	NA
AYA10109.1|157305_157947_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AYA10110.1|158036_158924_-	hypothetical protein	NA	NA	NA	NA	NA
AYA10111.1|159026_159941_-	hypothetical protein	NA	NA	NA	NA	NA
AYA10112.1|159963_160422_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYA14432.1|160509_160650_-	hypothetical protein	NA	NA	NA	NA	NA
AYA10113.1|161567_164417_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.1	2.6e-128
AYA10114.1|164522_165092_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYA14433.1|165126_165408_-	DNA-binding protein	NA	NA	NA	NA	NA
AYA10115.1|165507_166047_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYA10116.1|166078_167104_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYA10117.1|167443_168367_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	1.8e-171
AYA10118.1|169317_169890_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	46.6	1.1e-38
AYA10119.1|169898_170717_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10120.1|170787_172131_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AYA10121.1|172356_172989_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10122.1|173017_174421_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
175959:175972	attR	GAGGTGTTCCAGAT	NA	NA	NA	NA
>prophage 2
CP032291	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 chromosome, complete genome	5029558	972814	1002575	5029558	transposase	Enterobacteria_phage(36.36%)	29	NA	NA
AYA10831.1|972814_973795_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AYA10832.1|974405_974879_+	HNH endonuclease	NA	A0A0F6YQ55	Sinorhizobium_phage	38.4	5.5e-15
AYA10833.1|974933_975356_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10834.1|975397_976321_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	96.7	8.1e-172
AYA10835.1|977322_978009_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10836.1|978251_978851_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10837.1|979170_979464_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10838.1|979570_980011_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10839.1|980586_981282_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYA14457.1|982726_983155_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10840.1|984149_985073_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.0	8.7e-174
AYA10841.1|985097_985280_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10842.1|985236_986388_+|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AYA10843.1|986779_987190_-	hypothetical protein	NA	NA	NA	NA	NA
AYA10844.1|987483_989007_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AYA10845.1|989757_990048_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10846.1|990122_990416_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10847.1|990402_992865_+	hypothetical protein	NA	A0A0R6PHL3	Moraxella_phage	32.9	2.3e-16
AYA10848.1|992916_993471_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10849.1|993474_994119_+	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
AYA10850.1|994516_996475_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10851.1|996520_997444_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.0	8.7e-174
AYA10852.1|997643_999113_+	DUF1983 domain-containing protein	NA	A0A2L0V157	Salmonella_phage	68.8	8.5e-14
AYA10853.1|999152_999422_+	hypothetical protein	NA	NA	NA	NA	NA
AYA14458.1|999465_999855_-	lysozyme	NA	H6X3N0	Enterobacteria_phage	46.0	2.0e-23
AYA10854.1|999951_1000383_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10855.1|1000392_1001001_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10856.1|1001329_1001626_+	hypothetical protein	NA	NA	NA	NA	NA
AYA10857.1|1001651_1002575_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
>prophage 3
CP032291	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 chromosome, complete genome	5029558	1251264	1347163	5029558	tail,transposase,tRNA,capsid,portal,protease,head,integrase,holin,terminase	Enterobacterial_phage(23.64%)	105	1245378:1245395	1317616:1317633
1245378:1245395	attL	CGCGTCATTGAGCGCGCG	NA	NA	NA	NA
AYA11068.1|1251264_1252044_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AYA11069.1|1252047_1253370_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AYA11070.1|1253350_1254055_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AYA11071.1|1254054_1258506_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AYA11072.1|1258683_1260507_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AYA11073.1|1260681_1261233_+	DUF882 domain-containing protein	NA	NA	NA	NA	NA
AYA11074.1|1261253_1261901_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYA11075.1|1261949_1263140_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AYA11076.1|1263324_1264443_-	porin	NA	Q1MVN1	Enterobacteria_phage	52.2	2.1e-97
AYA11077.1|1264488_1264677_-	hypothetical protein	NA	NA	NA	NA	NA
AYA11078.1|1265049_1266450_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.7	4.2e-79
AYA11079.1|1266616_1267819_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.9	1.7e-44
AYA11080.1|1268003_1269296_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	94.0	5.3e-238
AYA11081.1|1269340_1269598_-	excisionase	NA	S4TND0	Salmonella_phage	90.0	1.8e-36
AYA11082.1|1269581_1269968_-	hypothetical protein	NA	NA	NA	NA	NA
AYA11083.1|1269955_1270705_-	hypothetical protein	NA	A0A1B5FPC0	Escherichia_phage	88.4	2.1e-122
AYA11084.1|1270716_1271295_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	66.7	3.2e-73
AYA11085.1|1271294_1271717_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	65.0	2.0e-45
AYA11086.1|1271713_1271935_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	66.7	1.9e-18
AYA11087.1|1271934_1272288_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	85.7	1.5e-46
AYA11088.1|1272280_1272502_-	hypothetical protein	NA	NA	NA	NA	NA
AYA11089.1|1272608_1272995_-	peptidase S24	NA	F1C5A0	Cronobacter_phage	60.8	9.9e-39
AYA11090.1|1273061_1273493_-	transcriptional regulator	NA	NA	NA	NA	NA
AYA11091.1|1273668_1274541_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	36.1	2.6e-34
AYA11092.1|1274503_1274734_+	transcriptional regulator	NA	NA	NA	NA	NA
AYA11093.1|1274735_1274945_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AYA11094.1|1274874_1275303_+	HNH endonuclease	NA	NA	NA	NA	NA
AYA11095.1|1275289_1276300_+	hypothetical protein	NA	A0A2I7RGI7	Vibrio_phage	45.3	2.5e-17
AYA11096.1|1276403_1278275_+	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	61.2	1.0e-229
AYA11097.1|1278276_1278588_+	hypothetical protein	NA	NA	NA	NA	NA
AYA11098.1|1278584_1279400_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	77.5	2.4e-111
AYA11099.1|1280047_1280443_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	3.4e-63
AYA11100.1|1280429_1280735_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	90.3	2.9e-41
AYA11101.1|1280712_1281255_+	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	72.1	1.3e-76
AYA11102.1|1281251_1281527_+	hypothetical protein	NA	NA	NA	NA	NA
AYA11103.1|1281477_1281672_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	77.2	9.7e-19
AYA11104.1|1281899_1282166_+	hypothetical protein	NA	NA	NA	NA	NA
AYA11105.1|1282327_1282801_+	hypothetical protein	NA	K7PH02	Enterobacteria_phage	91.6	1.5e-76
AYA11106.1|1282812_1284270_+	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	95.1	7.0e-279
AYA11107.1|1284313_1284832_+	HNH endonuclease	NA	K7PJS8	Enterobacterial_phage	53.8	1.0e-46
AYA11108.1|1284812_1285403_+	hypothetical protein	NA	K7P7D2	Enterobacteria_phage	88.3	1.0e-103
AYA11109.1|1285399_1285741_+	HNH endonuclease	NA	K7PM05	Enterobacterial_phage	98.2	3.0e-63
AYA11110.1|1285740_1285944_+	hypothetical protein	NA	A0A220NRN5	Escherichia_phage	79.1	4.4e-22
AYA11111.1|1286129_1286615_+|terminase	terminase	terminase	K7PGU7	Enterobacterial_phage	98.8	2.0e-81
AYA11112.1|1286621_1288136_+|terminase	terminase	terminase	Q9MCV7	Escherichia_phage	99.6	5.2e-293
AYA11113.1|1288135_1289410_+|portal	phage portal protein	portal	F1C584	Cronobacter_phage	97.4	2.2e-244
AYA11114.1|1289427_1290105_+|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	100.0	2.4e-125
AYA11115.1|1290107_1291265_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	99.7	1.3e-211
AYA11116.1|1291298_1291625_+	hypothetical protein	NA	K7PGU9	Enterobacterial_phage	98.1	1.1e-54
AYA11117.1|1291624_1291963_+|head,tail	head-tail adaptor protein	head,tail	K7PLY4	Enterobacterial_phage	97.3	5.4e-57
AYA11118.1|1291959_1292409_+	hypothetical protein	NA	K7PH84	Enterobacterial_phage	100.0	4.0e-76
AYA11119.1|1292405_1292753_+	hypothetical protein	NA	K7PKL6	Enterobacterial_phage	96.5	1.2e-56
AYA11120.1|1292806_1293277_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	98.1	4.4e-81
AYA11121.1|1293331_1293733_+|tail	phage tail protein	tail	K7PGV0	Enterobacterial_phage	100.0	4.3e-69
AYA11122.1|1293756_1294020_+	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	98.9	8.5e-42
AYA11123.1|1294054_1297336_+|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	99.4	0.0e+00
AYA11124.1|1297338_1297677_+|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	100.0	6.6e-63
AYA11125.1|1297673_1298432_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	99.6	1.1e-147
AYA11126.1|1298433_1299144_+	peptidase P60	NA	K7PJX1	Enterobacterial_phage	98.3	5.9e-146
AYA11127.1|1299191_1299416_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	100.0	3.6e-33
AYA11128.1|1299465_1300074_+|tail	tail assembly protein	tail	K7PM69	Enterobacteria_phage	100.0	1.4e-103
AYA11129.1|1300127_1303316_+	host specificity protein	NA	K7P7G9	Enterobacteria_phage	92.3	0.0e+00
AYA11130.1|1303358_1303673_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	66.7	2.0e-34
AYA11131.1|1303673_1304345_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	70.9	5.5e-85
AYA11132.1|1304452_1304686_+	cor protein	NA	E4WL42	Enterobacteria_phage	70.1	2.1e-28
AYA11133.1|1304748_1305996_+	hypothetical protein	NA	K7P7B1	Enterobacteria_phage	69.0	5.1e-60
AYA11134.1|1306053_1306320_-	virulence protein MsgA	NA	K7PKR6	Enterobacteria_phage	95.5	8.0e-40
AYA11135.1|1306744_1309357_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.0	9.1e-19
AYA11136.1|1309407_1310178_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	5.8e-30
AYA11137.1|1310174_1310966_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
AYA11138.1|1310975_1312121_-	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AYA11139.1|1312117_1313080_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYA11140.1|1313072_1313648_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AYA11141.1|1313896_1314907_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYA11142.1|1315073_1315616_+	cell division protein ZapC	NA	NA	NA	NA	NA
AYA11143.1|1315612_1316722_-	MOSC domain-containing protein	NA	V5UTY8	Synechococcus_phage	36.2	9.2e-05
AYA11144.1|1316820_1318929_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
1317616:1317633	attR	CGCGTCATTGAGCGCGCG	NA	NA	NA	NA
AYA11145.1|1318941_1320849_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	5.6e-50
AYA11146.1|1320862_1322116_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYA11147.1|1322120_1323761_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AYA11148.1|1323757_1324324_+	hypothetical protein	NA	NA	NA	NA	NA
AYA11149.1|1324579_1324747_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYA11150.1|1324817_1325336_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AYA11151.1|1325404_1327165_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
AYA11152.1|1327351_1327804_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
AYA14466.1|1327870_1328926_-	porin OmpA	NA	NA	NA	NA	NA
AYA11153.1|1329280_1329790_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AYA11154.1|1330007_1330634_+	competence protein	NA	NA	NA	NA	NA
AYA11155.1|1330590_1332753_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AYA11156.1|1332772_1333219_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AYA11157.1|1333342_1335397_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.8e-17
AYA11158.1|1335456_1335915_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYA11159.1|1335995_1336658_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AYA11160.1|1336831_1337245_+	CoA-binding protein	NA	NA	NA	NA	NA
AYA11161.1|1337282_1337600_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYA11162.1|1337660_1338851_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
AYA11163.1|1339025_1339583_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AYA11164.1|1339593_1340382_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYA11165.1|1340393_1340675_+	acylphosphatase	NA	NA	NA	NA	NA
AYA11166.1|1340671_1341001_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AYA11167.1|1341069_1341621_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYA11168.1|1341631_1342789_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYA11169.1|1342790_1345508_-	fimbrial protein	NA	NA	NA	NA	NA
AYA11170.1|1345580_1346069_-	fimbrial protein	NA	NA	NA	NA	NA
AYA11171.1|1346182_1347163_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 4
CP032291	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 chromosome, complete genome	5029558	1498486	1568447	5029558	tail,transposase,capsid,tRNA,portal,head,holin,terminase	Enterobacteria_phage(54.17%)	82	NA	NA
AYA11321.1|1498486_1498978_+|transposase	transposase	transposase	NA	NA	NA	NA
AYA11322.1|1499068_1500190_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYA11323.1|1500281_1501745_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AYA14474.1|1501745_1502417_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AYA11324.1|1502490_1503777_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	48.9	3.0e-108
AYA11325.1|1503776_1503992_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	54.9	1.2e-17
AYA11326.1|1504053_1504293_-	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	55.3	5.5e-16
AYA14475.1|1506406_1506679_-	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	44.3	1.8e-15
AYA11327.1|1507060_1507984_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
AYA11328.1|1508680_1509100_-	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	53.1	2.9e-12
AYA11329.1|1509177_1509390_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	43.4	4.6e-06
AYA11330.1|1509389_1509839_+	hypothetical protein	NA	NA	NA	NA	NA
AYA11331.1|1509855_1510113_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AYA11332.1|1510109_1511063_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	42.6	2.2e-63
AYA11333.1|1511092_1511749_+	hypothetical protein	NA	NA	NA	NA	NA
AYA11334.1|1514244_1515105_+	DNA methyltransferase	NA	NA	NA	NA	NA
AYA11335.1|1515328_1515652_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	65.7	1.7e-31
AYA11336.1|1515825_1516044_+	hypothetical protein	NA	NA	NA	NA	NA
AYA11337.1|1516188_1516485_+	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	57.0	1.1e-21
AYA11338.1|1516477_1516834_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	62.7	2.2e-40
AYA11339.1|1516830_1517436_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	65.2	2.5e-73
AYA11340.1|1518650_1519574_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
AYA11341.1|1519732_1519948_+|holin	holin	holin	H9C183	Pectobacterium_phage	75.4	1.0e-24
AYA11342.1|1519947_1520484_+	lysozyme	NA	K7PM52	Enterobacteria_phage	80.0	1.0e-81
AYA11343.1|1520480_1520870_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	48.4	3.4e-23
AYA11344.1|1521051_1521330_-	hypothetical protein	NA	NA	NA	NA	NA
AYA11345.1|1521580_1521940_+	cell envelope biogenesis protein TolA	NA	NA	NA	NA	NA
AYA11346.1|1522084_1522288_+	hypothetical protein	NA	NA	NA	NA	NA
AYA11347.1|1522714_1523260_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	93.4	5.4e-91
AYA11348.1|1523234_1525157_+|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	93.8	0.0e+00
AYA11349.1|1525156_1525363_+|tail	phage tail protein	tail	E4WL20	Enterobacteria_phage	95.5	9.3e-28
AYA11350.1|1525359_1526949_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	91.1	1.1e-285
AYA11351.1|1526929_1528273_+	S49 family peptidase	NA	O64320	Escherichia_phage	92.4	5.4e-201
AYA11352.1|1528282_1528615_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	91.8	1.5e-51
AYA11353.1|1528670_1529696_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	95.6	3.8e-186
AYA11354.1|1529741_1530155_+	DNA-packaging protein	NA	E4WL26	Enterobacteria_phage	59.4	3.5e-26
AYA11355.1|1530166_1530520_+|tail	phage tail protein	tail	E4WL27	Enterobacteria_phage	92.3	7.9e-59
AYA11356.1|1530529_1531114_+|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	99.5	1.2e-99
AYA11357.1|1531110_1531509_+|tail	phage tail protein	tail	E4WL29	Enterobacteria_phage	99.2	6.5e-70
AYA11358.1|1531516_1532260_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.8	3.9e-132
AYA11359.1|1532270_1532702_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	93.7	6.0e-69
AYA11360.1|1532710_1533025_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	96.2	1.3e-52
AYA11361.1|1533008_1536146_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	95.5	0.0e+00
AYA11362.1|1536142_1536481_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	100.0	2.3e-60
AYA11363.1|1536536_1537274_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	99.6	2.7e-146
AYA11364.1|1537276_1537996_+	peptidase P60	NA	K7PJY5	Enterobacterial_phage	96.2	2.0e-138
AYA11365.1|1537988_1538606_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	99.5	3.9e-106
AYA11366.1|1538648_1541876_+	host specificity protein	NA	E4WL39	Enterobacteria_phage	78.8	0.0e+00
AYA11367.1|1541918_1542233_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	66.7	2.0e-34
AYA11368.1|1542233_1542905_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	70.9	5.5e-85
AYA11369.1|1543012_1543246_+	cor protein	NA	E4WL42	Enterobacteria_phage	70.1	2.1e-28
AYA11370.1|1543308_1544556_+	hypothetical protein	NA	K7P7B1	Enterobacteria_phage	69.0	5.1e-60
AYA11371.1|1544583_1545147_-	hypothetical protein	NA	K7PGY2	Enterobacteria_phage	48.0	5.0e-23
AYA14476.1|1545343_1545910_+	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	78.8	1.0e-76
AYA11372.1|1546377_1546728_-	hypothetical protein	NA	NA	NA	NA	NA
AYA11373.1|1546922_1547150_-	hypothetical protein	NA	NA	NA	NA	NA
AYA11374.1|1547709_1547928_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.7	4.1e-18
AYA11375.1|1548211_1548424_+	cold-shock protein	NA	NA	NA	NA	NA
AYA11376.1|1548474_1549149_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	58.7	2.0e-79
AYA11377.1|1549546_1550917_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.0	3.8e-109
AYA11378.1|1550936_1551566_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
AYA11379.1|1551594_1552707_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AYA11380.1|1552747_1553221_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AYA11381.1|1553230_1553884_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AYA11382.1|1554001_1555252_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
AYA11383.1|1555329_1555677_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AYA11384.1|1555751_1555997_+	hypothetical protein	NA	NA	NA	NA	NA
AYA11385.1|1556287_1557787_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYA14477.1|1558023_1559544_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYA14478.1|1559723_1561196_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.8	2.9e-14
AYA11386.1|1561480_1561729_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AYA11387.1|1561859_1561958_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14479.1|1562003_1563032_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.5	3.5e-14
AYA11388.1|1563341_1563596_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AYA11389.1|1563676_1563982_+	hypothetical protein	NA	NA	NA	NA	NA
AYA11390.1|1563982_1564327_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AYA11391.1|1564428_1565136_+	hypothetical protein	NA	NA	NA	NA	NA
AYA11392.1|1565167_1566355_-	cyanate MFS transporter	NA	NA	NA	NA	NA
AYA11393.1|1566454_1567246_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYA11394.1|1567229_1567676_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AYA11395.1|1567820_1567925_+	hypothetical protein	NA	NA	NA	NA	NA
AYA11396.1|1567946_1568447_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 5
CP032291	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 chromosome, complete genome	5029558	2412231	2460329	5029558	tRNA,plate,transposase	uncultured_Caudovirales_phage(22.22%)	46	NA	NA
AYA12146.1|2412231_2413488_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AYA12147.1|2413689_2414301_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
AYA12148.1|2414297_2415167_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AYA14508.1|2415292_2416240_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
AYA12149.1|2416364_2418044_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	1.1e-22
AYA12150.1|2418029_2419088_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYA12151.1|2419208_2419484_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12152.1|2419758_2420343_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AYA12153.1|2420469_2421561_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AYA14509.1|2421614_2421908_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12154.1|2422007_2422373_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12155.1|2422389_2422770_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12156.1|2423352_2423835_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12157.1|2424396_2424801_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12158.1|2425254_2425695_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12159.1|2425782_2426706_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	96.7	8.1e-172
AYA12160.1|2426890_2427139_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12161.1|2427391_2427712_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12162.1|2427776_2428259_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYA12163.1|2428362_2428794_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12164.1|2429345_2429702_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYA12165.1|2429953_2430283_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12166.1|2431012_2431456_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12167.1|2431548_2432019_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12168.1|2431999_2433031_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AYA12169.1|2433191_2433455_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12170.1|2434715_2435072_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12171.1|2435068_2439493_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.7	6.9e-27
AYA12172.1|2439496_2439937_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
AYA12173.1|2440012_2441089_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14510.1|2441373_2441511_+	ABC transporter	NA	NA	NA	NA	NA
AYA12174.1|2441549_2442530_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AYA14511.1|2442922_2443339_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12175.1|2443412_2445335_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.4	3.2e-45
AYA12176.1|2445394_2445829_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12177.1|2445932_2446286_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12178.1|2446537_2447641_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	43.0	9.4e-58
AYA12179.1|2447674_2448046_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12180.1|2448047_2449310_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AYA12181.1|2449312_2450107_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
AYA12182.1|2450118_2452047_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.4	1.9e-45
AYA12183.1|2452112_2452616_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12184.1|2454197_2456813_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.8	2.7e-79
AYA12185.1|2456851_2457895_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYA12186.1|2457891_2459763_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYA12187.1|2459765_2460329_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 6
CP032291	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 chromosome, complete genome	5029558	2790637	2796923	5029558		Enterobacteria_phage(50.0%)	6	NA	NA
AYA12481.1|2790637_2791180_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.2	1.3e-52
AYA12482.1|2791182_2792061_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.1	9.6e-106
AYA12483.1|2792114_2793014_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	2.0e-29
AYA12484.1|2793013_2794099_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	6.7e-101
AYA12485.1|2794458_2795355_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	9.0e-43
AYA12486.1|2795531_2796923_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.2	2.8e-19
>prophage 7
CP032291	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 chromosome, complete genome	5029558	2919875	2980827	5029558	plate,tail,transposase,tRNA,lysis	Vibrio_phage(14.29%)	59	NA	NA
AYA12588.1|2919875_2920808_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
AYA12589.1|2920849_2921647_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYA12590.1|2921706_2922411_+	GMP synthase	NA	NA	NA	NA	NA
AYA12591.1|2922601_2922997_+	hypothetical protein	NA	NA	NA	NA	NA
AYA12592.1|2922993_2923689_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
AYA12593.1|2923818_2924703_+	cytidine deaminase	NA	NA	NA	NA	NA
AYA12594.1|2924830_2925547_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
AYA12595.1|2925671_2927060_+	glutamine synthetase	NA	NA	NA	NA	NA
AYA12596.1|2927109_2928120_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
AYA12597.1|2928135_2929656_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
AYA12598.1|2929735_2930734_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
AYA12599.1|2931029_2932052_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
AYA12600.1|2932207_2933365_-	DUF418 family protein	NA	NA	NA	NA	NA
AYA12601.1|2933384_2934053_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	6.9e-56
AYA12602.1|2934155_2935304_-	MFS transporter	NA	NA	NA	NA	NA
AYA12603.1|2935442_2936270_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AYA12604.1|2936428_2937586_+|transposase	transposase	transposase	NA	NA	NA	NA
AYA12605.1|2937666_2939637_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.9	1.6e-12
AYA12606.1|2939861_2941331_-	amino acid permease	NA	NA	NA	NA	NA
AYA12607.1|2941489_2942356_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYA12608.1|2942453_2943500_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
AYA12609.1|2943564_2944422_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	3.6e-25
AYA12610.1|2944468_2946154_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
AYA12611.1|2946170_2947109_-	1-phosphofructokinase	NA	NA	NA	NA	NA
AYA12612.1|2947108_2948239_-	bifunctional PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
AYA12613.1|2948600_2949782_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
AYA14528.1|2949778_2950033_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12614.1|2950197_2950770_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
AYA12615.1|2950887_2952078_-	mannonate dehydratase	NA	NA	NA	NA	NA
AYA12616.1|2952281_2953748_+	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	30.0	2.0e-39
AYA12617.1|2953870_2954857_+	GTP-binding protein	NA	NA	NA	NA	NA
AYA12618.1|2954878_2955604_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AYA12619.1|2956019_2956589_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	3.6e-13
AYA12620.1|2956716_2958273_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
AYA12621.1|2958346_2960152_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYA12622.1|2960161_2961256_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
AYA12623.1|2961255_2962281_+	ABC transporter permease	NA	NA	NA	NA	NA
AYA12624.1|2962282_2963872_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	2.7e-18
AYA12625.1|2963875_2964220_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12626.1|2964498_2965695_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	22.6	1.7e-20
AYA12627.1|2965710_2966418_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AYA12628.1|2966699_2968460_+	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	42.2	3.8e-101
AYA12629.1|2968585_2968870_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
AYA12630.1|2968920_2969928_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	2.9e-82
AYA12631.1|2970062_2970290_+	hypothetical protein	NA	NA	NA	NA	NA
AYA12632.1|2970309_2972070_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
AYA12633.1|2972324_2972645_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	68.9	3.1e-38
AYA12634.1|2972644_2972884_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	97.4	7.2e-40
AYA12635.1|2972983_2973223_+	virulence protein MsgA	NA	K7P797	Enterobacteria_phage	94.9	2.6e-34
AYA12636.1|2973308_2973719_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AYA12637.1|2973910_2974243_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.1	5.2e-20
AYA12638.1|2974321_2974564_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	79.2	4.0e-30
AYA12639.1|2974657_2975209_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	87.8	2.4e-86
AYA12640.1|2975386_2975806_-|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	61.0	7.2e-19
AYA12641.1|2976992_2977586_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
AYA12642.1|2977582_2978725_-|plate	phage baseplate protein	plate	A0A0A8WEY6	Clostridium_phage	34.8	6.2e-12
AYA12643.1|2978726_2979164_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	44.1	6.8e-12
AYA12644.1|2979160_2979703_-|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	30.8	5.9e-05
AYA12645.1|2979741_2980827_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	31.8	5.2e-45
>prophage 8
CP032291	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 chromosome, complete genome	5029558	2984936	3016374	5029558	tail,capsid,portal,head,holin,terminase	Enterobacterial_phage(25.0%)	49	NA	NA
AYA12649.1|2984936_2985215_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYA12650.1|2985216_2985588_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYA12651.1|2985591_2987094_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	42.0	4.2e-101
AYA12652.1|2987090_2987288_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AYA12653.1|2987291_2987837_-	ATP-binding protein	NA	NA	NA	NA	NA
AYA12654.1|2987833_2988193_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12655.1|2988197_2988608_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12656.1|2988579_2989629_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	3.6e-51
AYA12657.1|2989726_2990131_-|head	head decoration protein	head	NA	NA	NA	NA
AYA12658.1|2990130_2990721_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12659.1|2990722_2991589_-	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	46.0	4.8e-49
AYA12660.1|2991585_2993223_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	5.6e-91
AYA12661.1|2993222_2993486_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AYA12662.1|2993494_2995618_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.9	1.8e-97
AYA12663.1|2995559_2996126_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12664.1|2996416_2996920_+	hypothetical protein	NA	NA	NA	NA	NA
AYA14529.1|2996930_2997569_-	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	28.6	8.2e-06
AYA12665.1|2997811_2998171_-	cell envelope biogenesis protein TolA	NA	NA	NA	NA	NA
AYA12666.1|2998347_2998575_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	76.7	1.7e-19
AYA12667.1|2998791_2998989_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	88.6	8.3e-18
AYA12668.1|2998945_2999218_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12669.1|2999214_2999439_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12670.1|2999435_3000062_-	endolysin	NA	K7PJS7	Enterobacterial_phage	85.1	9.6e-100
AYA12671.1|3000061_3000343_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	4.1e-42
AYA12672.1|3000329_3000725_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
AYA12673.1|3000926_3001757_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.5	1.6e-57
AYA12674.1|3001769_3002759_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	94.2	7.3e-187
AYA12675.1|3002755_3003481_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	52.9	6.4e-55
AYA12676.1|3003496_3003886_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	96.0	1.1e-66
AYA12677.1|3003882_3004203_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	75.5	6.3e-39
AYA12678.1|3004199_3004427_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12679.1|3004423_3005083_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.5	1.2e-100
AYA12680.1|3005082_3005577_-	hypothetical protein	NA	NA	NA	NA	NA
AYA12681.1|3005573_3006515_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	58.7	2.4e-30
AYA12682.1|3006471_3006684_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AYA12683.1|3007418_3007676_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	79.5	2.2e-26
AYA12684.1|3007773_3008469_+	transcriptional regulator	NA	Q8HAA0	Salmonella_phage	73.0	1.1e-88
AYA12685.1|3009061_3009433_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	89.4	1.1e-55
AYA12686.1|3009486_3010317_+	hypothetical protein	NA	Q8HAA2	Salmonella_phage	77.2	1.8e-117
AYA12687.1|3010452_3010992_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	76.0	1.6e-74
AYA12688.1|3010979_3011177_+	hypothetical protein	NA	NA	NA	NA	NA
AYA12689.1|3011173_3011677_+	hypothetical protein	NA	NA	NA	NA	NA
AYA12690.1|3011673_3011895_+	conjugal transfer protein TraR	NA	A0A0P0ZCX5	Stx2-converting_phage	55.1	5.3e-13
AYA12691.1|3011901_3012114_+	hypothetical protein	NA	NA	NA	NA	NA
AYA12692.1|3012110_3012995_+	DNA methyltransferase	NA	Q5QF26	Pseudomonas_virus	50.0	1.2e-68
AYA12693.1|3012975_3013545_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	83.1	2.1e-93
AYA14530.1|3013592_3013802_+	hypothetical protein	NA	NA	NA	NA	NA
AYA12694.1|3013804_3014983_+	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	29.7	4.4e-29
AYA14531.1|3015459_3016374_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	55.7	1.5e-69
>prophage 9
CP032291	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 chromosome, complete genome	5029558	4027427	4076334	5029558	tRNA,tail,protease,integrase	Pseudomonas_phage(16.67%)	51	4044430:4044447	4086226:4086243
AYA14567.1|4027427_4027925_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	1.1e-26
AYA13557.1|4027930_4028569_-	stringent starvation protein A	NA	NA	NA	NA	NA
AYA13558.1|4028877_4029270_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AYA13559.1|4029285_4029714_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AYA13560.1|4030013_4031138_-	cell division protein ZapE	NA	NA	NA	NA	NA
AYA13561.1|4031327_4031726_+	hypothetical protein	NA	NA	NA	NA	NA
AYA13562.1|4031897_4033265_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.1	1.3e-21
AYA13563.1|4033356_4034424_+|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AYA13564.1|4034480_4035419_-	malate dehydrogenase	NA	NA	NA	NA	NA
AYA13565.1|4035816_4036287_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
AYA13566.1|4036662_4036926_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYA13567.1|4037036_4037303_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYA13568.1|4037364_4037637_-	hypothetical protein	NA	NA	NA	NA	NA
AYA13569.1|4037682_4039137_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYA13570.1|4039227_4041195_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AYA14568.1|4041200_4042133_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AYA13571.1|4042140_4042344_-	transporter	NA	NA	NA	NA	NA
AYA13572.1|4042523_4043450_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AYA13573.1|4043669_4044284_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AYA13574.1|4044330_4045776_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
4044430:4044447	attL	GTTATCCAGCTTCAGATC	NA	NA	NA	NA
AYA13575.1|4045860_4049658_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AYA13576.1|4049699_4051169_-	ribonuclease G	NA	NA	NA	NA	NA
AYA13577.1|4051158_4051752_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AYA13578.1|4051761_4052250_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYA13579.1|4052249_4053266_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AYA13580.1|4053328_4054372_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AYA13581.1|4054349_4054574_+	hypothetical protein	NA	NA	NA	NA	NA
AYA13582.1|4054654_4056595_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AYA13583.1|4056777_4057752_+	oxidoreductase	NA	NA	NA	NA	NA
AYA13584.1|4057829_4058831_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AYA13585.1|4058831_4059431_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AYA13586.1|4059665_4060118_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AYA13587.1|4060139_4060604_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AYA13588.1|4060614_4061964_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AYA13589.1|4062072_4062315_+	hypothetical protein	NA	NA	NA	NA	NA
AYA13590.1|4062304_4063756_+	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AYA13591.1|4063767_4064649_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AYA13592.1|4064776_4065517_+	carbonic anhydrase	NA	NA	NA	NA	NA
AYA13593.1|4065847_4066813_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AYA13594.1|4066836_4067133_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AYA13595.1|4067210_4069295_-|tail	phage tail tape measure protein	tail	A0A193GYN8	Enterobacter_phage	69.4	8.6e-254
AYA13596.1|4069316_4069529_-	hypothetical protein	NA	NA	NA	NA	NA
AYA13597.1|4069541_4069760_-	hypothetical protein	NA	NA	NA	NA	NA
AYA13598.1|4069761_4070094_-	hypothetical protein	NA	NA	NA	NA	NA
AYA13599.1|4070472_4070787_-	hypothetical protein	NA	NA	NA	NA	NA
AYA13600.1|4070789_4071701_-	hypothetical protein	NA	NA	NA	NA	NA
AYA13601.1|4072431_4072653_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14569.1|4072662_4073955_-	P-loop ATPase	NA	A0A1B0Z1F4	Shewanella_phage	41.6	5.1e-79
AYA13602.1|4074334_4074616_-	hypothetical protein	NA	NA	NA	NA	NA
AYA13603.1|4074624_4074804_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYA13604.1|4075098_4076334_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.2	7.1e-123
4086226:4086243	attR	GATCTGAAGCTGGATAAC	NA	NA	NA	NA
>prophage 1
CP032292	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence	105998	28181	91779	105998	integrase,protease,transposase	Escherichia_phage(23.53%)	54	45878:45897	84912:84931
AYA14620.1|28181_29162_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AYA14621.1|29218_29788_+	hypothetical protein	NA	NA	NA	NA	NA
AYA14622.1|29996_30680_+	type IV secretion system protein	NA	NA	NA	NA	NA
AYA14623.1|30676_31585_+	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
AYA14624.1|31627_32881_+	type VI secretion protein	NA	NA	NA	NA	NA
AYA14625.1|32877_33903_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AYA14626.1|33899_34298_+	Cag pathogenicity island protein Cag12	NA	NA	NA	NA	NA
AYA14627.1|34324_34630_+	kikA from plasmid origin	NA	NA	NA	NA	NA
AYA14628.1|34909_35215_+	dpoa decarboxylase	NA	NA	NA	NA	NA
AYA14629.1|35636_35981_+	hypothetical protein	NA	NA	NA	NA	NA
AYA14630.1|35983_37720_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AYA14631.1|37728_38484_+	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
AYA14632.1|38913_39174_+	hypothetical protein	NA	NA	NA	NA	NA
AYA14633.1|39173_39410_+	hypothetical protein	NA	NA	NA	NA	NA
AYA14634.1|40818_41457_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	39.6	4.2e-10
AYA14635.1|42003_42912_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYA14636.1|43011_43785_+	arpA protein	NA	NA	NA	NA	NA
AYA14637.1|43787_44861_-	DUF2817 domain-containing protein	NA	NA	NA	NA	NA
AYA14688.1|44898_45669_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
45878:45897	attL	TAGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
AYA14638.1|46026_47043_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
AYA14639.1|47523_48144_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYA14640.1|48308_49463_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYA14641.1|49459_49768_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYA14642.1|51120_52512_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYA14643.1|52579_53359_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.7	5.7e-09
AYA14644.1|53703_54627_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	3.9e-166
AYA14645.1|54737_55739_-|protease	CAAX protease	protease	NA	NA	NA	NA
AYA14646.1|55894_56476_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14647.1|57043_57262_+	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AYA14648.1|57263_57569_+	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AYA14649.1|58606_59854_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AYA14650.1|59942_61946_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYA14689.1|61996_62545_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.3	3.9e-49
AYA14651.1|62597_63470_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	3.6e-105
AYA14652.1|63617_64505_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	5.3e-27
AYA14653.1|64504_65590_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.3	7.7e-97
AYA14654.1|65656_66682_-	glycosyl transferase group 1 family protein	NA	NA	NA	NA	NA
AYA14655.1|66669_68682_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AYA14656.1|68751_69660_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYA14657.1|69748_70915_-	nucleotide sugar dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	55.3	8.8e-115
AYA14658.1|71373_72459_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14659.1|72886_76462_-	hypothetical protein	NA	A0A0F7L8V0	uncultured_marine_virus	24.6	6.2e-10
AYA14660.1|76749_77952_-	sugar transporter	NA	NA	NA	NA	NA
AYA14661.1|77966_78617_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.6	1.5e-07
AYA14662.1|78628_79429_-	ABC transporter	NA	NA	NA	NA	NA
AYA14663.1|79483_81256_-	sugar transporter	NA	NA	NA	NA	NA
AYA14664.1|81273_81648_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14665.1|83121_84111_+|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
AYA14666.1|84158_84527_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYA14667.1|84819_84939_-	ABC transporter	NA	NA	NA	NA	NA
84912:84931	attR	GCTTATTCGCACCTTCCCTA	NA	NA	NA	NA
AYA14668.1|85372_86383_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.9	6.7e-87
AYA14669.1|87123_88290_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
AYA14670.1|88289_89261_+	ParB/RepB/Spo0J family partition protein	NA	I3WF22	Macacine_betaherpesvirus	89.7	4.2e-155
AYA14671.1|90570_91779_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	81.8	3.0e-190
>prophage 1
CP032294	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed3, complete sequence	119757	1842	36386	119757	transposase,integrase	Escherichia_phage(27.27%)	32	1469:1483	10915:10929
1469:1483	attL	CAATATGTTTGATCG	NA	NA	NA	NA
AYA14762.1|1842_2625_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	6.0e-51
AYA14878.1|2729_3086_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14763.1|3175_3505_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14764.1|3532_3841_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14765.1|3893_4196_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14766.1|4810_5014_+	hypothetical protein	NA	NA	NA	NA	NA
AYA14767.1|5003_5294_-	korC	NA	NA	NA	NA	NA
AYA14768.1|5290_6418_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14769.1|6451_8044_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14770.1|8251_9031_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14771.1|9043_9544_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14772.1|9823_11098_+	hypothetical protein	NA	NA	NA	NA	NA
10915:10929	attR	CAATATGTTTGATCG	NA	NA	NA	NA
AYA14773.1|11147_11333_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14774.1|12708_13194_+	hypothetical protein	NA	NA	NA	NA	NA
AYA14775.1|13204_15208_+	hypothetical protein	NA	NA	NA	NA	NA
AYA14776.1|15462_16386_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	96.7	8.1e-172
AYA14777.1|16720_17841_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AYA14778.1|18175_19156_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AYA14779.1|21266_21518_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14780.1|22124_22427_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	42.9	1.7e-17
AYA14781.1|22432_22792_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	83.1	1.8e-50
AYA14782.1|22851_23346_+	chromosome partitioning protein ParB	NA	A0A0R6PHV6	Moraxella_phage	38.8	1.9e-18
AYA14783.1|24202_24973_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
AYA14784.1|25254_28152_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AYA14785.1|28246_28852_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AYA14786.1|29330_30335_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AYA14787.1|30413_33380_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.7	0.0e+00
AYA14788.1|33536_33827_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AYA14789.1|33823_34213_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AYA14790.1|34363_34723_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AYA14791.1|34745_35303_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.8	1.9e-59
AYA14792.1|35381_36386_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP032294	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed3, complete sequence	119757	108550	116806	119757		Escherichia_phage(33.33%)	7	NA	NA
AYA14869.1|108550_109525_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	2.4e-73
AYA14870.1|109753_110185_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	52.5	7.9e-29
AYA14871.1|110184_111456_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	2.1e-154
AYA14872.1|111946_112669_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	3.7e-23
AYA14873.1|113536_113764_-	hypothetical protein	NA	NA	NA	NA	NA
AYA14874.1|113808_114435_-	dna-binding plasmid partition protein	NA	A0A219YAQ5	Aeromonas_phage	35.9	1.3e-24
AYA14875.1|115282_116806_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	8.1e-44
