The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032296	Rahnella aquatilis strain ZF7 chromosome, complete genome	4994707	589630	663230	4994707	terminase,portal,tRNA,capsid,integrase,tail,holin,head	Cronobacter_phage(61.11%)	77	622827:622874	655021:655068
AYA05528.1|589630_590947_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.0	6.0e-35
AYA09296.1|591011_591566_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
AYA05529.1|591562_591721_-	hypothetical protein	NA	NA	NA	NA	NA
AYA05530.1|591939_593562_+	hypothetical protein	NA	NA	NA	NA	NA
AYA05531.1|593857_594646_+	hypothetical protein	NA	NA	NA	NA	NA
AYA05532.1|594859_595096_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYA05533.1|595227_596640_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AYA05534.1|596861_597485_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYA09297.1|597574_599113_-	hypothetical protein	NA	NA	NA	NA	NA
AYA05535.1|599167_599356_-	hypothetical protein	NA	NA	NA	NA	NA
AYA05536.1|599370_601284_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYA05537.1|601270_602611_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYA05538.1|602908_604774_-	hypothetical protein	NA	NA	NA	NA	NA
AYA05539.1|604958_608078_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
AYA05540.1|608070_609267_-	anticodon nuclease	NA	NA	NA	NA	NA
AYA05541.1|609268_610510_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYA05542.1|610506_612066_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	2.5e-104
AYA05543.1|612320_613184_+	GTPase family protein	NA	NA	NA	NA	NA
AYA05544.1|613271_614090_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.0	2.0e-44
AYA05545.1|614333_615044_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AYA05546.1|615087_615624_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
AYA05547.1|615674_616112_+	hypothetical protein	NA	NA	NA	NA	NA
AYA05548.1|616179_616578_+	hypothetical protein	NA	A0A1B2IBY1	Erwinia_phage	45.0	1.2e-26
AYA09298.1|616962_618021_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	34.6	2.2e-11
AYA05549.1|618198_620193_-	nuclease	NA	A0A2H4J1E0	uncultured_Caudovirales_phage	32.9	3.1e-27
AYA05550.1|620564_621044_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AYA05551.1|621057_621393_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AYA05552.1|621459_621780_+	toxin	NA	NA	NA	NA	NA
AYA05553.1|621893_622727_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
622827:622874	attL	ATTTGGTGGCCCTTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG	NA	NA	NA	NA
AYA05554.1|622990_624760_-	hypothetical protein	NA	NA	NA	NA	NA
AYA05555.1|624761_625790_-|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	64.4	1.8e-119
AYA05556.1|625792_626374_-	phage repressor protein	NA	Q94N02	Haemophilus_virus	35.2	1.0e-23
AYA05557.1|626514_626736_+	regulator	NA	NA	NA	NA	NA
AYA05558.1|626765_627275_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	52.8	1.9e-42
AYA05559.1|627284_627488_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
AYA05560.1|627490_627817_+	hypothetical protein	NA	NA	NA	NA	NA
AYA05561.1|627824_628256_+	hypothetical protein	NA	NA	NA	NA	NA
AYA05562.1|628329_628590_+	DUF2732 family protein	NA	NA	NA	NA	NA
AYA05563.1|628590_630747_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	60.5	1.2e-223
AYA05564.1|630848_631058_+	hypothetical protein	NA	NA	NA	NA	NA
AYA05565.1|631037_631298_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	62.8	9.9e-27
AYA05566.1|631348_632380_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	66.5	7.2e-137
AYA05567.1|632376_634164_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	71.7	1.4e-252
AYA05568.1|634314_635154_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	52.2	2.1e-49
AYA05569.1|635219_636254_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	75.4	1.1e-137
AYA05570.1|636256_636970_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	60.3	6.7e-73
AYA05571.1|636966_637158_+	hypothetical protein	NA	NA	NA	NA	NA
AYA05572.1|637251_637704_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	61.3	3.4e-46
AYA05573.1|637700_638207_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.8	9.0e-40
AYA05574.1|638203_638893_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	65.9	6.6e-78
AYA05575.1|638902_640030_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	69.8	8.7e-144
AYA05576.1|640032_640485_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	65.1	1.6e-51
AYA05577.1|640498_640795_+|holin	holin	holin	C7BGD7	Burkholderia_phage	54.3	1.3e-19
AYA05578.1|640791_641133_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	78.2	9.9e-43
AYA05579.1|641129_641504_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	54.4	1.8e-21
AYA05580.1|641448_641628_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	61.8	9.6e-13
AYA05581.1|641624_641882_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	55.8	2.2e-18
AYA05582.1|642069_644379_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	45.0	1.8e-164
AYA05583.1|644378_644711_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.7	9.1e-33
AYA05584.1|644703_645888_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	73.4	1.5e-162
AYA05585.1|645880_646468_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	72.8	6.0e-80
AYA05586.1|649177_649618_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	44.1	6.2e-21
AYA05587.1|649607_650330_+	hypothetical protein	NA	NA	NA	NA	NA
AYA05588.1|650304_650844_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	59.7	1.6e-47
AYA05589.1|650847_652503_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	57.6	2.6e-181
AYA05590.1|652565_652760_-	hypothetical protein	NA	NA	NA	NA	NA
AYA05591.1|653069_653342_+	hypothetical protein	NA	NA	NA	NA	NA
AYA05592.1|653439_654270_-	hypothetical protein	NA	NA	NA	NA	NA
AYA05593.1|654524_654893_-	hypothetical protein	NA	NA	NA	NA	NA
AYA05594.1|655242_655746_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
655021:655068	attR	ATTTGGTGGCCCTTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG	NA	NA	NA	NA
AYA05595.1|656024_656516_+	hypothetical protein	NA	NA	NA	NA	NA
AYA05596.1|656596_657199_+	protein rhiA	NA	NA	NA	NA	NA
AYA05597.1|657232_657700_+	hypothetical protein	NA	NA	NA	NA	NA
AYA05598.1|657760_659599_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
AYA05599.1|659801_661550_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.5	3.5e-75
AYA05600.1|661685_661901_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AYA05601.1|662216_663230_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	60.1	3.3e-110
>prophage 2
CP032296	Rahnella aquatilis strain ZF7 chromosome, complete genome	4994707	739167	807275	4994707	tRNA,tail,plate	Erwinia_phage(26.47%)	63	NA	NA
AYA09303.1|739167_740217_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AYA09302.1|740194_740962_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.7	6.3e-69
AYA05665.1|740951_741578_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	8.8e-37
AYA09304.1|741838_742843_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.2	2.2e-05
AYA05666.1|742894_743881_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.1	7.1e-33
AYA05667.1|743979_746535_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.7	6.4e-25
AYA05668.1|746957_749618_+	hypothetical protein	NA	NA	NA	NA	NA
AYA05669.1|749772_750876_+	murein transglycosylase B	NA	NA	NA	NA	NA
AYA05670.1|751037_751532_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	1.7e-27
AYA05671.1|751639_752704_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	3.2e-111
AYA05672.1|752824_753514_+	recombination regulator RecX	NA	NA	NA	NA	NA
AYA05673.1|753433_753715_-	hypothetical protein	NA	NA	NA	NA	NA
AYA05674.1|753652_756280_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.8	5.5e-80
AYA05675.1|756536_756722_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AYA05676.1|758020_758587_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AYA05677.1|758583_759012_+	DedA family protein	NA	NA	NA	NA	NA
AYA09305.1|759097_760669_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AYA05678.1|760826_761342_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AYA05679.1|761411_762701_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYA05680.1|762717_763509_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYA05681.1|763673_765035_+	signal recognition particle protein	NA	NA	NA	NA	NA
AYA05682.1|765213_765462_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYA05683.1|765480_766029_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYA05684.1|766096_766870_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYA05685.1|766918_767266_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYA05686.1|767357_767537_-	late control protein B	NA	F1BUT0	Erwinia_phage	75.5	6.4e-17
AYA05687.1|767601_768702_-|tail	phage tail protein	tail	Q6K1G4	Salmonella_virus	43.9	4.4e-84
AYA05688.1|768704_769175_-|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	50.0	1.7e-37
AYA05689.1|769171_770803_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	28.6	1.2e-16
AYA05690.1|770795_770930_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	78.9	6.7e-11
AYA05691.1|770950_771238_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	60.9	4.3e-23
AYA05692.1|771297_771807_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	68.4	3.1e-64
AYA05693.1|771821_772991_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	80.5	8.4e-182
AYA05694.1|773132_773681_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	42.1	2.7e-34
AYA05695.1|773677_775054_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	60.9	5.4e-63
AYA05696.1|775065_775593_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	69.2	5.6e-69
AYA05697.1|775585_776494_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	75.8	8.4e-121
AYA05698.1|776499_776850_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	63.8	9.9e-38
AYA05699.1|776846_777488_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	60.4	6.4e-67
AYA05700.1|777569_778031_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	43.3	1.1e-23
AYA05701.1|778123_778552_-	transcriptional regulator	NA	F1BUQ1	Erwinia_phage	48.3	1.4e-06
AYA05702.1|778552_779062_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	61.1	1.5e-55
AYA05703.1|779042_779264_-	hypothetical protein	NA	NA	NA	NA	NA
AYA05704.1|779254_779458_-|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	56.7	8.6e-18
AYA05705.1|779669_779864_-	hypothetical protein	NA	NA	NA	NA	NA
AYA05706.1|780012_781905_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	50.3	5.3e-178
AYA05707.1|781998_782220_-	conjugal transfer protein TraR	NA	A0A1S6L007	Salmonella_phage	44.3	4.6e-09
AYA05708.1|782219_782495_-	hypothetical protein	NA	NA	NA	NA	NA
AYA05709.1|782627_783218_+	CI repressor	NA	Q6K1G0	Salmonella_virus	51.3	1.8e-52
AYA05710.1|783506_784583_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.3	3.9e-85
AYA05711.1|784589_785711_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYA05712.1|785788_786943_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AYA05713.1|787254_787599_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AYA05714.1|787880_788615_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AYA05715.1|788745_789723_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AYA05716.1|789722_790460_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AYA05717.1|790590_793164_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.1	2.2e-126
AYA05718.1|798993_800292_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.3	2.9e-42
AYA05719.1|800481_801840_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AYA05720.1|801921_804642_-	bifunctional acyl-CoA synthetase/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYA05721.1|804673_805378_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AYA05722.1|805507_805927_-	thioredoxin TrxC	NA	A0A191VYI2	Roseobacter_phage	34.4	4.5e-13
AYA05723.1|806171_807275_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP032296	Rahnella aquatilis strain ZF7 chromosome, complete genome	4994707	1873122	1883384	4994707		Enterobacteria_phage(37.5%)	9	NA	NA
AYA06620.1|1873122_1873764_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	3.2e-34
AYA06621.1|1873801_1874383_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	1.5e-30
AYA06622.1|1874426_1876277_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AYA06623.1|1876355_1877945_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.6	8.2e-39
AYA06624.1|1878407_1879295_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.9	1.2e-60
AYA06625.1|1879410_1880283_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.6	1.0e-107
AYA06626.1|1880302_1881367_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	1.7e-101
AYA06627.1|1881978_1882515_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.0	5.5e-56
AYA06628.1|1882511_1883384_+	dTDP-4-dehydrorhamnose reductase	NA	K7QJU0	Escherichia_phage	37.5	6.3e-41
>prophage 4
CP032296	Rahnella aquatilis strain ZF7 chromosome, complete genome	4994707	2814826	2822962	4994707	tail,transposase	Cronobacter_phage(57.14%)	9	NA	NA
AYA07410.1|2814826_2815414_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	73.3	5.5e-81
AYA07411.1|2815406_2816591_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	73.4	9.7e-162
AYA07412.1|2816583_2816916_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.7	9.1e-33
AYA07413.1|2816915_2819186_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	44.4	6.7e-159
AYA07414.1|2819259_2820379_+|transposase	IS3-like element ISRaq1 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	5.1e-51
AYA07415.1|2820389_2820929_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.2	1.0e-04
AYA07416.1|2820919_2821240_-	hypothetical protein	NA	NA	NA	NA	NA
AYA07417.1|2821325_2821691_-	bleomycin resistance protein	NA	NA	NA	NA	NA
AYA07418.1|2821852_2822962_-	porin	NA	Q1MVN1	Enterobacteria_phage	57.4	9.6e-111
>prophage 5
CP032296	Rahnella aquatilis strain ZF7 chromosome, complete genome	4994707	3053343	3061826	4994707		Tupanvirus(33.33%)	8	NA	NA
AYA07618.1|3053343_3055326_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	24.6	2.8e-20
AYA07619.1|3055325_3056306_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.4	5.4e-33
AYA07620.1|3056305_3057448_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.9	5.0e-30
AYA07621.1|3057796_3058546_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	7.1e-09
AYA07622.1|3058565_3059117_-	glutathione peroxidase	NA	A0A1S7DMQ0	Molluscum_contagiosum_virus	41.6	9.2e-14
AYA07623.1|3059189_3060197_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AYA07624.1|3060350_3060749_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AYA07625.1|3061529_3061826_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
>prophage 1
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	0	14752	542014	lysis,transposase	Salmonella_phage(25.0%)	23	NA	NA
AYA09942.1|586_958_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	69.9	4.1e-42
AYA09477.1|1793_2036_+	hypothetical protein	NA	NA	NA	NA	NA
AYA09478.1|2332_3028_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	70.0	7.1e-88
AYA09479.1|3125_3371_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	62.7	4.4e-16
AYA09480.1|3396_3903_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	63.0	3.8e-46
AYA09481.1|4087_4276_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	54.5	6.1e-10
AYA09482.1|4265_5192_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	58.1	5.4e-75
AYA09483.1|5173_5878_+	DNA replication protein	NA	A0A193GYX1	Enterobacter_phage	43.8	9.9e-45
AYA09484.1|5874_6747_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	54.5	2.0e-87
AYA09485.1|6898_7912_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	43.4	6.5e-74
AYA09486.1|7925_8747_+	antitermination protein	NA	F1C595	Cronobacter_phage	45.2	5.7e-60
AYA09487.1|8978_9194_+	hypothetical protein	NA	NA	NA	NA	NA
AYA09488.1|9141_9660_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	28.0	1.9e-05
AYA09489.1|9778_9940_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	69.8	4.3e-12
AYA09490.1|10075_10648_+	hypothetical protein	NA	NA	NA	NA	NA
AYA09491.1|10661_10883_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09492.1|11016_11268_+	hypothetical protein	NA	NA	NA	NA	NA
AYA09493.1|11350_11683_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09494.1|11871_12177_+	hypothetical protein	NA	O64361	Escherichia_phage	55.6	4.9e-25
AYA09495.1|12178_12709_+	lysozyme	NA	Q7Y3V3	Yersinia_phage	80.0	1.4e-80
AYA09496.1|12701_13205_+|lysis	lysis protein	lysis	S4TP37	Salmonella_phage	36.4	3.5e-20
AYA09497.1|13201_13495_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09498.1|13631_14752_-|transposase	IS3-like element ISRaq1 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	5.1e-51
>prophage 2
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	22587	27425	542014		Mollivirus(50.0%)	5	NA	NA
AYA09503.1|22587_23349_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	A0A0M4JSW6	Mollivirus	29.3	1.3e-05
AYA09504.1|23417_24056_+	hypothetical protein	NA	NA	NA	NA	NA
AYA09505.1|24124_24445_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYA09506.1|24448_25630_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
AYA09507.1|25922_27425_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.0	9.1e-56
>prophage 3
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	31010	32696	542014		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYA09511.1|31010_32696_-	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	35.1	6.4e-82
>prophage 4
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	60528	63243	542014		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AYA09534.1|60528_63243_+	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	24.8	2.2e-39
>prophage 5
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	71671	72661	542014		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYA09541.1|71671_72661_-	acyltransferase	NA	A7ITI3	Paramecium_bursaria_Chlorella_virus	32.4	5.9e-11
>prophage 6
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	81148	84911	542014		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
AYA09547.1|81148_81469_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.6	4.1e-22
AYA09548.1|81513_82803_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.9	1.2e-165
AYA09549.1|82854_83286_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	4.0e-49
AYA09550.1|83357_84911_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.3	4.1e-160
>prophage 7
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	90426	91332	542014		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYA09555.1|90426_91332_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.2	3.8e-81
>prophage 8
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	95534	98312	542014		Lactobacillus_phage(100.0%)	1	NA	NA
AYA09560.1|95534_98312_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	30.4	3.8e-63
>prophage 9
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	107986	108664	542014		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AYA09566.1|107986_108664_+	SDR family oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	25.6	1.3e-09
>prophage 10
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	112067	113801	542014		Tupanvirus(100.0%)	1	NA	NA
AYA09570.1|112067_113801_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	26.0	4.5e-38
>prophage 11
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	118981	119761	542014		Cedratvirus(100.0%)	1	NA	NA
AYA09577.1|118981_119761_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	30.4	2.8e-16
>prophage 12
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	126304	134919	542014		Mycobacterium_phage(33.33%)	6	NA	NA
AYA09585.1|126304_127192_-	serine hydrolase	NA	A0A2P0ZZM8	Mycobacterium_phage	22.8	1.5e-05
AYA09586.1|127346_128105_+	hypothetical protein	NA	NA	NA	NA	NA
AYA09587.1|128156_130031_-	low affinity potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	28.1	3.0e-64
AYA09588.1|130226_130940_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09589.1|130978_132328_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09590.1|132348_134919_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	36.1	7.0e-88
>prophage 13
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	164150	165896	542014		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AYA09951.1|164150_165896_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.9	5.0e-21
>prophage 14
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	174554	181672	542014		Bacillus_virus(20.0%)	7	NA	NA
AYA09625.1|174554_175334_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.7	2.0e-14
AYA09626.1|175330_176050_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	4.9e-15
AYA09627.1|176083_176923_+	VOC family protein	NA	NA	NA	NA	NA
AYA09628.1|177122_178136_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYA09629.1|178382_178802_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.5	1.5e-32
AYA09630.1|178804_180067_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	70.8	1.9e-171
AYA09631.1|180235_181672_-	glycosyl hydrolase family protein	NA	A0A0B5JD41	Pandoravirus	27.3	9.1e-37
>prophage 15
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	185472	187874	542014		Clostridioides_phage(50.0%)	2	NA	NA
AYA09635.1|185472_186192_-	two-component system response regulator YehT	NA	A0A2R2ZGH8	Clostridioides_phage	24.5	1.4e-09
AYA09636.1|186185_187874_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	81.5	3.9e-249
>prophage 16
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	199890	206849	542014		Klosneuvirus(25.0%)	5	NA	NA
AYA09645.1|199890_201276_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	3.5e-25
AYA09646.1|201830_202244_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09647.1|202346_203234_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	70.9	1.4e-107
AYA09648.1|203359_205024_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	2.4e-17
AYA09649.1|205259_206849_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	8.0e-18
>prophage 17
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	235174	237367	542014		Bacillus_phage(100.0%)	2	NA	NA
AYA09674.1|235174_236641_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.6	4.6e-28
AYA09675.1|236644_237367_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	6.2e-34
>prophage 18
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	252167	255284	542014		Leptospira_phage(100.0%)	1	NA	NA
AYA09692.1|252167_255284_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.9	6.5e-40
>prophage 19
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	264200	268557	542014		Planktothrix_phage(66.67%)	4	NA	NA
AYA09699.1|264200_265610_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	27.3	8.1e-22
AYA09700.1|265610_266666_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYA09701.1|266923_267742_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	5.0e-08
AYA09702.1|267741_268557_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	5.5e-15
>prophage 20
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	274702	276364	542014		Planktothrix_phage(50.0%)	2	NA	NA
AYA09958.1|274702_275473_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.7	9.2e-28
AYA09959.1|275497_276364_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.8	1.0e-06
>prophage 21
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	281532	285390	542014		Pseudoalteromonas_phage(33.33%)	4	NA	NA
AYA09709.1|281532_282195_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	30.7	1.2e-15
AYA09710.1|282199_283105_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYA09711.1|283239_284661_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.9	3.7e-22
AYA09712.1|284700_285390_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	32.3	7.2e-16
>prophage 22
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	294116	296270	542014		Salmonella_phage(100.0%)	1	NA	NA
AYA09723.1|294116_296270_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.5	3.1e-129
>prophage 23
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	306473	307988	542014		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AYA09731.1|306473_307988_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.0	3.9e-14
>prophage 24
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	312938	313403	542014		Erwinia_phage(100.0%)	1	NA	NA
AYA09737.1|312938_313403_-	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	32.9	1.1e-07
>prophage 25
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	320203	320506	542014		Bacillus_phage(100.0%)	1	NA	NA
AYA09745.1|320203_320506_+	NINE protein	NA	M4ZS56	Bacillus_phage	70.3	8.3e-17
>prophage 26
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	323753	334011	542014		Escherichia_phage(33.33%)	8	NA	NA
AYA09750.1|323753_324374_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	54.8	1.5e-60
AYA09751.1|324370_326746_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	38.0	3.1e-143
AYA09752.1|327094_328552_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	30.4	2.1e-33
AYA09753.1|328727_329402_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYA09754.1|329557_330682_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.1	3.7e-17
AYA09755.1|330954_332214_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	29.1	1.7e-10
AYA09756.1|332225_333275_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AYA09757.1|333267_334011_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.1	1.7e-10
>prophage 27
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	337692	346563	542014		Klosneuvirus(20.0%)	6	NA	NA
AYA09759.1|337692_338961_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.1	2.4e-25
AYA09760.1|339107_340664_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.5	4.6e-18
AYA09761.1|340914_342000_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	1.3e-27
AYA09762.1|343368_343995_+	chromosome partitioning protein ParA	NA	D4HTX7	Vibrio_phage	37.8	2.3e-29
AYA09763.1|343991_344201_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AYA09764.1|345576_346563_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	29.8	6.7e-23
>prophage 28
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	350528	352495	542014		Bacillus_virus(50.0%)	2	NA	NA
AYA09768.1|350528_351533_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	1.9e-12
AYA09769.1|351529_352495_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.0	1.8e-17
>prophage 29
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	356199	357399	542014		Oenococcus_phage(100.0%)	1	NA	NA
AYA09773.1|356199_357399_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.6	4.3e-40
>prophage 30
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	363141	365241	542014		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AYA09776.1|363141_365241_-	lipase family protein	NA	G9E505	Ostreococcus_lucimarinus_virus	27.1	7.1e-06
>prophage 31
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	375679	377479	542014		Planktothrix_phage(100.0%)	1	NA	NA
AYA09972.1|375679_377479_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	5.0e-16
>prophage 32
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	384171	384888	542014		Planktothrix_phage(100.0%)	1	NA	NA
AYA09973.1|384171_384888_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.2	1.6e-37
>prophage 33
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	392451	393768	542014		Pandoravirus(100.0%)	1	NA	NA
AYA09797.1|392451_393768_-	cytochrome P450	NA	S4VXU7	Pandoravirus	32.0	3.5e-11
>prophage 34
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	400668	408801	542014		Tupanvirus(66.67%)	7	NA	NA
AYA09806.1|400668_402183_-	AMP-dependent synthetase	NA	A0A2K9KZV5	Tupanvirus	24.4	8.1e-28
AYA09807.1|402151_403705_-	AMP-dependent synthetase	NA	NA	NA	NA	NA
AYA09808.1|403705_403960_-	phosphopantetheine-containing protein	NA	NA	NA	NA	NA
AYA09809.1|403970_405551_-	long-chain fatty acid--CoA ligase	NA	A0A2K9KZV5	Tupanvirus	23.4	2.1e-26
AYA09810.1|405547_406570_-	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AYA09811.1|406572_407484_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09812.1|407493_408801_-	type III PLP-dependent enzyme	NA	A0A1V0SKK0	Klosneuvirus	22.7	2.7e-11
>prophage 35
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	441502	442039	542014		Leuconostoc_phage(100.0%)	1	NA	NA
AYA09974.1|441502_442039_+	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	39.8	8.1e-15
>prophage 36
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	461706	462483	542014		Mollivirus(100.0%)	1	NA	NA
AYA09873.1|461706_462483_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.2	1.1e-09
>prophage 37
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	465581	466322	542014		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYA09877.1|465581_466322_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	2.8e-13
>prophage 38
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	473859	478645	542014		Aeromonas_phage(33.33%)	5	NA	NA
AYA09885.1|473859_474615_-	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	26.3	5.1e-07
AYA09886.1|474842_475781_+	ABC transporter permease	NA	NA	NA	NA	NA
AYA09887.1|475777_476638_+	ABC transporter permease	NA	NA	NA	NA	NA
AYA09888.1|476634_477612_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	4.2e-09
AYA09889.1|477595_478645_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	31.8	6.1e-06
>prophage 39
CP032297	Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence	542014	487798	541608	542014	integrase,plate	uncultured_Caudovirales_phage(25.0%)	44	483526:483540	541215:541229
483526:483540	attL	AGGTGGCGATCACCG	NA	NA	NA	NA
AYA09898.1|487798_488236_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AYA09976.1|488228_488726_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYA09899.1|488745_489843_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYA09900.1|489806_491570_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYA09901.1|491879_492365_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09902.1|492561_493212_-	DUF2931 family protein	NA	NA	NA	NA	NA
AYA09903.1|493251_493899_-	DUF2931 family protein	NA	NA	NA	NA	NA
AYA09904.1|493938_494586_-	DUF2931 family protein	NA	NA	NA	NA	NA
AYA09905.1|494582_496166_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AYA09906.1|496195_498703_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.9	1.7e-14
AYA09907.1|498725_500330_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AYA09908.1|500329_503746_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AYA09909.1|503729_504893_-	type VI secretion protein	NA	NA	NA	NA	NA
AYA09910.1|504896_505163_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AYA09911.1|506375_507134_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09912.1|507165_507939_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09913.1|507935_509885_-	lipase family protein	NA	G9E505	Ostreococcus_lucimarinus_virus	29.9	7.8e-07
AYA09914.1|509931_510360_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09915.1|510356_510641_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09916.1|510692_513239_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.7	5.0e-14
AYA09917.1|513312_513657_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09918.1|514650_514830_-	hypothetical protein	NA	NA	NA	NA	NA
AYA09919.1|514839_517497_-	type VI secretion system ATPase TssH	NA	A0A1S6UBG5	Serratia_phage	32.8	1.2e-90
AYA09920.1|517659_518151_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYA09921.1|518183_519878_-	OmpA family protein	NA	NA	NA	NA	NA
AYA09922.1|519881_520535_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AYA09923.1|520531_521869_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYA09924.1|521880_523428_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AYA09925.1|523459_523954_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AYA09926.1|524800_526348_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	3.0e-09
AYA09927.1|528362_529487_+|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	27.1	2.1e-28
AYA09928.1|529633_531775_+	5-histidylcysteine sulfoxide synthase	NA	NA	NA	NA	NA
AYA09929.1|532073_532241_-	DUF4223 domain-containing protein	NA	NA	NA	NA	NA
AYA09930.1|532578_534177_+	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
AYA09931.1|534597_535464_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYA09932.1|535528_536308_-	(S)-acetoin forming diacetyl reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.5	1.9e-17
AYA09933.1|536537_536951_+	hypothetical protein	NA	NA	NA	NA	NA
AYA09934.1|537109_537298_+	hypothetical protein	NA	NA	NA	NA	NA
AYA09935.1|537907_538579_+	porin	NA	Q1MVN1	Enterobacteria_phage	58.2	1.4e-64
AYA09936.1|538653_539778_-|integrase	integrase	integrase	Q77Z04	Phage_21	51.7	2.3e-104
AYA09937.1|539761_540004_-	excisionase	NA	NA	NA	NA	NA
AYA09938.1|540337_540826_-	SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.8	7.5e-68
AYA09939.1|540818_541115_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	60.0	9.9e-23
AYA09940.1|541116_541608_-	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	44.7	2.0e-36
541215:541229	attR	CGGTGATCGCCACCT	NA	NA	NA	NA
