The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	1025936	1039071	4737445		Escherichia_phage(50.0%)	12	NA	NA
AXZ72202.1|1025936_1026698_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AXZ72203.1|1026691_1027318_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AXZ72204.1|1027457_1028549_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AXZ72205.1|1028611_1029604_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AXZ72206.1|1029697_1031062_-	permease	NA	NA	NA	NA	NA
AXZ72207.1|1031150_1031927_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AXZ72208.1|1031931_1032570_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AXZ72209.1|1032566_1033829_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AXZ72210.1|1033825_1034734_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AXZ72211.1|1034929_1035697_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AXZ72212.1|1035747_1036404_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
AXZ72213.1|1036509_1039071_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
>prophage 2
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	1399863	1410127	4737445		Enterobacteria_phage(57.89%)	20	NA	NA
AXZ72534.1|1399863_1400064_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AXZ72535.1|1400122_1400290_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	92.7	9.2e-26
AXZ75574.1|1400222_1400426_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ72536.1|1400970_1401276_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	88.0	6.8e-43
AXZ72537.1|1401272_1401734_-	hypothetical protein	NA	K7P7V4	Enterobacteria_phage	80.3	6.4e-53
AXZ72538.1|1401730_1401895_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
AXZ72539.1|1401911_1402226_-	hypothetical protein	NA	K7P7J8	Enterobacteria_phage	100.0	1.2e-50
AXZ72540.1|1402237_1402720_-	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	99.4	8.4e-80
AXZ72541.1|1402703_1403606_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	87.5	5.7e-146
AXZ72542.1|1403602_1403911_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	98.0	7.3e-53
AXZ72543.1|1403995_1404148_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
AXZ72544.1|1404132_1404267_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
AXZ72545.1|1404461_1404932_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
AXZ72546.1|1405315_1405510_+	hypothetical protein	NA	M1E1Y7	Enterobacteria_phage	74.4	1.1e-09
AXZ72547.1|1405741_1406935_+	acyltransferase	NA	B6SCW4	Bacteriophage	67.1	2.9e-137
AXZ72548.1|1406934_1408773_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.8	6.2e-248
AXZ75575.1|1408797_1409166_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	99.2	1.7e-64
AXZ72549.1|1409217_1409583_+	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	99.2	8.1e-67
AXZ72550.1|1409596_1409776_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
AXZ72551.1|1409875_1410127_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	89.2	2.5e-35
>prophage 3
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	1667266	1676707	4737445		Enterobacteria_phage(85.71%)	10	NA	NA
AXZ72779.1|1667266_1668193_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AXZ72780.1|1668197_1668929_+	ABC transporter permease	NA	NA	NA	NA	NA
AXZ72781.1|1668909_1669017_-	protein YohO	NA	NA	NA	NA	NA
AXZ72782.1|1669076_1669808_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AXZ72783.1|1670029_1671715_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AXZ72784.1|1671711_1672431_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXZ72785.1|1672477_1672948_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
AXZ72786.1|1672987_1673449_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AXZ72787.1|1673573_1675574_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
AXZ72788.1|1675570_1676707_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	1773916	1782626	4737445		Bacillus_phage(33.33%)	8	NA	NA
AXZ72857.1|1773916_1774810_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AXZ72858.1|1775119_1776139_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.3	2.9e-85
AXZ72859.1|1776157_1777174_+	glycosyltransferase	NA	NA	NA	NA	NA
AXZ72860.1|1777200_1778322_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	5.3e-133
AXZ72861.1|1778324_1779290_+	GDP-fucose synthetase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
AXZ72862.1|1779292_1779793_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AXZ72863.1|1779785_1781234_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.3	2.5e-58
AXZ72864.1|1781237_1782626_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	27.4	2.9e-32
>prophage 5
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	1805923	1813773	4737445	tail	Escherichia_phage(33.33%)	11	NA	NA
AXZ72889.1|1805923_1807102_+	DUF4102 domain-containing protein	NA	K7P7J2	Enterobacteria_phage	99.2	1.7e-230
AXZ72890.1|1807082_1807274_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
AXZ72891.1|1807362_1807668_-	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
AXZ72892.1|1807667_1808030_-	hypothetical protein	NA	U5P092	Shigella_phage	96.7	3.4e-65
AXZ72893.1|1808020_1808557_-	HD family hydrolase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
AXZ72894.1|1808705_1808930_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	63.1	4.1e-13
AXZ72895.1|1809070_1809358_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ72896.1|1809578_1810172_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	62.2	3.3e-57
AXZ72897.1|1810290_1811370_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ72898.1|1812131_1812263_+	umuD domain protein	NA	O64339	Escherichia_phage	64.3	1.8e-08
AXZ72899.1|1812606_1813773_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	6.1e-225
>prophage 6
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	2291790	2343933	4737445	transposase,holin,tail,terminase,protease	Enterobacteria_phage(31.25%)	62	NA	NA
AXZ73340.1|2291790_2292612_-|protease	serine protease	protease	NA	NA	NA	NA
AXZ73341.1|2292711_2292795_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ73342.1|2292887_2293223_-	acid shock protein	NA	NA	NA	NA	NA
AXZ73343.1|2293619_2294873_-	MFS transporter	NA	NA	NA	NA	NA
AXZ73344.1|2294979_2295873_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ73345.1|2296007_2297228_+	protein mlc	NA	NA	NA	NA	NA
AXZ73346.1|2297352_2298048_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AXZ73347.1|2298000_2299293_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AXZ73348.1|2299452_2300067_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AXZ73349.1|2300109_2300964_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AXZ73350.1|2300965_2301583_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	1.2e-75
AXZ75612.1|2301593_2304017_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AXZ73351.1|2304077_2306504_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.0e-213
AXZ73352.1|2306702_2307008_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AXZ73353.1|2307115_2307826_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AXZ73354.1|2307828_2308389_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AXZ73355.1|2308423_2308765_-	DUF1283 family protein	NA	NA	NA	NA	NA
AXZ73356.1|2308899_2309226_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AXZ73357.1|2309262_2309451_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ73358.1|2309431_2310646_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AXZ73359.1|2310657_2311695_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.8e-17
AXZ73360.1|2311733_2311862_+	transporter	NA	NA	NA	NA	NA
AXZ73361.1|2311863_2313159_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.8	2.1e-157
AXZ73362.1|2313178_2313430_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	48.7	6.4e-15
AXZ73363.1|2313502_2315974_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
AXZ73364.1|2316066_2316258_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXZ73365.1|2316254_2316443_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AXZ73366.1|2316929_2317547_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ75613.1|2317506_2317662_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	3.4e-06
AXZ73367.1|2317959_2318379_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
AXZ73368.1|2318458_2318713_+	DNA-binding protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
AXZ73369.1|2318709_2319135_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AXZ73370.1|2319206_2320277_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	1.9e-63
AXZ73371.1|2320317_2320740_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.1	2.4e-62
AXZ73372.1|2321002_2322394_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ75614.1|2322483_2323353_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ75615.1|2323609_2323753_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ73373.1|2323911_2324124_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
AXZ73374.1|2324582_2324861_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
AXZ73375.1|2324862_2325912_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
AXZ73376.1|2325929_2326307_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.7	6.9e-53
AXZ73377.1|2326462_2326987_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
AXZ73378.1|2327179_2328139_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AXZ73379.1|2328143_2328332_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ73380.1|2328536_2329259_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXZ73381.1|2329449_2329665_+|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	8.5e-32
AXZ73382.1|2329669_2329981_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
AXZ73383.1|2330329_2331538_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AXZ73384.1|2331845_2332343_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AXZ73385.1|2332706_2332919_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AXZ73386.1|2332929_2333118_+	cold-shock protein	NA	NA	NA	NA	NA
AXZ73387.1|2333148_2333421_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ73388.1|2333593_2333767_+	protein GnsB	NA	NA	NA	NA	NA
AXZ73389.1|2334062_2334269_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
AXZ73390.1|2334819_2335359_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	1.8e-94
AXZ73391.1|2335367_2336918_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.0	2.6e-300
AXZ73392.1|2337094_2338501_+|tail	phage tail tape measure protein	tail	K7PKI9	Enterobacteria_phage	75.8	9.7e-68
AXZ73393.1|2338500_2339076_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	8.5e-103
AXZ73394.1|2339173_2339764_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AXZ73395.1|2340081_2340315_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AXZ73396.1|2341100_2342384_+	MFS transporter	NA	NA	NA	NA	NA
AXZ73397.1|2342472_2343933_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.5	7.3e-42
>prophage 7
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	2384055	2469780	4737445	transposase,integrase	Bluetongue_virus(15.38%)	59	2385733:2385792	2466579:2467892
AXZ73433.1|2384055_2385396_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2385733:2385792	attL	GCTCTGATGAATCCCCTAATGATTTTGGTAAAAATCATTAAGTTAAGGTGGATACACATC	NA	NA	NA	NA
AXZ73434.1|2385842_2387051_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AXZ73435.1|2387047_2388100_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AXZ73436.1|2390473_2390902_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ73437.1|2391112_2391445_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXZ73438.1|2392407_2392704_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXZ73439.1|2392756_2393002_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ73440.1|2393283_2396817_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AXZ73441.1|2396800_2397580_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
AXZ73442.1|2399067_2400717_-	metallophosphoesterase	NA	NA	NA	NA	NA
AXZ73443.1|2400894_2404017_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ73444.1|2404117_2405551_-	restriction endonuclease	NA	NA	NA	NA	NA
AXZ73445.1|2405571_2406375_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	36.0	2.6e-33
AXZ75618.1|2406396_2406876_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ73446.1|2409096_2409627_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AXZ73447.1|2409639_2410143_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AXZ73448.1|2410201_2411116_+	fimbrial protein	NA	NA	NA	NA	NA
AXZ73449.1|2411449_2413729_+	putative oxidoreductase	NA	NA	NA	NA	NA
AXZ73450.1|2413976_2414174_+	two-component-system connector protein SafA	NA	NA	NA	NA	NA
AXZ73451.1|2414248_2415010_+	transcriptional regulator YdeO	NA	NA	NA	NA	NA
AXZ73452.1|2415411_2417094_+	sulfatase	NA	NA	NA	NA	NA
AXZ73453.1|2417145_2418303_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AXZ73454.1|2418593_2420279_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
AXZ73455.1|2420316_2422689_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXZ73456.1|2422733_2425529_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
AXZ73457.1|2425658_2425880_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ73458.1|2425890_2427291_+	glutamate decarboxylase beta	NA	NA	NA	NA	NA
AXZ73459.1|2427446_2428982_+	glutamate:gamma-aminobutyrate antiporter	NA	NA	NA	NA	NA
AXZ73460.1|2429112_2430432_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
AXZ73461.1|2432186_2434610_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
AXZ73462.1|2434867_2435449_+	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
AXZ73463.1|2435462_2437013_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ73464.1|2437014_2438037_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AXZ73465.1|2438033_2438930_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AXZ73466.1|2438926_2439913_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
AXZ73467.1|2439905_2440832_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	3.5e-13
AXZ73468.1|2440887_2441319_-	peroxiredoxin OsmC	NA	NA	NA	NA	NA
AXZ73469.1|2441663_2441879_+	protein bdm	NA	NA	NA	NA	NA
AXZ73470.1|2441980_2442118_+	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
AXZ73471.1|2442274_2443972_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
AXZ73472.1|2444105_2445116_+	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
AXZ73473.1|2445261_2445546_+	transcriptional regulator	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
AXZ73474.1|2445942_2446605_-	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
AXZ73475.1|2446597_2447482_-	formate dehydrogenase nitrate-inducible iron-sulfur subunit	NA	NA	NA	NA	NA
AXZ73476.1|2447494_2450542_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
AXZ73477.1|2450773_2451655_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
AXZ73478.1|2451914_2452205_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
AXZ73479.1|2453882_2455271_+	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
AXZ73480.1|2455352_2459093_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
AXZ73481.1|2459089_2460634_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
AXZ73482.1|2460633_2461329_+	nitrate reductase molybdenum cofactor assembly chaperone NarW	NA	NA	NA	NA	NA
AXZ73483.1|2461325_2462006_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AXZ73484.1|2462084_2462978_+	PhzF family isomerase	NA	NA	NA	NA	NA
AXZ73485.1|2463073_2463919_-	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
AXZ73486.1|2464091_2464661_+	flavin reductase family protein	NA	NA	NA	NA	NA
AXZ73487.1|2464657_2464891_-	tautomerase PptA	NA	NA	NA	NA	NA
AXZ73488.1|2464990_2466127_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AXZ73489.1|2466688_2467897_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
2466579:2467892	attR	GCTCTGATGAATCCCCTAATGATTTTGGTAAAAATCATTAAGTTAAGGTGGATACACATCTTGTCATATGATCAAATGGTTTCGCGAAAAATCAATAATCAGACAACAAGATGTGCGAACTCGATATTTTACACGACTCTCTTTACCAATTCTGCCCCGAATTACACTTAAAACGACTCAACAGCTTAACGTTGGCTTGCCACGCATTACTTGACTGTAAAACTCTCACTCTTACCGAACTTGGCCGTAACCTGCCAACCAAAGCGAGAACAAAACATAACATCAAACGAATCGACCGATTGTTAGGTAATCGTCACCTCCACAAAGAGCGACTCGCTGTATACCGTTGGCATGCTAGCTTTATCTGTTCGGGCAATACGATGCCCATTGTACTTGTTGACTGGTCTGATATTCGTGAGCAAAAACGACTTATGGTATTGCGAGCTTCAGTCGCACTACACGGTCGTTCTGTTACTCTTTATGAGAAAGCGTTCCCGCTTTCAGAGCAATGTTCAAAGAAAGCTCATGACCAATTTCTAGCCGACCTTGCGAGCATTCTACCGAGTAACACCACACCGCTCATTGTCAGTGATGCTGGCTTTAAAGTGCCATGGTATAAATCCGTTGAGAAGCTGGGTTGGTACTGGTTAAGTCGAGTAAGAGGAAAAGTACAATATGCAGACCTAGGAGCGGAAAACTGGAAACCTATCAGCAACTTACATGATATGTCATCTAGTCACTCAAAGACTTTAGGCTATAAGAGGCTGACTAAAAGCAATCCAATCTCATGCCAAATTCTATTGTATAAATCTCGCTCTAAAGGCCGAAAAAATCAGCGCTCGACACGGACTCATTGTCACCACCCGTCACCTAAAATCTACTCAGCGTCGGCAAAGGAGCCATGGGTTCTAGCAACTAACTTACCTGTTGAAATTCGAACACCCAAACAACTTGTTAATATCTATTCGAAGCGAATGCAGATTGAAGAAACCTTCCGAGACTTGAAAAGTCCTGCCTACGGACTAGGCCTACGCCATAGCCGAACGAGCAGCTCAGAGCGTTTTGATATCATGCTGCTAATCGCCCTGATGCTTCAACTAACATGTTGGCTTGCGGGCGTTCATGCTCAGAAACAAGGTTGGGACAAGCACTTCCAGGCTAACACAGTCAGAAATCGAAACGTACTCTCAACAGTTCGCTTAGGCATGGAAGTTTTGCGGCATTCTGGCTACACAATAACAAGGGAAGACTTACTCGTGGCTGCAACCCTACTAGCTCAAAATTTATTCACACATGGTTACGCTTTGGGGAAAT	NA	NA	NA	NA
AXZ73490.1|2468617_2469780_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 8
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	2559584	2568782	4737445	tail,coat	Enterobacteria_phage(57.14%)	7	NA	NA
AXZ73559.1|2559584_2560718_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
AXZ73560.1|2560858_2561293_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AXZ73561.1|2562264_2562498_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AXZ73562.1|2562814_2563405_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AXZ73563.1|2563502_2564078_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
AXZ73564.1|2564077_2567356_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.5e-06
AXZ73565.1|2567642_2568782_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.0	7.4e-159
>prophage 9
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	2581930	2600232	4737445	tRNA	Escherichia_phage(52.94%)	23	NA	NA
AXZ73581.1|2581930_2583934_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.4e-21
AXZ73582.1|2584268_2584691_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
AXZ73583.1|2584731_2585802_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
AXZ73584.1|2585873_2586299_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AXZ73585.1|2586282_2586564_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
AXZ73586.1|2586664_2587084_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AXZ73587.1|2587293_2587473_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ73588.1|2587483_2587639_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AXZ73589.1|2587635_2588124_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
AXZ73590.1|2588158_2588437_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ73591.1|2588565_2588787_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AXZ75629.1|2588786_2588957_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AXZ73592.1|2589031_2589307_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AXZ73593.1|2589408_2592009_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
AXZ73594.1|2592001_2592811_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	2.6e-105
AXZ73595.1|2592867_2593062_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AXZ73596.1|2593054_2593264_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AXZ73597.1|2593342_2593558_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AXZ73598.1|2594846_2595782_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.3e-145
AXZ73599.1|2595910_2597284_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	8.6e-53
AXZ73600.1|2597313_2597487_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ73601.1|2597761_2598745_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AXZ75630.1|2598999_2600232_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 10
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	2677329	2741781	4737445	capsid,plate,head,portal,lysis,tail,terminase,protease,integrase	Enterobacteria_phage(48.94%)	83	2697123:2697139	2741968:2741984
AXZ73675.1|2677329_2678379_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AXZ73676.1|2678598_2679357_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
AXZ73677.1|2679353_2679944_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AXZ73678.1|2679983_2680859_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AXZ73679.1|2681069_2682965_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AXZ73680.1|2682992_2683613_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AXZ73681.1|2683609_2684491_-	phosphatase	NA	NA	NA	NA	NA
AXZ75633.1|2684628_2684673_+	trp operon leader peptide	NA	NA	NA	NA	NA
AXZ73682.1|2684764_2686327_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AXZ73683.1|2686326_2687922_+	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AXZ73684.1|2689294_2690488_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXZ73685.1|2690487_2691294_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXZ73686.1|2691674_2691854_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ73687.1|2691939_2692440_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXZ73688.1|2692485_2692992_+	YciE/YciF family protein	NA	NA	NA	NA	NA
AXZ73689.1|2693051_2693690_-	outer membrane protein W	NA	NA	NA	NA	NA
AXZ73690.1|2694046_2694790_+	UPF0259 family protein	NA	NA	NA	NA	NA
AXZ73691.1|2694819_2695359_+	intracellular septation protein A	NA	NA	NA	NA	NA
AXZ73692.1|2695463_2695862_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXZ75634.1|2695901_2696621_-	protein TonB	NA	NA	NA	NA	NA
AXZ73693.1|2696844_2697141_+	YciI family protein	NA	NA	NA	NA	NA
2697123:2697139	attL	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
AXZ73694.1|2697259_2697808_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	100.0	2.7e-98
AXZ73695.1|2697863_2698400_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.9	1.1e-38
AXZ73696.1|2698399_2698999_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	54.3	6.9e-55
AXZ73697.1|2698970_2699579_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	62.4	4.4e-65
AXZ75635.1|2699578_2700040_-|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	71.2	2.8e-56
AXZ73698.1|2700379_2700973_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
AXZ73699.1|2700969_2702112_-|plate	baseplate J/gp47 family protein	plate	A0A0A8WEY6	Clostridium_phage	34.8	6.2e-12
AXZ73700.1|2702113_2702551_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	45.8	4.0e-12
AXZ73701.1|2702547_2703090_-|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	30.8	3.5e-05
AXZ73702.1|2703128_2704214_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	31.5	9.9e-44
AXZ73703.1|2704210_2705614_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ73704.1|2705682_2707620_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	30.7	2.3e-19
AXZ73705.1|2707761_2708040_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXZ73706.1|2708041_2708413_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXZ73707.1|2708416_2709919_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	42.4	1.9e-101
AXZ73708.1|2709915_2710113_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AXZ73709.1|2710116_2710662_-	ATP-binding protein	NA	NA	NA	NA	NA
AXZ73710.1|2710658_2711018_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ73711.1|2711022_2711433_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ73712.1|2711404_2712454_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	3.6e-51
AXZ73713.1|2712551_2712956_-|head	head decoration protein	head	NA	NA	NA	NA
AXZ73714.1|2712955_2713546_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ73715.1|2713547_2714414_-	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.9	4.8e-49
AXZ73716.1|2714410_2716048_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	3.3e-91
AXZ73717.1|2716047_2716311_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AXZ73718.1|2716319_2718443_-|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	35.6	1.8e-97
AXZ73719.1|2718384_2718954_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ75636.1|2719244_2719748_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ73720.1|2719758_2720397_-	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	28.6	1.1e-05
AXZ73721.1|2720473_2720878_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
AXZ73722.1|2720910_2721372_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	63.8	3.9e-42
AXZ73723.1|2721371_2721905_-	lysozyme	NA	K7PM52	Enterobacteria_phage	88.4	3.2e-88
AXZ73724.1|2721904_2722207_-	hypothetical protein	NA	O64361	Escherichia_phage	66.3	5.4e-32
AXZ73725.1|2722275_2723328_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	81.4	5.8e-174
AXZ73726.1|2723537_2723942_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ73727.1|2723941_2724697_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ73728.1|2725610_2726420_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	70.3	5.0e-109
AXZ73729.1|2726419_2726557_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	76.3	1.2e-07
AXZ73730.1|2726553_2726910_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	92.4	8.5e-61
AXZ75637.1|2726906_2727188_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	98.9	2.7e-46
AXZ73731.1|2727190_2727397_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	65.2	1.1e-20
AXZ73732.1|2727396_2727996_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	93.0	2.7e-104
AXZ73733.1|2728030_2728279_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	98.8	8.0e-42
AXZ73734.1|2728396_2728630_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	100.0	2.3e-38
AXZ73735.1|2728895_2729237_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ73736.1|2729707_2730016_-	hypothetical protein	NA	O64351	Escherichia_phage	85.3	4.8e-44
AXZ73737.1|2730290_2730536_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	60.0	4.7e-18
AXZ75638.1|2730535_2731117_-	ead/Ea22-like family protein	NA	A0A088CQ13	Enterobacteria_phage	98.1	7.1e-57
AXZ73738.1|2731128_2731473_-	winged helix-turn-helix transcriptional regulator	NA	K7PHG5	Enterobacteria_phage	99.1	2.2e-58
AXZ73739.1|2731474_2732164_-	phage replication protein	NA	K7P7B6	Enterobacteria_phage	100.0	6.8e-131
AXZ73740.1|2732160_2733069_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	100.0	1.2e-159
AXZ73741.1|2733153_2733711_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	41.1	6.4e-23
AXZ73742.1|2733722_2733941_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.8	1.5e-20
AXZ75639.1|2734013_2734433_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	77.1	3.1e-46
AXZ73743.1|2734497_2734779_+	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	75.3	2.2e-32
AXZ75640.1|2735016_2735307_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75641.1|2735762_2735969_+	cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	100.0	1.5e-33
AXZ73744.1|2736280_2738944_+	exodeoxyribonuclease VIII	NA	K7PJT5	Enterobacteria_phage	66.1	0.0e+00
AXZ73745.1|2738955_2740071_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	87.9	5.5e-183
AXZ73746.1|2740109_2740352_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	100.0	4.0e-38
AXZ73747.1|2740393_2740591_+	excisionase	NA	K7PM28	Enterobacteria_phage	100.0	8.3e-34
AXZ73748.1|2740587_2741781_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
2741968:2741984	attR	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
>prophage 11
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	3085162	3141909	4737445	portal,tRNA,tail,terminase,protease	Salmonella_phage(13.64%)	52	NA	NA
AXZ74063.1|3085162_3086455_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AXZ74064.1|3086545_3087889_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AXZ74065.1|3087899_3088511_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXZ74066.1|3088665_3092694_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AXZ74067.1|3092828_3093323_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AXZ74068.1|3093867_3094833_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AXZ74069.1|3094955_3096722_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AXZ74070.1|3096722_3098444_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
AXZ74071.1|3098485_3099190_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXZ74072.1|3099474_3099693_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXZ74073.1|3100733_3103010_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
AXZ74074.1|3103040_3103361_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AXZ74075.1|3103683_3103908_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AXZ74076.1|3103980_3105927_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AXZ74077.1|3105923_3107039_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AXZ74078.1|3107153_3108146_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AXZ74079.1|3108142_3109801_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AXZ74080.1|3110226_3110922_+	aquaporin	NA	NA	NA	NA	NA
AXZ74081.1|3111416_3112316_+	transporter	NA	NA	NA	NA	NA
AXZ74082.1|3112459_3114112_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AXZ74083.1|3114123_3115092_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXZ74084.1|3115224_3116943_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
AXZ74085.1|3116979_3117981_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AXZ74086.1|3117991_3119422_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXZ75663.1|3119520_3120534_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXZ74087.1|3120530_3121361_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AXZ74088.1|3121357_3121681_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ74089.1|3121806_3122322_+	lipoprotein	NA	NA	NA	NA	NA
AXZ74090.1|3122539_3123268_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AXZ74091.1|3123285_3124017_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ74092.1|3124031_3124739_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AXZ74093.1|3124738_3125407_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AXZ74094.1|3125697_3126429_+	ABC transporter arginine-binding protein 1	NA	NA	NA	NA	NA
AXZ74095.1|3126627_3127755_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
AXZ74096.1|3127795_3128284_-	DUF2593 family protein	NA	NA	NA	NA	NA
AXZ74097.1|3128343_3129189_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AXZ74098.1|3129185_3130139_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AXZ74099.1|3130148_3131282_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AXZ74100.1|3131376_3132489_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AXZ74101.1|3132839_3133316_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AXZ74102.1|3133403_3134306_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AXZ74103.1|3134366_3135089_-	nitroreductase NfsA	NA	NA	NA	NA	NA
AXZ74104.1|3135072_3135360_-	DUF1418 family protein	NA	NA	NA	NA	NA
AXZ74105.1|3135519_3135777_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AXZ74106.1|3135806_3136184_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ74107.1|3136453_3138139_+	transporter	NA	NA	NA	NA	NA
AXZ74108.1|3138374_3138593_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	67.6	1.7e-19
AXZ74109.1|3139390_3139498_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXZ74110.1|3139512_3139815_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AXZ74111.1|3139869_3140268_-	hypothetical protein	NA	F1BUR5	Erwinia_phage	71.6	1.8e-27
AXZ74112.1|3140266_3140881_+|terminase	terminase-like protein	terminase	A0A1S6KZW3	Salmonella_phage	100.0	1.7e-117
AXZ74113.1|3140880_3141909_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.1	2.6e-171
>prophage 12
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	3145918	3153966	4737445	integrase	Salmonella_phage(83.33%)	13	3146662:3146676	3157171:3157185
AXZ74118.1|3145918_3146224_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AXZ74119.1|3146162_3146351_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
AXZ74120.1|3146503_3148918_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
3146662:3146676	attL	GCTGTCGCTGATGGT	NA	NA	NA	NA
AXZ74121.1|3148914_3149772_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	1.3e-160
AXZ74122.1|3149768_3149996_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AXZ74123.1|3149995_3150229_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
AXZ74124.1|3150296_3150638_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	91.2	2.6e-51
AXZ74125.1|3150755_3151052_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
AXZ74126.1|3151059_3151569_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
AXZ74127.1|3151601_3151823_-	regulator	NA	NA	NA	NA	NA
AXZ74128.1|3151948_3152518_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AXZ74129.1|3152533_3152725_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	70.5	2.4e-09
AXZ74130.1|3152913_3153966_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3157171:3157185	attR	ACCATCAGCGACAGC	NA	NA	NA	NA
>prophage 13
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	3453609	3479028	4737445	lysis,transposase,tail,protease,integrase	Enterobacteria_phage(53.33%)	25	3462092:3462138	3479042:3479088
AXZ74391.1|3453609_3454746_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AXZ74392.1|3455016_3457128_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
AXZ74393.1|3460213_3461104_+	DUF4434 family protein	NA	NA	NA	NA	NA
AXZ74394.1|3461017_3461230_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ74395.1|3461286_3462048_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ74396.1|3462041_3462158_+	hypothetical protein	NA	NA	NA	NA	NA
3462092:3462138	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AXZ74397.1|3462561_3463515_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AXZ74398.1|3465313_3465607_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ74399.1|3465617_3466322_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.6e-58
AXZ74400.1|3466331_3466613_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	2.4e-18
AXZ74401.1|3466609_3468958_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	1.2e-91
AXZ74402.1|3469016_3470054_-	hypothetical protein	NA	A0A291AWT4	Escherichia_phage	98.6	1.3e-122
AXZ74403.1|3470255_3470357_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ74404.1|3470504_3470738_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
AXZ74405.1|3470795_3471206_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AXZ74406.1|3471251_3471422_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ74407.1|3471389_3472007_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
AXZ74408.1|3472156_3472615_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	99.3	6.0e-75
AXZ74409.1|3472611_3473109_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
AXZ74410.1|3473108_3473324_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AXZ74411.1|3473897_3474980_+	porin	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
AXZ74412.1|3475169_3475553_-	antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	5.2e-56
AXZ74413.1|3475814_3476570_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AXZ74414.1|3476636_3477500_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	62.1	1.8e-93
AXZ74415.1|3477909_3479028_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	85.9	4.8e-187
3479042:3479088	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 14
CP032237	Escherichia coli strain ECCWS199 chromosome, complete genome	4737445	3709356	3773295	4737445	holin,tail,transposase,integrase	Enterobacteria_phage(30.0%)	54	3729067:3729083	3775516:3775532
AXZ74630.1|3709356_3711390_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AXZ75682.1|3711386_3711602_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ74631.1|3711518_3712106_+	transcriptional regulator	NA	NA	NA	NA	NA
AXZ74632.1|3712119_3713592_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AXZ74633.1|3713605_3715276_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	1.8e-60
AXZ74634.1|3715488_3716157_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ74635.1|3716128_3716326_+	universal stress protein	NA	NA	NA	NA	NA
AXZ74636.1|3716232_3716445_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ74637.1|3716399_3717095_-	lactate utilization protein C	NA	NA	NA	NA	NA
AXZ74638.1|3717087_3718515_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AXZ74639.1|3718525_3719245_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AXZ74640.1|3719771_3720626_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ74641.1|3720851_3722177_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
AXZ74642.1|3722285_3722522_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXZ74643.1|3722533_3723127_+	protein RclC	NA	NA	NA	NA	NA
AXZ74644.1|3723683_3724550_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXZ74645.1|3725484_3729741_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
3729067:3729083	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
AXZ74646.1|3730855_3730957_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ74647.1|3731320_3731584_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AXZ74648.1|3731583_3731724_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AXZ74649.1|3731758_3731986_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ74650.1|3732047_3732227_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ74651.1|3732760_3733351_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXZ74652.1|3733425_3734013_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
AXZ74653.1|3734070_3734739_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
AXZ74654.1|3734764_3737290_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AXZ74655.1|3737279_3738923_+	fimbria adhesin EcpD	NA	NA	NA	NA	NA
AXZ74656.1|3738891_3739602_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
AXZ74657.1|3739914_3740244_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXZ75683.1|3740238_3740418_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ74658.1|3741217_3741343_+	transporter	NA	NA	NA	NA	NA
AXZ74659.1|3741522_3742212_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AXZ74660.1|3742208_3743165_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
AXZ74661.1|3743161_3745360_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.3e-38
AXZ74662.1|3746303_3746714_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ74663.1|3746964_3747117_-|integrase	attP region and P4int integrase	integrase	NA	NA	NA	NA
AXZ74664.1|3748559_3749159_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.0	3.3e-110
AXZ74665.1|3749228_3749621_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.6	1.0e-35
AXZ74666.1|3749518_3750253_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.5e-144
AXZ74667.1|3750455_3751103_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXZ74668.1|3751853_3752924_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.2	5.1e-69
AXZ74669.1|3753194_3754466_+	maltoporin	NA	NA	NA	NA	NA
AXZ74670.1|3754602_3754917_-	PTS sugar transporter	NA	NA	NA	NA	NA
AXZ74671.1|3754980_3757038_-	beta-galactosidase	NA	NA	NA	NA	NA
AXZ74672.1|3757069_3758272_-	galactosidase	NA	NA	NA	NA	NA
AXZ74673.1|3758276_3759128_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AXZ74674.1|3759138_3760446_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AXZ74675.1|3760508_3761741_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AXZ74676.1|3762097_3763207_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	3.3e-26
AXZ74677.1|3765933_3766497_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AXZ74678.1|3767355_3768789_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AXZ74679.1|3769362_3769590_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXZ74680.1|3770297_3771914_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ74681.1|3772133_3773295_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
3775516:3775532	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
>prophage 1
CP032238	Escherichia coli strain ECCWS199 plasmid pTB221, complete sequence	162163	16564	61619	162163	tail,head,transposase	Pseudomonas_phage(16.67%)	55	NA	NA
AXZ75750.1|16564_17764_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXZ75751.1|17773_17962_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ75752.1|18017_18245_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75753.1|18259_18601_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ75754.1|18718_19180_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
AXZ75755.1|19182_19680_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75756.1|19894_20599_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ75757.1|21149_21854_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ75758.1|21887_22379_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ75759.1|23654_25148_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXZ75760.1|25178_26063_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AXZ75761.1|26285_27500_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AXZ75762.1|27527_27833_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ75763.1|28099_29299_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AXZ75764.1|29377_30055_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ75765.1|30086_30329_-	relaxase	NA	NA	NA	NA	NA
AXZ75766.1|30634_31471_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXZ75767.1|31470_32274_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AXZ75768.1|32334_33150_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AXZ75769.1|33453_33765_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75770.1|33938_34724_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
AXZ75771.1|34727_35909_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
AXZ75772.1|35957_36230_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75773.1|36282_36918_-	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AXZ75774.1|37471_37849_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
AXZ75775.1|37841_38123_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75776.1|38097_38772_+	thymidylate kinase	NA	NA	NA	NA	NA
AXZ75912.1|38839_39271_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75777.1|39255_39588_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75778.1|39596_40097_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
AXZ75779.1|40100_41528_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
AXZ75780.1|41527_42184_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75781.1|42389_42608_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75782.1|42701_43319_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AXZ75783.1|43319_43526_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75784.1|43530_43830_+	ASCH domain-containing protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	2.1e-20
AXZ75785.1|43921_44410_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ75786.1|44424_46617_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	1.7e-42
AXZ75787.1|46616_46850_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ75788.1|46831_47449_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ75789.1|47616_50589_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AXZ75790.1|50585_52451_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AXZ75791.1|52461_53046_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75792.1|53002_53632_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
AXZ75793.1|53641_54088_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75794.1|54097_54475_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75795.1|54474_55137_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75796.1|55460_55838_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75797.1|55982_56264_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AXZ75798.1|56260_56887_+	pilus assembly protein	NA	NA	NA	NA	NA
AXZ75799.1|56870_57788_+	conjugal transfer protein TraK	NA	NA	NA	NA	NA
AXZ75800.1|57784_59101_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AXZ75801.1|59097_59676_+	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AXZ75802.1|59679_60072_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AXZ75803.1|60356_61619_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 2
CP032238	Escherichia coli strain ECCWS199 plasmid pTB221, complete sequence	162163	96251	122228	162163	integrase,transposase	Escherichia_phage(25.0%)	31	106508:106521	118520:118533
AXZ75838.1|96251_97364_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AXZ75839.1|97618_97963_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75840.1|98040_98343_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75841.1|98420_100046_+	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
AXZ75842.1|100061_100538_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75843.1|100611_101166_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75844.1|101398_101785_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75845.1|101872_104326_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
AXZ75846.1|104527_104731_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75847.1|104802_105408_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
AXZ75848.1|105400_105670_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75914.1|105683_105902_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75849.1|105975_106533_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
106508:106521	attL	CTGAATTAAGCCGC	NA	NA	NA	NA
AXZ75850.1|106607_107459_+	NgrC	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
AXZ75851.1|107917_108304_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75852.1|108481_110209_+	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
AXZ75853.1|110195_110474_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75854.1|110546_110768_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75855.1|110949_111954_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AXZ75856.1|112032_115005_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AXZ75857.1|115007_115565_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AXZ75858.1|115602_115923_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ75859.1|115861_116875_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ75860.1|117226_117883_+	quinolone resistance pentapeptide repeat protein QnrVC4	NA	NA	NA	NA	NA
AXZ75861.1|117862_118000_-	DUF1196 domain-containing protein	NA	NA	NA	NA	NA
AXZ75862.1|118139_118472_+	quaternary ammonium compound efflux SMR transporter QacF	NA	NA	NA	NA	NA
AXZ75863.1|118717_119518_+	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
118520:118533	attR	GCGGCTTAATTCAG	NA	NA	NA	NA
AXZ75915.1|119534_120326_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AXZ75864.1|120360_120834_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AXZ75865.1|121054_121321_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AXZ75866.1|121463_122228_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 1
CP032239	Escherichia coli strain ECCWS199 plasmid pTB222, complete sequence	159756	3454	76978	159756	integrase,holin,transposase	Escherichia_phage(57.78%)	61	6760:6776	19570:19586
AXZ75921.1|3454_4159_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
6760:6776	attL	GATGGCACTGTTGCAAA	NA	NA	NA	NA
AXZ75922.1|6814_7519_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXZ75923.1|7723_8515_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AXZ75924.1|8520_8811_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AXZ75925.1|8922_9420_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AXZ75926.1|9564_10578_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ75927.1|10516_11131_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AXZ75928.1|11306_11867_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AXZ75929.1|11870_14837_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AXZ75930.1|14957_16034_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXZ75931.1|17376_17793_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXZ75932.1|17789_18020_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXZ76044.1|19544_19706_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	64.1	1.0e-05
19570:19586	attR	TTTGCAACAGTGCCATC	NA	NA	NA	NA
AXZ75933.1|22079_22790_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75934.1|22950_24411_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXZ75935.1|24388_25747_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXZ75936.1|26570_28676_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
AXZ75937.1|28739_30890_+	cellulose synthase regulator BcsB	NA	NA	NA	NA	NA
AXZ75938.1|31633_32980_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	4.0e-26
AXZ75939.1|33580_34853_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
AXZ75940.1|35355_38829_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
AXZ75941.1|40602_41337_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ75942.1|42372_42564_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	98.3	2.5e-27
AXZ75943.1|42645_42864_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AXZ75944.1|42865_43093_+	hypothetical protein	NA	A0A077SL55	Escherichia_phage	100.0	6.2e-17
AXZ75945.1|43029_44127_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	97.5	4.9e-200
AXZ75946.1|44199_44706_+	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	98.8	2.7e-92
AXZ75947.1|44972_48089_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	1.3e-27
AXZ75948.1|48210_49479_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AXZ76045.1|49475_51032_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	4.9e-105
AXZ75949.1|51214_51436_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AXZ75950.1|51435_51816_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	2.8e-62
AXZ75951.1|51820_52000_+	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
AXZ75952.1|52027_53071_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.6	8.2e-205
AXZ75953.1|53194_54118_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
AXZ75954.1|54331_54451_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75955.1|54469_54691_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	81.2	6.0e-25
AXZ75956.1|54687_55803_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	92.2	4.0e-189
AXZ75957.1|55835_56687_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
AXZ75958.1|56797_57007_-	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
AXZ75959.1|56972_57068_-	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AXZ75960.1|58043_59024_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AXZ75961.1|59062_59173_-	ABC transporter	NA	NA	NA	NA	NA
AXZ75962.1|59156_59249_-	peptidase	NA	Q38401	Escherichia_phage	100.0	2.3e-07
AXZ75963.1|59660_59882_+	creatininase	NA	Q5QBN7	Enterobacteria_phage	97.3	4.2e-34
AXZ75964.1|59889_60921_+	recombinase	NA	A0A077SLE7	Escherichia_phage	99.1	1.9e-193
AXZ75965.1|60971_61283_+	lysogeny establishment protein	NA	A0A077SK03	Escherichia_phage	97.1	8.8e-46
AXZ75966.1|61528_62089_+	recombinase	NA	Q5QBN4	Enterobacteria_phage	95.7	2.8e-95
AXZ75967.1|62175_62925_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	48.6	8.3e-66
AXZ75968.1|63080_63722_+	maturation control protein	NA	A0A077SK30	Escherichia_phage	95.8	2.3e-109
AXZ75969.1|63824_64952_+	GTP pyrophosphokinase	NA	A0A1B0VBT5	Salmonella_phage	74.4	2.0e-156
AXZ75970.1|64988_65237_-	modulator protein	NA	Q71TG0	Escherichia_phage	98.8	4.0e-41
AXZ75971.1|65233_65674_-	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AXZ75972.1|65793_66955_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AXZ75973.1|66969_67218_-|holin	holin	holin	Q71TF4	Escherichia_phage	100.0	2.5e-35
AXZ76046.1|67210_67768_-	lysozyme	NA	Q71TF3	Escherichia_phage	98.9	6.1e-106
AXZ75974.1|67937_68426_+	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	98.8	2.5e-87
AXZ75975.1|68659_69772_-	porin	NA	Q1MVN1	Enterobacteria_phage	98.4	3.4e-201
AXZ75976.1|70438_70750_-	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
AXZ76047.1|70739_72017_-	ddrB domain protein	NA	Q1MVM9	Enterobacteria_phage	98.6	1.1e-235
AXZ75977.1|73462_76978_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.1	2.7e-98
>prophage 2
CP032239	Escherichia coli strain ECCWS199 plasmid pTB222, complete sequence	159756	81929	143764	159756	transposase	Escherichia_phage(35.71%)	59	NA	NA
AXZ75982.1|81929_83142_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
AXZ75983.1|86134_86527_+	cysteine hydrolase	NA	NA	NA	NA	NA
AXZ75984.1|86664_87549_+	EamA family transporter	NA	NA	NA	NA	NA
AXZ75985.1|87580_88780_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AXZ75986.1|89250_89955_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ75987.1|89988_90480_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ75988.1|90586_91324_+	resolvase	NA	NA	NA	NA	NA
AXZ75989.1|91320_91545_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75990.1|91755_93249_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXZ75991.1|93279_94164_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AXZ75992.1|94380_95595_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AXZ75993.1|95622_95928_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ75994.1|96039_97533_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXZ75995.1|97563_97815_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ75996.1|97708_98011_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXZ75997.1|98097_98913_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AXZ75998.1|100112_101321_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AXZ75999.1|101627_102107_-	phenol hydroxylase	NA	NA	NA	NA	NA
AXZ76000.1|102162_102867_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ76001.1|104044_104368_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ76002.1|104473_105607_+	permease	NA	NA	NA	NA	NA
AXZ76003.1|106306_109294_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	1.7e-295
AXZ76004.1|109309_109489_+	replication initiator protein	NA	NA	NA	NA	NA
AXZ76005.1|109634_110192_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AXZ76006.1|110374_111235_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXZ76007.1|111492_112284_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AXZ76008.1|112491_113415_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
AXZ76048.1|113481_113667_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ76009.1|113817_114063_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ76010.1|114100_114964_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AXZ76011.1|115261_115966_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ76012.1|116116_116932_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AXZ76013.1|117121_117826_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ76014.1|117816_117993_+	replication initiator protein	NA	NA	NA	NA	NA
AXZ76049.1|117934_118276_-	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	97.3	1.1e-54
AXZ76015.1|119959_120352_+	cysteine hydrolase	NA	NA	NA	NA	NA
AXZ76016.1|120489_121374_+	EamA family transporter	NA	NA	NA	NA	NA
AXZ76017.1|121405_122605_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AXZ76018.1|122683_123361_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ76019.1|123392_123635_-	relaxase	NA	NA	NA	NA	NA
AXZ76020.1|125272_125977_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ76051.1|125867_126119_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ76050.1|126105_126870_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXZ76021.1|126841_127219_-	hypothetical protein	NA	Q6JIG6	Burkholderia_virus	38.4	2.0e-07
AXZ76022.1|127301_127520_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ76023.1|127627_128320_+	hypothetical protein	NA	B1B6L9	Salmonella_phage	39.1	1.3e-25
AXZ76024.1|128422_128779_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ76025.1|128724_129309_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ76026.1|129308_130547_-	MFS transporter	NA	NA	NA	NA	NA
AXZ76027.1|130543_131449_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXZ76028.1|132041_132746_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ76029.1|133390_134401_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	53.9	6.7e-87
AXZ76030.1|135141_136308_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
AXZ76031.1|136307_137279_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	89.7	4.2e-155
AXZ76032.1|138502_139711_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	81.8	1.7e-190
AXZ76033.1|140027_141299_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	1.0e-153
AXZ76034.1|141298_141724_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
AXZ76035.1|141876_142128_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ76036.1|142551_143764_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
