The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032207	Klebsiella pneumoniae strain AR_0109 chromosome, complete genome	5280811	1421356	1490734	5280811	terminase,protease,tRNA,integrase,portal,head,capsid,tail	uncultured_Caudovirales_phage(61.11%)	75	1457115:1457132	1473110:1473127
AXZ52363.1|1421356_1421851_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
AXZ52364.1|1421854_1422493_-	stringent starvation protein A	NA	NA	NA	NA	NA
AXZ52365.1|1422491_1422695_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ52366.1|1422804_1423197_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AXZ52367.1|1423212_1423641_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AXZ52368.1|1423906_1425034_-	cell division protein ZapE	NA	NA	NA	NA	NA
AXZ52369.1|1425224_1425623_+	DUF1043 family protein	NA	NA	NA	NA	NA
AXZ52370.1|1425796_1427164_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AXZ52371.1|1427251_1428310_+|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AXZ52372.1|1428446_1429385_-	malate dehydrogenase	NA	NA	NA	NA	NA
AXZ52373.1|1429799_1430270_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
AXZ52374.1|1430645_1430909_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXZ52375.1|1431007_1431274_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXZ52376.1|1431324_1431600_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ52377.1|1431679_1433647_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AXZ52378.1|1433652_1434585_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AXZ52379.1|1434592_1434796_-	protein AaeX	NA	NA	NA	NA	NA
AXZ52380.1|1434927_1435857_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AXZ52381.1|1435892_1437338_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AXZ52382.1|1437426_1441224_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AXZ52383.1|1441261_1442731_-	ribonuclease G	NA	NA	NA	NA	NA
AXZ52384.1|1442733_1443315_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AXZ52385.1|1443322_1443811_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AXZ52386.1|1443810_1444803_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AXZ52387.1|1444873_1445917_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AXZ56004.1|1445894_1446101_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ52388.1|1446222_1448163_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AXZ52389.1|1448242_1448434_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ52390.1|1448662_1449664_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AXZ52391.1|1449663_1450272_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AXZ52392.1|1450495_1450948_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AXZ52393.1|1450970_1451438_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AXZ52394.1|1451448_1452798_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AXZ52395.1|1452908_1453151_+	DUF997 family protein	NA	NA	NA	NA	NA
AXZ52396.1|1453140_1454592_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
AXZ52397.1|1454603_1455485_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AXZ52398.1|1455490_1455685_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ52399.1|1455842_1456808_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AXZ52400.1|1456832_1457129_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
1457115:1457132	attL	TACGGCATGAACTGATAC	NA	NA	NA	NA
AXZ52401.1|1457282_1457474_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ52402.1|1457476_1459138_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AXZ52403.1|1459121_1459478_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AXZ52404.1|1459435_1459627_-|terminase	terminase	terminase	NA	NA	NA	NA
AXZ52405.1|1459753_1460197_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AXZ52406.1|1460196_1460496_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AXZ52407.1|1460492_1460828_-|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AXZ52408.1|1460824_1462066_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AXZ52409.1|1462067_1462628_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AXZ52410.1|1462679_1463846_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AXZ52411.1|1464109_1464622_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ52412.1|1464670_1465006_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ52413.1|1465348_1467484_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AXZ52414.1|1467483_1467849_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ52415.1|1467845_1468214_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AXZ52416.1|1468210_1468525_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ52417.1|1468517_1468706_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56005.1|1468698_1468968_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
AXZ52418.1|1469101_1469296_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AXZ52419.1|1469419_1470199_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AXZ52420.1|1470209_1470494_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXZ52421.1|1470675_1471617_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ52422.1|1471709_1472936_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AXZ52423.1|1473211_1473862_-	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
1473110:1473127	attR	TACGGCATGAACTGATAC	NA	NA	NA	NA
AXZ52424.1|1474240_1475380_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXZ52425.1|1475392_1478503_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AXZ52426.1|1478796_1479018_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56006.1|1484813_1485368_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AXZ52427.1|1485343_1485601_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AXZ52428.1|1485597_1486416_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
AXZ52429.1|1486419_1486992_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AXZ52430.1|1486996_1487539_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ52431.1|1487564_1488038_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AXZ52432.1|1488009_1489134_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AXZ52433.1|1489262_1489772_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AXZ52434.1|1489786_1490734_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
>prophage 2
CP032207	Klebsiella pneumoniae strain AR_0109 chromosome, complete genome	5280811	3034744	3046398	5280811		Enterobacteria_phage(70.0%)	13	NA	NA
AXZ53833.1|3034744_3037078_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
AXZ53834.1|3037089_3037410_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ53835.1|3037406_3037634_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ53836.1|3037630_3038188_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AXZ53837.1|3038184_3038451_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AXZ53838.1|3038992_3039730_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
AXZ53839.1|3039726_3039972_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AXZ53840.1|3039989_3040556_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
AXZ53841.1|3041124_3041550_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ53842.1|3041549_3042500_-	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AXZ53843.1|3042487_3043678_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AXZ53844.1|3044030_3045284_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AXZ53845.1|3045294_3046398_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
>prophage 3
CP032207	Klebsiella pneumoniae strain AR_0109 chromosome, complete genome	5280811	3697190	3734526	5280811	integrase,portal,head,capsid,plate,tail,lysis	Salmonella_phage(84.62%)	47	3697098:3697116	3734598:3734616
3697098:3697116	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
AXZ54430.1|3697190_3698243_-|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
AXZ54431.1|3698410_3698662_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ54432.1|3698661_3700146_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AXZ54433.1|3700244_3701189_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ54434.1|3701200_3702079_-	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AXZ54435.1|3702224_3702446_+	regulator	NA	NA	NA	NA	NA
AXZ54436.1|3702478_3702988_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AXZ56095.1|3702995_3703196_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AXZ54437.1|3703159_3703501_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AXZ54438.1|3703568_3703802_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AXZ54439.1|3703801_3704029_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AXZ54440.1|3704025_3704883_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AXZ54441.1|3704879_3707294_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AXZ54442.1|3707447_3707636_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AXZ54443.1|3707574_3707880_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AXZ54444.1|3707994_3708672_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ54445.1|3708947_3710690_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ54446.1|3710751_3711777_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AXZ54447.1|3711776_3713543_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AXZ54448.1|3713685_3714519_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AXZ54449.1|3714535_3715594_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AXZ54450.1|3715597_3716248_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AXZ54451.1|3716343_3716808_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AXZ54452.1|3716807_3717011_+|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AXZ54453.1|3717014_3717230_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AXZ54454.1|3717210_3717720_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AXZ54455.1|3717724_3718108_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AXZ54456.1|3718104_3718533_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AXZ54457.1|3718628_3719060_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AXZ54458.1|3719052_3719499_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AXZ54459.1|3719495_3720188_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ54460.1|3720282_3720855_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AXZ54461.1|3720851_3721214_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
AXZ54462.1|3721200_3722109_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AXZ54463.1|3722101_3722701_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AXZ54464.1|3722702_3725654_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AXZ54465.1|3725657_3726389_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ54466.1|3726385_3726589_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ54467.1|3726618_3727695_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AXZ54468.1|3727833_3729006_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AXZ54469.1|3729015_3729531_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AXZ54470.1|3729583_3729883_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AXZ54471.1|3729897_3730017_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AXZ54472.1|3730009_3732637_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AXZ54473.1|3732633_3733119_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AXZ54474.1|3733115_3734216_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AXZ54475.1|3734307_3734526_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
3734598:3734616	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 4
CP032207	Klebsiella pneumoniae strain AR_0109 chromosome, complete genome	5280811	3768942	3778406	5280811	protease,tRNA	Dickeya_phage(16.67%)	9	NA	NA
AXZ54505.1|3768942_3770058_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AXZ54506.1|3770054_3771995_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AXZ54507.1|3771934_3772117_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ54508.1|3772071_3772293_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXZ54509.1|3772618_3772936_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXZ54510.1|3772966_3775246_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXZ54511.1|3775366_3775585_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXZ54512.1|3775938_3776640_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXZ54513.1|3776684_3778406_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 5
CP032207	Klebsiella pneumoniae strain AR_0109 chromosome, complete genome	5280811	4145606	4186481	5280811	transposase,integrase,protease	Enterobacteria_phage(21.05%)	46	4172878:4172937	4178789:4179446
AXZ54854.1|4145606_4146653_+|protease	protease SohB	protease	NA	NA	NA	NA
AXZ54855.1|4146700_4146952_-	DUF2498 family protein	NA	NA	NA	NA	NA
AXZ54856.1|4146880_4147102_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ54857.1|4147358_4149956_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
AXZ54858.1|4150301_4151276_+	LysR family transcriptional regulator CysB	NA	NA	NA	NA	NA
AXZ54859.1|4151521_4151689_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
AXZ54860.1|4151860_4152067_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ54861.1|4152077_4154750_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
AXZ54862.1|4154796_4155399_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
AXZ54863.1|4155562_4156330_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
AXZ54864.1|4156465_4156774_+	LapA family protein	NA	NA	NA	NA	NA
AXZ54865.1|4156780_4157950_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
AXZ54866.1|4158141_4158879_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AXZ54867.1|4158878_4159205_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
AXZ54868.1|4159336_4159558_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
AXZ54869.1|4159830_4160580_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AXZ54870.1|4160651_4160831_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ54871.1|4160989_4162924_-	exoribonuclease 2	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
AXZ54872.1|4163005_4164163_-	CMD domain-containing protein	NA	NA	NA	NA	NA
AXZ54873.1|4164353_4165142_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
AXZ56113.1|4165340_4165883_-	HutD family protein	NA	NA	NA	NA	NA
AXZ54874.1|4166079_4167510_+	cytosine permease	NA	NA	NA	NA	NA
AXZ54875.1|4167554_4168364_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
AXZ54876.1|4168365_4169358_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AXZ54877.1|4169357_4170248_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AXZ56114.1|4170424_4171612_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
AXZ54878.1|4171508_4171823_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AXZ54879.1|4171819_4172482_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AXZ54880.1|4172478_4172883_-	regulator	NA	M9NYX4	Enterobacteria_phage	78.9	2.6e-58
4172878:4172937	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AXZ54881.1|4172941_4173646_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ54882.1|4173536_4174496_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AXZ56115.1|4174641_4175433_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AXZ54883.1|4175596_4175944_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXZ54884.1|4175937_4176777_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AXZ54885.1|4176706_4176886_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ54886.1|4176904_4177405_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXZ54887.1|4177710_4177824_-	NTP-binding protein	NA	NA	NA	NA	NA
AXZ54888.1|4177911_4178676_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXZ54889.1|4178852_4179557_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
4178789:4179446	attR	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACC	NA	NA	NA	NA
AXZ54890.1|4180149_4180572_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AXZ54891.1|4181218_4181470_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ54892.1|4181469_4182954_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AXZ54893.1|4183033_4183453_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AXZ54894.1|4183454_4184720_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
AXZ56116.1|4184795_4185623_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
AXZ54895.1|4185809_4186481_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
>prophage 6
CP032207	Klebsiella pneumoniae strain AR_0109 chromosome, complete genome	5280811	4219414	4257879	5280811	terminase,head,tail,lysis	uncultured_Caudovirales_phage(34.04%)	56	NA	NA
AXZ54926.1|4219414_4220176_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
AXZ54927.1|4220392_4221925_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AXZ54928.1|4222123_4222672_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
AXZ54929.1|4222868_4224050_+	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AXZ54930.1|4224030_4224273_-	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AXZ54931.1|4224451_4224931_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ54932.1|4224927_4225140_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AXZ54933.1|4225136_4225361_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AXZ54934.1|4225350_4226061_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AXZ54935.1|4226066_4226585_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AXZ54936.1|4226689_4227517_-	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AXZ54937.1|4227513_4227708_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ54938.1|4227704_4228130_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AXZ54939.1|4228316_4228571_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AXZ54940.1|4228563_4228929_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AXZ54941.1|4229098_4229287_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AXZ54942.1|4229279_4229594_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AXZ54943.1|4229764_4230433_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AXZ54944.1|4230530_4230752_+	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AXZ54945.1|4230726_4231020_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AXZ54946.1|4231327_4232986_+	ATP-dependent helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AXZ54947.1|4232987_4233950_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AXZ54948.1|4233946_4234423_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AXZ54949.1|4234419_4235202_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AXZ54950.1|4235607_4235856_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AXZ54951.1|4235858_4236389_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AXZ54952.1|4236385_4236775_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AXZ54953.1|4237009_4237330_+	negative regulator GrlR	NA	NA	NA	NA	NA
AXZ54954.1|4237431_4238184_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
AXZ54955.1|4238134_4239535_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AXZ54956.1|4239772_4241224_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AXZ56119.1|4241279_4241828_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AXZ54957.1|4241879_4243082_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AXZ54958.1|4243085_4243580_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AXZ54959.1|4243591_4244533_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AXZ54960.1|4244572_4244854_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ54961.1|4244822_4245242_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AXZ54962.1|4245238_4245745_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ54963.1|4245744_4246131_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AXZ54964.1|4246225_4246666_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AXZ54965.1|4246669_4247815_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AXZ54966.1|4247825_4248266_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
AXZ54967.1|4248269_4248695_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AXZ54968.1|4248730_4248883_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AXZ54969.1|4248872_4250876_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AXZ54970.1|4250875_4251475_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
AXZ54971.1|4251475_4251778_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AXZ54972.1|4251780_4252803_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AXZ54973.1|4252802_4253144_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AXZ54974.1|4253196_4253382_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ54975.1|4253418_4253985_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ54976.1|4254038_4254692_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AXZ54977.1|4254693_4255047_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AXZ54978.1|4255046_4256243_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AXZ54979.1|4256239_4257013_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AXZ54980.1|4257012_4257879_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 7
CP032207	Klebsiella pneumoniae strain AR_0109 chromosome, complete genome	5280811	4262555	4300265	5280811	terminase,head,tail,lysis	uncultured_Caudovirales_phage(34.04%)	56	NA	NA
AXZ54985.1|4262555_4264040_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AXZ54986.1|4264117_4264402_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ54987.1|4264624_4264873_-	DinI family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
AXZ54988.1|4265256_4266438_+	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AXZ54989.1|4266418_4266661_-	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AXZ54990.1|4266839_4267319_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ54991.1|4267315_4267528_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AXZ54992.1|4267524_4267749_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AXZ54993.1|4267738_4268449_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AXZ54994.1|4268454_4268973_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AXZ54995.1|4269077_4269905_-	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AXZ54996.1|4269901_4270096_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ54997.1|4270092_4270518_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AXZ54998.1|4270704_4270959_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AXZ54999.1|4270951_4271317_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AXZ55000.1|4271486_4271675_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AXZ55001.1|4271667_4271982_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AXZ55002.1|4272151_4272820_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AXZ55003.1|4272917_4273139_+	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AXZ55004.1|4273113_4273407_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AXZ55005.1|4273715_4275374_+	ATP-dependent helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AXZ55006.1|4275375_4276338_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AXZ55007.1|4276334_4276811_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AXZ55008.1|4276807_4277590_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AXZ55009.1|4277995_4278244_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AXZ55010.1|4278246_4278777_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AXZ55011.1|4278773_4279163_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AXZ55012.1|4279397_4279718_+	negative regulator GrlR	NA	NA	NA	NA	NA
AXZ55013.1|4279819_4280572_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
AXZ55014.1|4280522_4281923_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AXZ55015.1|4282160_4283612_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AXZ56121.1|4283667_4284216_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AXZ55016.1|4284267_4285470_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AXZ55017.1|4285473_4285968_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AXZ55018.1|4285979_4286921_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AXZ55019.1|4286960_4287242_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ55020.1|4287210_4287630_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AXZ55021.1|4287626_4288133_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ55022.1|4288132_4288519_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AXZ55023.1|4288613_4289054_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AXZ55024.1|4289057_4290203_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AXZ55025.1|4290213_4290654_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
AXZ55026.1|4290657_4291083_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AXZ55027.1|4291118_4291271_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AXZ55028.1|4291260_4293264_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AXZ55029.1|4293263_4293863_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
AXZ55030.1|4293863_4294166_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AXZ55031.1|4294168_4295191_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AXZ55032.1|4295190_4295532_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AXZ55033.1|4295583_4295769_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56122.1|4296020_4296371_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ55034.1|4296424_4297078_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AXZ55035.1|4297079_4297433_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AXZ55036.1|4297432_4298629_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AXZ55037.1|4298625_4299399_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AXZ55038.1|4299398_4300265_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 8
CP032207	Klebsiella pneumoniae strain AR_0109 chromosome, complete genome	5280811	4528460	4539347	5280811		Escherichia_phage(87.5%)	9	NA	NA
AXZ55250.1|4528460_4529081_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AXZ55251.1|4529073_4530339_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AXZ55252.1|4530350_4531253_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AXZ55253.1|4531513_4532275_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXZ55254.1|4532295_4533156_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AXZ55255.1|4533453_4533714_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AXZ55256.1|4533800_4534889_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AXZ55257.1|4534919_4536185_-	MFS transporter	NA	NA	NA	NA	NA
AXZ55258.1|4536239_4539347_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.7	0.0e+00
>prophage 1
CP032208	Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence	310872	13350	119999	310872	transposase	Stx2-converting_phage(22.22%)	101	NA	NA
AXZ56170.1|13350_14382_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AXZ56171.1|14535_15192_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56172.1|15221_15662_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56173.1|15651_16161_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56174.1|16169_16484_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56175.1|16691_18095_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AXZ56176.1|18123_18756_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56444.1|18992_20339_+|transposase	ISNCY-like element ISLad2 family transposase	transposase	NA	NA	NA	NA
AXZ56177.1|20397_21201_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56178.1|21214_22576_+	FRG domain-containing protein	NA	NA	NA	NA	NA
AXZ56179.1|22728_23169_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56180.1|23186_23993_+	SecC motif-containing protein	NA	NA	NA	NA	NA
AXZ56181.1|24286_24580_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56182.1|24676_25075_-	DNA-binding protein H-NS-like protein	NA	NA	NA	NA	NA
AXZ56183.1|25478_26297_-	DNA repair protein	NA	NA	NA	NA	NA
AXZ56184.1|26406_26901_-	nuclease	NA	A0A0R6PHV6	Moraxella_phage	35.5	4.2e-18
AXZ56185.1|27083_28355_+	DUF1173 family protein	NA	NA	NA	NA	NA
AXZ56186.1|29347_29950_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56187.1|30209_30941_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AXZ56188.1|31173_31932_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56189.1|31999_32392_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56190.1|32416_32746_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56191.1|32972_33620_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AXZ56192.1|34731_35973_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
AXZ56193.1|36057_36633_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	42.6	7.3e-30
AXZ56194.1|36719_37298_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.8	4.9e-34
AXZ56195.1|37336_38377_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
AXZ56196.1|38400_38856_-	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AXZ56197.1|38878_40030_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AXZ56198.1|40026_40611_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.9	1.8e-12
AXZ56199.1|40922_41981_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AXZ56445.1|41992_43135_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.8	3.1e-32
AXZ56200.1|43127_43901_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56201.1|43902_44982_+	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	33.8	1.1e-39
AXZ56202.1|44981_45938_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
AXZ56203.1|45948_47172_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AXZ56204.1|47174_47633_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
AXZ56205.1|48112_48751_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AXZ56206.1|48775_49417_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
AXZ56207.1|49417_50056_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AXZ56446.1|50148_51189_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AXZ56208.1|51188_52922_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
AXZ56209.1|52949_54449_+	kinase	NA	NA	NA	NA	NA
AXZ56447.1|54827_55310_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56210.1|55585_55990_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
AXZ56211.1|56389_56794_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	97.8	2.1e-68
AXZ56212.1|56790_57138_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AXZ56213.1|57186_58725_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.9	1.6e-281
AXZ56214.1|58825_59089_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56215.1|59399_59777_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	91.3	4.6e-57
AXZ56216.1|59773_60121_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
AXZ56217.1|60170_61709_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
AXZ56218.1|61790_62795_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXZ56448.1|62879_63041_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56219.1|63234_63987_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXZ56220.1|64227_65097_+	DMT family transporter	NA	NA	NA	NA	NA
AXZ56449.1|67389_68412_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXZ56221.1|68435_71474_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	2.5e-294
AXZ56222.1|71641_72277_+	resolvase	NA	NA	NA	NA	NA
AXZ56450.1|72304_73141_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AXZ56223.1|73206_73605_-	VOC family protein	NA	NA	NA	NA	NA
AXZ56224.1|73646_74756_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
AXZ56225.1|74786_75062_-	DNA-binding transcriptional repressor FrmR	NA	NA	NA	NA	NA
AXZ56226.1|75686_76460_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXZ56227.1|76525_77227_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
AXZ56228.1|77292_78399_-	alkene reductase	NA	NA	NA	NA	NA
AXZ56451.1|78612_78942_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	34.7	7.4e-11
AXZ56229.1|78971_79310_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AXZ56230.1|79314_79896_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ56231.1|80037_80595_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AXZ56232.1|80779_81364_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.1	2.0e-22
AXZ56233.1|82012_82717_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ56234.1|83453_83789_-	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
AXZ56235.1|83680_83908_-	protein SamB	NA	NA	NA	NA	NA
AXZ56236.1|83947_84595_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56237.1|84659_85034_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXZ56238.1|85057_85621_+	chlorite dismutase	NA	NA	NA	NA	NA
AXZ56239.1|87022_87727_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ56240.1|90424_91429_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AXZ56241.1|91803_92070_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXZ56242.1|92166_92724_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ56243.1|92936_93197_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXZ56244.1|93227_93734_+	DUF417 family protein	NA	NA	NA	NA	NA
AXZ56245.1|93968_94430_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AXZ56246.1|94419_94914_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AXZ56247.1|95633_95915_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56248.1|96052_96316_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AXZ56249.1|96349_96955_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AXZ56250.1|99537_100542_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXZ56251.1|101510_103904_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AXZ56252.1|103924_104944_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AXZ56253.1|105124_105541_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXZ56254.1|105537_105768_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXZ56255.1|105799_105982_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56256.1|108599_110807_-	restriction endonuclease	NA	NA	NA	NA	NA
AXZ56257.1|111537_112320_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.9	2.7e-136
AXZ56258.1|112316_113339_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.0	2.1e-173
AXZ56259.1|115224_115404_+	hypothetical protein	NA	A0A1B2IAL0	Erwinia_phage	60.7	6.8e-11
AXZ56260.1|115664_115925_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56261.1|117738_118503_-	DUF815 domain-containing protein	NA	A0A059NT77	Lactococcus_phage	35.8	1.5e-30
AXZ56262.1|118499_119999_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP032208	Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence	310872	201058	276874	310872	tail,transposase	Escherichia_phage(21.21%)	83	NA	NA
AXZ56334.1|201058_201982_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	1.4e-171
AXZ56335.1|202044_202611_+	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	62.4	3.7e-42
AXZ56336.1|202601_202916_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56337.1|203039_203618_+	DNA-binding protein	NA	Q71TH9	Escherichia_phage	55.6	2.3e-55
AXZ56338.1|203633_203993_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56339.1|204136_204778_+	DNA-binding protein	NA	NA	NA	NA	NA
AXZ56340.1|204815_205526_-	RES domain-containing protein	NA	NA	NA	NA	NA
AXZ56341.1|205796_206240_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56342.1|206280_206484_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56343.1|206492_206753_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	44.3	1.0e-10
AXZ56344.1|206785_207220_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56345.1|207216_207960_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
AXZ56346.1|208086_209502_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	6.9e-106
AXZ56347.1|210407_211331_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	6.2e-172
AXZ56348.1|211563_211893_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56349.1|211998_212619_-	Eac protein	NA	A0A075B8I7	Enterobacteria_phage	47.0	3.6e-51
AXZ56350.1|212685_212904_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56351.1|212939_213212_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	44.9	1.4e-10
AXZ56352.1|213491_213803_+	plasmid maintenance system killer family protein	NA	NA	NA	NA	NA
AXZ56353.1|213814_214132_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56354.1|214161_214551_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56456.1|214927_215434_+	hypothetical protein	NA	K7PM35	Enterobacteria_phage	34.7	6.3e-09
AXZ56355.1|216593_217517_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	95.1	4.4e-170
AXZ56356.1|218211_220062_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AXZ56357.1|220067_221612_+	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
AXZ56358.1|221858_222374_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AXZ56359.1|222375_222654_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
AXZ56360.1|222699_224103_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
AXZ56361.1|224171_226235_+	PRD domain-containing protein	NA	NA	NA	NA	NA
AXZ56362.1|226337_227000_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
AXZ56363.1|227045_228059_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AXZ56364.1|228068_228710_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
AXZ56365.1|228725_228992_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AXZ56366.1|229125_230319_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
AXZ56367.1|230536_231166_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
AXZ56368.1|231167_232172_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AXZ56369.1|232292_233195_-	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
AXZ56370.1|233470_234946_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AXZ56457.1|235108_236032_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AXZ56371.1|237508_238513_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXZ56372.1|239227_240097_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AXZ56373.1|240150_240471_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
AXZ56374.1|240550_240865_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56375.1|240985_241237_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
AXZ56376.1|241402_241621_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
AXZ56377.1|241713_242211_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	55.9	6.3e-22
AXZ56378.1|242207_242396_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56379.1|242873_243101_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
AXZ56380.1|243097_243742_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
AXZ56381.1|243742_244066_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
AXZ56382.1|244158_244545_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
AXZ56383.1|244908_245832_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AXZ56384.1|246861_247344_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
AXZ56458.1|247427_248030_+	DUF551 domain-containing protein	NA	A0A1V0E5M5	Salmonella_phage	31.1	2.1e-19
AXZ56385.1|248029_248215_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56386.1|248484_248757_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	50.0	2.5e-12
AXZ56387.1|249317_249503_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	67.4	2.1e-10
AXZ56388.1|249512_249962_+|tail	phage tail protein	tail	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
AXZ56389.1|250405_251437_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AXZ56390.1|252082_252538_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56391.1|253422_254664_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
AXZ56392.1|254738_254921_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56393.1|255111_255507_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56394.1|255516_255924_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56395.1|255953_256364_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56396.1|256734_257739_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXZ56397.1|258315_258729_+	NB-ARC domain protein	NA	NA	NA	NA	NA
AXZ56398.1|258791_259583_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56399.1|259585_260152_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
AXZ56400.1|260154_262029_+	helicase	NA	A0A127AW80	Bacillus_phage	27.1	5.2e-08
AXZ56401.1|262022_262730_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56402.1|262974_263766_+	CRISPR-associated protein Csf2	NA	NA	NA	NA	NA
AXZ56403.1|265624_267109_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AXZ56404.1|267108_267360_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56459.1|267520_267943_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	49.3	6.3e-31
AXZ56405.1|267942_269214_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.3	5.1e-140
AXZ56460.1|269314_269758_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AXZ56406.1|269754_270225_+	RES domain-containing protein	NA	NA	NA	NA	NA
AXZ56407.1|270334_270595_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56408.1|271284_272653_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
AXZ56409.1|272650_273784_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AXZ56410.1|273912_275445_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	1.4e-51
AXZ56411.1|275533_276874_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP032209	Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence	161618	68100	133072	161618	protease,integrase,transposase	uncultured_Caudovirales_phage(26.32%)	58	59843:59857	79870:79884
59843:59857	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
AXZ56538.1|68100_68841_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AXZ56539.1|69984_70932_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
AXZ56540.1|70958_71270_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AXZ56541.1|71334_72258_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
AXZ56542.1|72930_73188_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56543.1|73789_75244_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AXZ56544.1|76226_77504_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AXZ56545.1|77566_79570_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AXZ56615.1|80603_81811_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
79870:79884	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
AXZ56546.1|83239_83671_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AXZ56547.1|83921_85397_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AXZ56548.1|85389_86070_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AXZ56549.1|86259_87645_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AXZ56550.1|87673_88027_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ56551.1|88140_89433_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXZ56552.1|89443_92590_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AXZ56553.1|92676_93117_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56554.1|93243_95691_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AXZ56555.1|95731_95929_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AXZ56556.1|95962_96700_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AXZ56557.1|96988_97438_-	copper resistance protein	NA	NA	NA	NA	NA
AXZ56558.1|97671_99489_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AXZ56559.1|99488_100385_+	copper resistance protein B	NA	NA	NA	NA	NA
AXZ56560.1|100424_100805_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AXZ56561.1|100809_101739_+	copper resistance protein D	NA	NA	NA	NA	NA
AXZ56562.1|101793_102474_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AXZ56563.1|102470_103871_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AXZ56564.1|104087_104522_+	copper-binding protein	NA	NA	NA	NA	NA
AXZ56616.1|104753_104933_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXZ56565.1|106675_107185_+	porin	NA	NA	NA	NA	NA
AXZ56617.1|107234_107732_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXZ56566.1|108063_108390_+	transcriptional regulator	NA	NA	NA	NA	NA
AXZ56618.1|108389_109100_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AXZ56567.1|109108_109654_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXZ56568.1|109729_110092_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AXZ56569.1|111988_112525_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXZ56570.1|112557_112983_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AXZ56571.1|112995_114285_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AXZ56572.1|114332_116084_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AXZ56573.1|116101_116464_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AXZ56574.1|116513_116864_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AXZ56575.1|117221_117491_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56576.1|117478_118054_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56577.1|118084_118579_+	DNA-binding protein	NA	NA	NA	NA	NA
AXZ56578.1|118622_118991_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56579.1|119024_119228_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AXZ56580.1|119276_119534_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56581.1|119609_119864_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56582.1|120039_120306_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AXZ56583.1|120293_120776_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXZ56619.1|120987_122334_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXZ56584.1|124176_125139_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AXZ56585.1|125125_125875_-	diguanylate cyclase	NA	NA	NA	NA	NA
AXZ56586.1|126112_126310_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56587.1|126309_129105_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AXZ56588.1|129219_129789_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXZ56620.1|129823_130105_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AXZ56589.1|132091_133072_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 1
CP032212	Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence	83015	0	62122	83015	transposase,integrase	Escherichia_phage(33.33%)	60	2124:2141	9308:9325
AXZ56681.1|1650_2220_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
2124:2141	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
AXZ56682.1|2359_2674_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ56683.1|2612_3626_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ56684.1|3781_4255_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AXZ56685.1|4475_4742_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AXZ56686.1|4884_5649_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXZ56687.1|5690_5903_+	resolvase	NA	NA	NA	NA	NA
AXZ56688.1|5915_7124_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AXZ56689.1|7157_8591_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AXZ56690.1|8972_9179_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56760.1|9183_9696_-	restriction endonuclease	NA	NA	NA	NA	NA
9308:9325	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
AXZ56691.1|9720_10425_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
AXZ56692.1|10522_11642_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
AXZ56693.1|11689_12328_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	65.5	8.3e-75
AXZ56694.1|12739_13615_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AXZ56761.1|14239_14866_+	cobyrinic acid ac-diamide synthase	NA	E5FFJ3	Burkholderia_phage	30.1	3.8e-16
AXZ56695.1|14985_15165_+	Par-like protein	NA	NA	NA	NA	NA
AXZ56696.1|15541_15730_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56697.1|16313_16751_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56698.1|17044_18568_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AXZ56699.1|19109_20186_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXZ56700.1|20898_21603_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ56701.1|21756_24723_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
AXZ56702.1|24801_25806_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AXZ56703.1|25987_26164_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AXZ56704.1|26493_27309_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AXZ56705.1|27369_28173_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AXZ56706.1|28172_29009_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXZ56707.1|28980_29520_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXZ56708.1|29730_29955_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56709.1|29951_30689_-	resolvase	NA	NA	NA	NA	NA
AXZ56710.1|30795_31287_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56711.1|31320_32025_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ56712.1|32104_32605_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56713.1|32754_33396_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
AXZ56714.1|33539_34244_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ56715.1|36565_36898_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AXZ56716.1|36944_37820_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AXZ56717.1|38075_39338_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AXZ56718.1|39901_40459_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AXZ56719.1|40641_41502_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXZ56720.1|41683_42544_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AXZ56721.1|42556_43099_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AXZ56722.1|43580_43772_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56723.1|43777_44023_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56724.1|44073_45210_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AXZ56725.1|45324_46695_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
AXZ56726.1|47515_48376_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXZ56727.1|48470_48761_-	alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	40.6	4.8e-06
AXZ56728.1|48855_50040_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AXZ56729.1|50135_50792_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ56730.1|50803_51508_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ56731.1|52701_53244_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AXZ56732.1|53256_54117_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AXZ56733.1|54223_54928_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ56762.1|55559_56390_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AXZ56763.1|56520_57075_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AXZ56734.1|57218_57923_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ56735.1|58524_59130_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AXZ56736.1|59224_62122_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 2
CP032212	Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence	83015	66046	66751	83015	transposase	Escherichia_phage(100.0%)	1	NA	NA
AXZ56738.1|66046_66751_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
CP032212	Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence	83015	70469	79562	83015	transposase,integrase	Escherichia_phage(60.0%)	12	73523:73582	78806:79625
AXZ56745.1|70469_71225_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
AXZ56746.1|72236_72428_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AXZ56747.1|72436_72823_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56748.1|73368_73629_+	hypothetical protein	NA	NA	NA	NA	NA
73523:73582	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCGTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AXZ56749.1|73574_74279_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ56750.1|74356_75223_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AXZ56751.1|75990_76248_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56752.1|76305_77082_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AXZ56753.1|77078_77822_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56754.1|77872_78223_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ56755.1|78548_78824_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ56756.1|78857_79562_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
78806:79625	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCGTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
