The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032222	Klebsiella pneumoniae strain AR_0046 chromosome, complete genome	5250521	429482	438947	5250521	protease,tRNA	Dickeya_phage(16.67%)	9	NA	NA
AXZ57139.1|429482_430598_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AXZ57140.1|430594_432535_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AXZ57141.1|432474_432657_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ57142.1|432611_432833_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXZ57143.1|433158_433476_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXZ57144.1|433506_435786_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXZ57145.1|435907_436126_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXZ57146.1|436479_437181_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXZ57147.1|437225_438947_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 2
CP032222	Klebsiella pneumoniae strain AR_0046 chromosome, complete genome	5250521	1102825	1113712	5250521		Escherichia_phage(87.5%)	9	NA	NA
AXZ57750.1|1102825_1103446_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AXZ57751.1|1103438_1104704_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
AXZ57752.1|1104715_1105618_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AXZ57753.1|1105878_1106640_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXZ57754.1|1106660_1107521_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AXZ57755.1|1107818_1108079_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AXZ57756.1|1108165_1109254_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AXZ57757.1|1109284_1110550_-	MFS transporter	NA	NA	NA	NA	NA
AXZ57758.1|1110604_1113712_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 3
CP032222	Klebsiella pneumoniae strain AR_0046 chromosome, complete genome	5250521	1958371	2005310	5250521	capsid,transposase,protease,integrase,head,tail,portal,terminase,lysis	Enterobacteria_phage(26.67%)	56	1963310:1963369	2005421:2005484
AXZ61632.1|1958371_1958866_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
AXZ58566.1|1958846_1960280_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	8.9e-101
AXZ58567.1|1960323_1961031_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
AXZ58568.1|1961073_1961355_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61633.1|1961235_1961502_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ58569.1|1961893_1963039_+	porin	NA	Q1MVN1	Enterobacteria_phage	58.7	8.4e-118
1963310:1963369	attL	AGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAG	NA	NA	NA	NA
AXZ58570.1|1963643_1964015_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	5.4e-26
AXZ58571.1|1963971_1964211_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	6.8e-22
AXZ58572.1|1964287_1965772_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AXZ58573.1|1965771_1966023_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ58574.1|1966684_1967521_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ58575.1|1967553_1968297_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ58576.1|1968311_1970072_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	83.3	6.7e-50
AXZ58577.1|1970149_1973227_-	kinase	NA	A0A286S259	Klebsiella_phage	61.5	0.0e+00
AXZ58578.1|1973223_1973604_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	79.4	3.6e-57
AXZ58579.1|1973616_1974093_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
AXZ58580.1|1974079_1974553_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
AXZ58581.1|1974573_1977963_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.5	1.5e-303
AXZ58582.1|1978023_1978257_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	45.8	3.2e-08
AXZ58583.1|1978390_1979890_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AXZ58584.1|1979886_1980642_+	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.9e-34
AXZ58585.1|1980746_1981052_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	8.1e-28
AXZ58586.1|1981054_1981459_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	1.7e-33
AXZ58587.1|1981489_1982194_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.4	7.2e-80
AXZ58588.1|1982250_1982598_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.1	4.0e-31
AXZ58589.1|1982594_1983044_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	82.6	1.9e-62
AXZ58590.1|1983040_1983379_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	6.4e-42
AXZ58591.1|1983390_1983717_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	68.5	1.2e-40
AXZ58592.1|1984055_1985273_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	81.4	3.9e-182
AXZ61634.1|1985282_1986131_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	84.6	1.0e-128
AXZ58593.1|1986143_1987451_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.4	4.3e-211
AXZ58594.1|1987450_1989193_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.6	2.0e-139
AXZ58595.1|1989146_1989611_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	60.8	6.3e-48
AXZ58596.1|1989793_1990135_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	6.0e-48
AXZ58597.1|1990190_1990436_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	65.4	1.2e-18
AXZ58598.1|1990635_1991031_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ58599.1|1991367_1991526_-	rz1 lytic protein	NA	NA	NA	NA	NA
AXZ58600.1|1991820_1992159_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ58601.1|1992233_1992698_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	62.9	1.6e-43
AXZ58602.1|1992694_1993225_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	80.0	3.2e-80
AXZ58603.1|1993227_1993476_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AXZ58604.1|1994183_1994762_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
AXZ58605.1|1994775_1995756_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	6.4e-135
AXZ58606.1|1995768_1996146_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	75.2	6.7e-48
AXZ58607.1|1996155_1996965_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	3.5e-110
AXZ58608.1|1996961_1997876_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	59.6	3.1e-30
AXZ58609.1|1997832_1998045_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
AXZ58610.1|1998282_1998744_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	6.4e-69
AXZ58611.1|1998778_1999021_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
AXZ58612.1|1999118_1999814_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
AXZ58613.1|2000527_2001445_+	hypothetical protein	NA	A0A1W6JP69	Morganella_phage	36.5	1.5e-45
AXZ58614.1|2001534_2001834_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	7.2e-13
AXZ58615.1|2001833_2002619_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.1e-60
AXZ58616.1|2003218_2004049_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ58617.1|2004088_2004316_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
AXZ58618.1|2004317_2005310_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	86.9	1.1e-174
2005421:2005484	attR	AGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAGACCG	NA	NA	NA	NA
>prophage 4
CP032222	Klebsiella pneumoniae strain AR_0046 chromosome, complete genome	5250521	2073256	2082636	5250521		Escherichia_phage(25.0%)	8	NA	NA
AXZ58678.1|2073256_2074423_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AXZ58679.1|2074602_2075157_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
AXZ58680.1|2075171_2076062_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AXZ58681.1|2076093_2076963_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	1.3e-110
AXZ61640.1|2076976_2078041_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
AXZ58682.1|2078195_2079566_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
AXZ58683.1|2079587_2081003_-	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AXZ58684.1|2081229_2082636_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 5
CP032222	Klebsiella pneumoniae strain AR_0046 chromosome, complete genome	5250521	2126757	2133662	5250521		Bacillus_phage(33.33%)	6	NA	NA
AXZ58714.1|2126757_2128236_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
AXZ58715.1|2128232_2128955_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AXZ58716.1|2129273_2130635_+	U32 family peptidase	NA	Q6DW11	Phage_TP	94.5	1.1e-206
AXZ61642.1|2130880_2131774_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AXZ58717.1|2132014_2132788_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	6.6e-26
AXZ61643.1|2132798_2133662_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 6
CP032222	Klebsiella pneumoniae strain AR_0046 chromosome, complete genome	5250521	3139846	3190355	5250521	capsid,integrase,head,plate,tail,holin,tRNA,portal,terminase,lysis	Salmonella_phage(23.91%)	63	3159873:3159888	3190892:3190907
AXZ59623.1|3139846_3141088_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
AXZ59624.1|3141099_3141921_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AXZ59625.1|3142119_3142503_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AXZ59626.1|3142610_3143228_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AXZ59627.1|3143489_3143636_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AXZ59628.1|3143625_3144450_+	urease accessory protein	NA	NA	NA	NA	NA
AXZ59629.1|3144459_3144762_+	urease subunit gamma	NA	NA	NA	NA	NA
AXZ59630.1|3144771_3145092_+	urease subunit beta	NA	NA	NA	NA	NA
AXZ59631.1|3145084_3146788_+	urease subunit alpha	NA	NA	NA	NA	NA
AXZ59632.1|3146797_3147274_+	urease accessory protein UreE	NA	NA	NA	NA	NA
AXZ59633.1|3147275_3147950_+	urease accessory protein UreF	NA	NA	NA	NA	NA
AXZ59634.1|3147958_3148576_+	urease accessory protein UreG	NA	NA	NA	NA	NA
AXZ59635.1|3148729_3150337_+	allantoin permease	NA	NA	NA	NA	NA
AXZ59636.1|3150381_3151395_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
AXZ59637.1|3151403_3151634_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ59638.1|3151632_3151848_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXZ59639.1|3151959_3153705_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
AXZ59640.1|3153923_3155765_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AXZ59641.1|3155864_3156371_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AXZ59642.1|3156729_3156948_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
AXZ59643.1|3157041_3157449_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.3	1.2e-26
AXZ59644.1|3157489_3158650_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.6	8.3e-174
AXZ59645.1|3158649_3159129_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	80.9	1.3e-69
AXZ59646.1|3159145_3161584_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.8	2.1e-299
3159873:3159888	attL	GCAATGATGGCATTTA	NA	NA	NA	NA
AXZ59647.1|3161576_3161714_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
AXZ59648.1|3161728_3162004_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
AXZ59649.1|3162064_3162580_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.0	1.2e-68
AXZ59650.1|3162593_3163775_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	7.9e-196
AXZ59651.1|3163884_3164964_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	43.3	4.7e-30
AXZ59652.1|3164975_3165704_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ59653.1|3165709_3167974_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	40.8	7.0e-108
AXZ59654.1|3167975_3168578_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	57.6	1.0e-53
AXZ59655.1|3168570_3169479_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	5.2e-115
AXZ59656.1|3169483_3169831_-|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
AXZ59657.1|3169827_3170469_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	2.0e-92
AXZ59658.1|3170811_3171855_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ59659.1|3172183_3172633_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	4.7e-48
AXZ59660.1|3172625_3173093_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	9.1e-63
AXZ59661.1|3173055_3173307_-|holin	holin	holin	S4TNY4	Salmonella_phage	72.5	2.6e-24
AXZ59662.1|3173188_3173620_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	1.1e-41
AXZ59663.1|3173616_3174114_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	84.8	4.8e-78
AXZ59664.1|3174100_3174391_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	80.6	2.2e-35
AXZ59665.1|3174395_3174599_-|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
AXZ59666.1|3174598_3175105_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
AXZ59667.1|3175201_3175945_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	78.9	9.6e-99
AXZ59668.1|3175948_3177007_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	4.9e-165
AXZ59669.1|3177080_3177935_-|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	9.6e-127
AXZ59670.1|3178100_3179870_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	87.9	6.3e-306
AXZ59671.1|3179869_3180913_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	4.4e-166
AXZ59672.1|3181425_3181620_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	64.1	4.7e-13
AXZ59673.1|3181618_3182050_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	93.7	2.9e-71
AXZ59674.1|3182188_3183139_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	37.7	8.7e-36
AXZ59675.1|3183116_3183425_-	XRE family transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.1	2.4e-11
AXZ59676.1|3184045_3184486_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	95.6	3.4e-67
AXZ59677.1|3184604_3186821_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.1	0.0e+00
AXZ59678.1|3186822_3187044_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	95.9	5.5e-34
AXZ59679.1|3187043_3187271_-	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	97.3	2.9e-30
AXZ59680.1|3187338_3187677_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
AXZ61679.1|3187640_3187841_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	8.1e-29
AXZ59681.1|3187848_3188358_-	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	96.4	8.9e-88
AXZ59682.1|3188388_3188652_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
AXZ59683.1|3188781_3189357_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.2	1.2e-59
AXZ59684.1|3189356_3190355_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	4.5e-192
3190892:3190907	attR	TAAATGCCATCATTGC	NA	NA	NA	NA
>prophage 1
CP032223	Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence	201149	38054	52481	201149	tail	Salmonella_phage(28.57%)	20	NA	NA
AXZ61798.1|38054_39296_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
AXZ61799.1|40179_40635_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61800.1|40922_41531_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
AXZ61801.1|41600_42050_-|tail	phage tail protein	tail	A0A1I9KFG8	Aeromonas_phage	40.7	1.3e-18
AXZ61802.1|42059_42245_-	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	67.4	1.6e-10
AXZ61803.1|42501_43269_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	62.7	3.5e-43
AXZ61804.1|43332_43857_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61805.1|44310_44598_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61806.1|44878_45151_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
AXZ61960.1|45742_45937_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61807.1|48086_48473_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
AXZ61808.1|48565_48889_-	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
AXZ61809.1|48889_49534_-	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
AXZ61810.1|49530_49758_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
AXZ61811.1|50235_50424_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61812.1|50420_50918_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.6e-23
AXZ61813.1|51010_51229_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
AXZ61814.1|51394_51646_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
AXZ61815.1|51765_52080_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61816.1|52160_52481_-	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	1.7e-28
>prophage 2
CP032223	Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence	201149	75447	83435	201149		Burkholderia_phage(28.57%)	13	NA	NA
AXZ61839.1|75447_75765_-	DUF3846 domain-containing protein	NA	A0A2H4P7A4	Pseudomonas_phage	47.7	3.2e-11
AXZ61840.1|75792_76041_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61841.1|76620_77823_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	37.7	1.8e-33
AXZ61842.1|77912_79328_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
AXZ61843.1|79399_79729_-	hypothetical protein	NA	A0A060D1I0	Salmonella_phage	62.2	5.7e-11
AXZ61844.1|79817_80252_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61963.1|80284_80545_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
AXZ61845.1|80553_80757_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61846.1|80798_81242_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61847.1|81472_81832_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ61848.1|82016_82427_-	DNA-binding protein	NA	Q71TH9	Escherichia_phage	60.0	2.9e-41
AXZ61849.1|82551_82866_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ61850.1|82856_83435_-	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
>prophage 1
CP032224	Klebsiella pneumoniae strain AR_0046 plasmid unnamed2, complete sequence	73056	8233	71164	73056	head,tail,portal,capsid,terminase	Klebsiella_phage(80.0%)	65	NA	NA
AXZ61975.1|8233_10156_+	protelomerase	NA	Q6UAV6	Klebsiella_phage	93.4	0.0e+00
AXZ61976.1|10210_10990_-	hypothetical protein	NA	O64341	Escherichia_phage	80.9	3.3e-118
AXZ61977.1|10986_11217_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61978.1|11213_11552_-	host cell division inhibitor Icd-like protein	NA	Q77WP0	Escherichia_phage	79.5	1.7e-26
AXZ61979.1|11910_13044_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ61980.1|13070_13595_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61981.1|13694_14027_-	hypothetical protein	NA	O64344	Escherichia_phage	86.2	2.5e-46
AXZ61982.1|14029_14356_-	hypothetical protein	NA	O64345	Escherichia_phage	72.9	4.7e-42
AXZ61983.1|14342_14549_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ61984.1|14541_18546_-	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.4	0.0e+00
AXZ61985.1|18796_19405_-	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	92.6	9.6e-105
AXZ62038.1|19485_19695_+	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
AXZ61986.1|19684_20422_+	phage antitermination protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.2e-119
AXZ61987.1|20402_20624_+	hypothetical protein	NA	A0A2I6TCB2	Escherichia_phage	74.0	2.4e-29
AXZ61988.1|20833_21442_+	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	87.5	2.5e-97
AXZ61989.1|22042_22288_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
AXZ61990.1|22280_22607_+	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	93.5	1.9e-51
AXZ61991.1|22627_22855_+	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
AXZ61992.1|22958_23162_+	hypothetical protein	NA	Q6UAT5	Klebsiella_phage	76.6	3.5e-19
AXZ61993.1|23206_23494_-	XRE family transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
AXZ61994.1|23493_23802_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
AXZ62039.1|23972_24194_+	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
AXZ61995.1|24205_24433_+	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
AXZ61996.1|24750_25812_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	93.2	1.6e-171
AXZ61997.1|25870_26182_+	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
AXZ61998.1|26178_26670_+	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.2	1.9e-82
AXZ61999.1|26686_27163_+	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	1.7e-61
AXZ62000.1|27416_27716_+	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
AXZ62001.1|27984_28623_+	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	44.7	9.0e-45
AXZ62002.1|28622_28985_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	93.3	2.0e-62
AXZ62003.1|28981_29305_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ62004.1|29304_29733_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.0	2.7e-37
AXZ62040.1|29818_30019_+	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	90.9	3.4e-11
AXZ62005.1|30149_30584_+|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
AXZ62006.1|30618_32328_+|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
AXZ62007.1|32321_32501_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	80.7	2.4e-16
AXZ62008.1|32500_33760_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.5	8.9e-222
AXZ62009.1|33796_34717_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	1.9e-149
AXZ62010.1|34794_36081_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	2.2e-215
AXZ62011.1|36139_36400_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	62.7	4.3e-22
AXZ62012.1|36380_36698_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AXZ62013.1|36694_37033_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AXZ62014.1|37013_37403_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	84.5	5.3e-56
AXZ62015.1|37399_37801_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	93.2	1.7e-62
AXZ62016.1|37832_38294_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	1.0e-66
AXZ62017.1|38351_38717_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AXZ62018.1|38737_38950_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	87.5	1.4e-31
AXZ62019.1|38949_42306_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	86.6	0.0e+00
AXZ62020.1|42305_42644_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
AXZ62021.1|42640_43396_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	6.7e-124
AXZ62022.1|43397_44108_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	6.7e-134
AXZ62023.1|44154_44982_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	44.0	2.3e-08
AXZ62024.1|44998_45592_+|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.7	3.7e-85
AXZ62025.1|45654_57813_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.6	0.0e+00
AXZ62026.1|57816_58125_+	hypothetical protein	NA	A0A248SL87	Klebsiella_phage	54.5	1.6e-28
AXZ62027.1|58127_58775_+	hypothetical protein	NA	A0A248SKJ6	Klebsiella_phage	58.8	1.9e-74
AXZ62028.1|58878_59112_+	cor protein	NA	Q38624	Escherichia_phage	57.9	1.1e-21
AXZ62029.1|59189_60335_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.3	1.7e-38
AXZ62030.1|60409_61387_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	89.5	2.6e-160
AXZ62031.1|61389_62553_-	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
AXZ62032.1|64751_65729_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	89.5	2.6e-160
AXZ62033.1|67023_67257_-	cor protein	NA	Q38624	Escherichia_phage	57.9	1.1e-21
AXZ62034.1|67360_68008_-	hypothetical protein	NA	A0A248SKJ6	Klebsiella_phage	58.8	1.9e-74
AXZ62035.1|68321_70931_-	DUF1983 domain-containing protein	NA	A0A0P0IKE4	Klebsiella_phage	46.2	7.7e-18
AXZ62036.1|70930_71164_-	hypothetical protein	NA	Q6UAW1	Klebsiella_phage	62.2	1.3e-06
>prophage 1
CP032225	Klebsiella pneumoniae strain AR_0046 plasmid unnamed3, complete sequence	108879	0	108481	108879	integrase,tail,terminase,capsid	Salmonella_phage(89.8%)	118	27796:27820	44169:44193
AXZ62042.1|355_1084_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	70.7	1.7e-79
AXZ62043.1|1145_2831_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	91.1	0.0e+00
AXZ62044.1|3681_3837_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
AXZ62045.1|3836_4262_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
AXZ62046.1|4364_4553_-	hypothetical protein	NA	J9Q800	Salmonella_phage	52.5	3.3e-08
AXZ62047.1|4549_4828_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ62048.1|5259_5847_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
AXZ62049.1|6419_6653_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.0	7.8e-31
AXZ62050.1|6850_7444_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.9e-99
AXZ62051.1|7628_8462_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	5.1e-64
AXZ62052.1|8587_9136_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	74.4	3.2e-75
AXZ62154.1|9132_9714_-	hypothetical protein	NA	I6WLM5	Burkholderia_virus	55.0	7.2e-33
AXZ62053.1|9936_10356_-	hypothetical protein	NA	J9Q743	Salmonella_phage	73.4	1.9e-51
AXZ62054.1|10419_11064_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	77.1	3.1e-93
AXZ62055.1|11063_11540_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.6	4.9e-72
AXZ62056.1|11536_11950_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	77.4	4.7e-55
AXZ62057.1|11951_13055_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	80.1	6.7e-181
AXZ62058.1|13248_14124_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	84.7	2.3e-139
AXZ62059.1|14201_15344_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
AXZ62060.1|15474_17778_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	91.1	0.0e+00
AXZ62061.1|17853_18423_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
AXZ62062.1|18432_19179_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	61.7	2.9e-79
AXZ62063.1|19168_21085_-	exonuclease	NA	J9Q741	Salmonella_phage	84.6	9.5e-300
AXZ62155.1|21081_21276_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	2.8e-18
AXZ62064.1|21314_22400_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	84.5	5.4e-183
AXZ62065.1|22588_23083_-	N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	67.1	1.0e-59
AXZ62066.1|23158_23803_-	hypothetical protein	NA	J9Q739	Salmonella_phage	81.1	3.7e-99
AXZ62067.1|23899_24112_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ62068.1|24123_25221_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.2e-73
AXZ62069.1|25672_25885_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
AXZ62070.1|25884_26220_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.1e-37
AXZ62071.1|26216_26396_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ62072.1|26929_28006_-	recombinase	NA	J9Q736	Salmonella_phage	96.4	3.8e-197
27796:27820	attL	CGGCCGTCGCCAGGAAGGTTTTACC	NA	NA	NA	NA
AXZ62073.1|28008_28275_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
AXZ62074.1|28274_29219_-	exonuclease	NA	J9Q7S6	Salmonella_phage	92.7	5.4e-171
AXZ62075.1|29279_30287_-	regulator	NA	J9Q7Z3	Salmonella_phage	88.0	6.0e-144
AXZ62076.1|30406_30838_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	90.9	4.0e-65
AXZ62077.1|30958_31195_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ62078.1|31187_31403_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.5e-25
AXZ62079.1|31555_31999_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	81.6	6.4e-58
AXZ62080.1|31995_35514_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.3	0.0e+00
AXZ62081.1|35488_35692_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	7.2e-25
AXZ62082.1|35694_36927_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	86.6	1.3e-212
AXZ62083.1|37023_39303_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	63.3	2.7e-245
AXZ62084.1|39905_40286_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXZ62085.1|40280_41381_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	30.0	1.6e-17
AXZ62086.1|41729_42089_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ62087.1|42153_42564_-	toxin YafO	NA	NA	NA	NA	NA
AXZ62088.1|42573_43191_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ62156.1|43285_43531_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	1.2e-13
AXZ62089.1|43659_44505_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	66.5	3.8e-91
44169:44193	attR	CGGCCGTCGCCAGGAAGGTTTTACC	NA	NA	NA	NA
AXZ62090.1|45378_46170_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ62091.1|47584_47809_-	nuclease	NA	NA	NA	NA	NA
AXZ62092.1|47936_48152_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ62093.1|48148_48364_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	78.6	8.5e-24
AXZ62094.1|48466_49789_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	85.9	5.1e-228
AXZ62095.1|49788_50256_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	3.4e-49
AXZ62096.1|50335_51124_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	50.8	2.6e-70
AXZ62097.1|51413_52580_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ62098.1|52622_53741_-	DNA primase	NA	J9Q720	Salmonella_phage	91.6	6.3e-203
AXZ62099.1|53893_55234_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
AXZ62100.1|55298_56024_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	1.9e-128
AXZ62101.1|56230_56995_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	41.2	1.9e-49
AXZ62102.1|57010_57373_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.2e-43
AXZ62103.1|57372_58038_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
AXZ62157.1|58359_58917_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	43.8	1.4e-33
AXZ62104.1|59113_59365_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	72.3	5.8e-24
AXZ62105.1|59367_60060_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	89.6	7.0e-120
AXZ62106.1|60073_60397_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
AXZ62107.1|60487_61933_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.6	8.0e-41
AXZ62108.1|61985_74156_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	57.5	2.4e-29
AXZ62109.1|74172_74784_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	73.9	4.5e-78
AXZ62110.1|74771_75569_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
AXZ62111.1|75561_76260_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
AXZ62112.1|76346_76682_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
AXZ62113.1|76725_81258_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	71.4	0.0e+00
AXZ62114.1|81265_81499_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
AXZ62115.1|81615_81933_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
AXZ62116.1|81994_82741_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.4	1.6e-106
AXZ62117.1|82808_83201_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	67.5	1.0e-46
AXZ62118.1|83202_83676_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
AXZ62119.1|83666_84011_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	91.2	2.8e-53
AXZ62120.1|84108_84942_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	4.8e-131
AXZ62121.1|84941_85376_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
AXZ62122.1|85423_85852_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
AXZ62123.1|85930_86809_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.2	4.7e-153
AXZ62124.1|86835_87735_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
AXZ62125.1|87757_89347_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.7	3.9e-275
AXZ62126.1|89364_90621_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
AXZ62127.1|90623_91265_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
AXZ62128.1|91441_91708_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
AXZ62129.1|91717_92608_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
AXZ62130.1|92604_93156_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ62131.1|93145_93787_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	96.7	6.8e-109
AXZ62132.1|93783_94452_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	91.9	6.6e-107
AXZ62133.1|94451_95132_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	89.3	1.4e-107
AXZ62134.1|95215_96775_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	93.1	3.1e-280
AXZ62135.1|96777_97056_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	70.3	6.2e-27
AXZ62136.1|97120_97657_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ62137.1|98427_98784_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ62138.1|98833_99364_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	69.6	2.5e-56
AXZ62139.1|99679_100330_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
AXZ62140.1|100380_100584_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
AXZ62141.1|101176_101659_-	hypothetical protein	NA	J9Q805	Salmonella_phage	70.6	1.3e-64
AXZ62158.1|101671_101863_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ62142.1|101914_102103_+	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	61.1	1.1e-11
AXZ62143.1|102130_102412_-	ABC transporter	NA	J9Q753	Salmonella_phage	83.9	5.3e-42
AXZ62144.1|102538_102946_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ62145.1|103065_103377_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	66.0	3.0e-30
AXZ62146.1|103513_103726_-	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
AXZ62147.1|103738_103957_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
AXZ62148.1|104518_104710_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ62149.1|105513_105702_-	hypothetical protein	NA	J9Q6K5	Salmonella_phage	66.7	3.6e-18
AXZ62150.1|105715_106033_-	hypothetical protein	NA	J9Q750	Salmonella_phage	75.2	5.4e-43
AXZ62151.1|106231_106660_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
AXZ62159.1|106840_107104_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	9.7e-30
AXZ62152.1|107235_107493_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ62153.1|107944_108481_-	hypothetical protein	NA	J9Q748	Salmonella_phage	73.1	1.6e-74
>prophage 1
CP032226	Klebsiella pneumoniae strain AR_0046 plasmid unnamed4, complete sequence	85410	47176	70031	85410	protease,transposase	Escherichia_phage(57.14%)	20	NA	NA
AXZ62212.1|47176_47830_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXZ62213.1|48049_48514_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AXZ62214.1|48510_48615_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ62215.1|48650_51548_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AXZ62216.1|51642_52248_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AXZ62254.1|53024_53417_+	cysteine hydrolase	NA	NA	NA	NA	NA
AXZ62217.1|53554_54439_+	EamA family transporter	NA	NA	NA	NA	NA
AXZ62218.1|54470_55670_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AXZ62219.1|55748_56426_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ62255.1|56457_56700_-	relaxase	NA	NA	NA	NA	NA
AXZ62220.1|58321_59026_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ62256.1|59169_59724_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AXZ62257.1|59854_60685_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AXZ62221.1|61316_62021_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ62222.1|62127_62988_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AXZ62223.1|63000_63543_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AXZ62224.1|64736_65441_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ62225.1|67762_68095_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AXZ62226.1|68141_69017_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AXZ62227.1|69326_70031_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
CP032227	Klebsiella pneumoniae strain AR_0046 plasmid unnamed5, complete sequence	49701	0	9092	49701		Escherichia_phage(50.0%)	9	NA	NA
AXZ62262.1|483_741_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ62263.1|1508_2375_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AXZ62264.1|2551_2821_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ62265.1|3235_4441_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AXZ62266.1|4437_5415_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AXZ62267.1|5496_6768_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AXZ62268.1|6767_7199_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
AXZ62269.1|7356_7608_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ62270.1|7607_9092_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.8e-32
>prophage 2
CP032227	Klebsiella pneumoniae strain AR_0046 plasmid unnamed5, complete sequence	49701	13814	15794	49701	transposase	Escherichia_phage(50.0%)	2	NA	NA
AXZ62272.1|13814_14519_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXZ62305.1|14543_15794_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 3
CP032227	Klebsiella pneumoniae strain AR_0046 plasmid unnamed5, complete sequence	49701	21093	24148	49701	transposase	Escherichia_phage(50.0%)	3	NA	NA
AXZ62278.1|21093_22017_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.1e-176
AXZ62279.1|22209_22428_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ62280.1|23968_24148_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	60.3	6.8e-11
>prophage 4
CP032227	Klebsiella pneumoniae strain AR_0046 plasmid unnamed5, complete sequence	49701	28299	38596	49701	integrase,transposase	Escherichia_phage(50.0%)	14	30095:30154	42645:43466
AXZ62281.1|28299_29004_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ62282.1|29193_30009_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
30095:30154	attL	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
AXZ62283.1|30159_30864_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ62284.1|31053_31233_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ62285.1|31162_32002_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXZ62286.1|31995_32343_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXZ62287.1|33308_33782_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
AXZ62288.1|33924_34383_-	aminoglycoside N-acetyltransferase AAC(6')-Il	NA	NA	NA	NA	NA
AXZ62289.1|34476_35277_-	subclass B1 metallo-beta-lactamase VIM-27	NA	NA	NA	NA	NA
AXZ62290.1|35443_36457_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AXZ62291.1|36395_36653_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ62292.1|36598_37303_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ62293.1|37630_37744_-	NTP-binding protein	NA	NA	NA	NA	NA
AXZ62294.1|37831_38596_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
42645:43466	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTTTCGACTACCTCCCCTCAAAGCCATATCACGTACGTTAATCCTGACTTCATTAAAATCAGTGGTTTCACTGAGGAAGAACTATTAGGCCAGCCTCACAACATCGTAAGACACCCAGATATGCCGCCTGCTGCATTTGAGCATATGTGGAGTACATTAAAATCTGGCCGCTCATGGATGGGGCTAGTAAAAAATCGCTGTAAAAATGGCGACCACTATTGGGTAAGTGCTTATGTAACGCCAATAGCTAAGAATGGTTCGATTGTTGAATACCAGTCTGTAAGGACCAAGCCTGAACCTGAGCAGGTTTTGGCTGCGGAAAAATTATATGCTCAATTGAGAAGCGGGAAGGCCGCGAGGCCGAAATTGGCTGCTAGCTTTTCCGTGAAAATACTCTTGCTCATATGGGGTAGTATTATATCAAGCGCAATGGCTGCCGGCATGCTTACTGATACATCAATAAGCAGCTTATTGTTAGCCACTTTAATGTCAGGAAGCTTAAGCTCTGTTAGTGTTTTGGCTATTCTCTCTCCTCTTGGAAGACTGGTTGAAAGAGCCAGGAATATTTCCAATAACCCATTAAGTCAATCCCTCTACACTGGGCGCACCGATGAGTTTGGCCAAATAGAGTTTGCTTTACGAATGATGCAAGCTGAAACAGGCGCCATAGTAGGTCGCATAGGTGATGCATCAAATCGGCTTAGCGAACACACCCGAGGCCTACTAAAGGATATTGAGTCAAGCAATGTACTTACAGTTGAGCA	NA	NA	NA	NA
>prophage 5
CP032227	Klebsiella pneumoniae strain AR_0046 plasmid unnamed5, complete sequence	49701	41934	44220	49701	transposase	Escherichia_phage(50.0%)	2	NA	NA
AXZ62299.1|41934_42639_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ62307.1|42663_44220_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
