The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032200	Klebsiella pneumoniae strain AR_0097 chromosome, complete genome	5309987	37019	46482	5309987	tRNA,protease	Brazilian_cedratvirus(16.67%)	9	NA	NA
AXZ17131.1|37019_38741_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.2e-14
AXZ17132.1|38785_39487_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXZ17133.1|39840_40059_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXZ17134.1|40178_42458_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXZ17135.1|42488_42806_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXZ17136.1|43131_43353_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXZ17137.1|43307_43490_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ17138.1|43429_45370_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
AXZ17139.1|45366_46482_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 2
CP032200	Klebsiella pneumoniae strain AR_0097 chromosome, complete genome	5309987	3191654	3254793	5309987	transposase,holin,capsid,tail,terminase	Salmonella_phage(55.56%)	69	NA	NA
AXZ19978.1|3191654_3193121_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AXZ19979.1|3193188_3194766_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AXZ19980.1|3194957_3196208_+	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	85.3	1.8e-206
AXZ19981.1|3196224_3196416_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ19982.1|3196412_3197006_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	1.6e-109
AXZ19983.1|3197002_3197656_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	64.2	3.7e-70
AXZ19984.1|3197652_3197811_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	75.0	5.6e-17
AXZ19985.1|3197803_3198097_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
AXZ19986.1|3198206_3198455_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
AXZ19987.1|3198503_3199385_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.6	4.0e-136
AXZ19988.1|3199381_3200203_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	81.3	9.5e-132
AXZ19989.1|3200199_3200499_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	52.5	8.8e-19
AXZ19990.1|3200863_3201445_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
AXZ19991.1|3201599_3201833_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AXZ19992.1|3201979_3202183_+	hypothetical protein	NA	Q858D5	Salmonella_phage	82.1	2.3e-23
AXZ19993.1|3202179_3203265_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	65.7	2.8e-139
AXZ19994.1|3203254_3204025_+	DNA replication domain protein	NA	G9L6A8	Escherichia_phage	91.7	5.5e-57
AXZ19995.1|3204689_3205085_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	40.2	2.2e-09
AXZ19996.1|3205081_3205486_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ19997.1|3205482_3205986_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	34.3	6.9e-08
AXZ19998.1|3205985_3206177_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ19999.1|3206798_3207047_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ20000.1|3207039_3207378_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
AXZ22083.1|3207452_3207710_+	lF-82	NA	NA	NA	NA	NA
AXZ20001.1|3207787_3208372_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
AXZ20002.1|3208368_3209844_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.4	5.4e-279
AXZ20003.1|3209840_3210632_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ22084.1|3211222_3211411_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ20004.1|3211432_3211636_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ20005.1|3211639_3213319_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
AXZ20006.1|3213315_3213627_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	5.0e-17
AXZ20007.1|3213663_3213861_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ20008.1|3213902_3214301_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
AXZ20009.1|3214313_3215321_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	4.7e-181
AXZ20010.1|3215330_3215723_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
AXZ20011.1|3215715_3215994_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
AXZ20012.1|3216042_3216654_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
AXZ20013.1|3216653_3219131_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.6	6.2e-267
AXZ20014.1|3219132_3219603_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
AXZ20015.1|3219595_3220093_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
AXZ20016.1|3220105_3222622_+	hypothetical protein	NA	Q858G0	Salmonella_phage	53.0	1.2e-246
AXZ20017.1|3222621_3224499_+	hypothetical protein	NA	Q858F9	Salmonella_phage	58.0	9.0e-194
AXZ20018.1|3224498_3227273_+	hypothetical protein	NA	Q858F8	Salmonella_phage	78.2	0.0e+00
AXZ20019.1|3227269_3227599_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ20020.1|3227633_3227786_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	5.6e-14
AXZ20021.1|3227877_3228423_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
AXZ20022.1|3228346_3228682_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ20023.1|3228810_3229107_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	8.1e-25
AXZ20024.1|3231854_3232076_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ20025.1|3232328_3232733_+	hypothetical protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
AXZ20026.1|3232719_3233025_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	80.4	6.0e-39
AXZ20027.1|3233014_3233644_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	77.4	7.4e-92
AXZ20028.1|3233640_3234156_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	88.8	1.4e-69
AXZ20029.1|3234342_3236211_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
AXZ20030.1|3236194_3237373_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AXZ20031.1|3237666_3238899_-	MFS transporter	NA	NA	NA	NA	NA
AXZ20032.1|3238996_3239884_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ20033.1|3239980_3240172_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
AXZ20034.1|3240524_3242753_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AXZ20035.1|3242806_3244339_-	exopolyphosphatase	NA	NA	NA	NA	NA
AXZ20036.1|3244342_3246403_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
AXZ20037.1|3246583_3247225_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
AXZ20038.1|3247221_3248259_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
AXZ20039.1|3248522_3249416_+	beta-glucoside kinase	NA	NA	NA	NA	NA
AXZ20040.1|3249425_3250859_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AXZ20041.1|3251076_3251703_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AXZ20042.1|3251798_3253085_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.9	4.1e-65
AXZ20043.1|3253183_3253885_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AXZ20044.1|3253881_3254793_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
>prophage 3
CP032200	Klebsiella pneumoniae strain AR_0097 chromosome, complete genome	5309987	3320382	3407318	5309987	portal,head,tRNA,protease,integrase,holin,capsid,tail,terminase	Klebsiella_phage(33.33%)	96	3343385:3343412	3384564:3384591
AXZ20108.1|3320382_3321801_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AXZ20109.1|3321852_3322245_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ20110.1|3322248_3322602_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ20111.1|3323223_3325395_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXZ20112.1|3325443_3326646_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AXZ20113.1|3326992_3328234_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AXZ20114.1|3328291_3328651_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AXZ20115.1|3328781_3329774_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
AXZ22087.1|3329954_3331616_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
AXZ20116.1|3331612_3332848_-	ion channel protein	NA	NA	NA	NA	NA
AXZ20117.1|3333111_3334077_+	glucokinase	NA	NA	NA	NA	NA
AXZ22088.1|3334130_3334868_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
AXZ20118.1|3334879_3336577_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
AXZ20119.1|3336685_3336871_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
AXZ20120.1|3336959_3338174_+	alanine transaminase	NA	NA	NA	NA	NA
AXZ22089.1|3338244_3338316_-	membrane protein YpdK	NA	NA	NA	NA	NA
AXZ20121.1|3338654_3339851_-	MFS transporter	NA	NA	NA	NA	NA
AXZ20122.1|3339847_3340306_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.2e-11
AXZ20123.1|3340438_3341347_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
AXZ20124.1|3341356_3342238_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
AXZ20125.1|3342605_3343088_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
3343385:3343412	attL	TCGTTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AXZ20126.1|3343606_3344776_+	DUF4102 domain-containing protein	NA	A0A2R2Z2Y0	Escherichia_phage	85.8	5.6e-202
AXZ20127.1|3344997_3345723_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ20128.1|3345838_3346024_-	DNA-binding protein	NA	G3CFG7	Escherichia_phage	60.0	3.8e-12
AXZ22090.1|3346031_3346340_-	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	72.1	3.4e-18
AXZ20129.1|3346636_3346924_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ20130.1|3346916_3347141_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.8	3.2e-13
AXZ20131.1|3347137_3347266_-|integrase	integrase	integrase	NA	NA	NA	NA
AXZ20132.1|3347455_3348316_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.1	1.0e-72
AXZ20133.1|3348397_3349210_-	DUF2303 family protein	NA	NA	NA	NA	NA
AXZ20134.1|3349253_3349613_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ20135.1|3350061_3350574_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ20136.1|3351329_3351536_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	56.7	5.1e-10
AXZ20137.1|3351573_3352608_-	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	43.2	3.9e-74
AXZ22091.1|3352665_3353370_-	helix-turn-helix domain-containing protein	NA	G8C7U1	Escherichia_phage	60.1	3.7e-68
AXZ20138.1|3353475_3353736_+	hypothetical protein	NA	A0A1B5FPK9	Escherichia_phage	42.0	1.2e-08
AXZ20139.1|3353764_3354295_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	61.8	7.9e-55
AXZ20140.1|3354337_3354616_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ20141.1|3354777_3355053_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ20142.1|3355045_3356575_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	5.1e-203
AXZ20143.1|3356571_3357543_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.1	1.6e-109
AXZ22092.1|3357512_3358157_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
AXZ20144.1|3358153_3358798_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.2	3.4e-84
AXZ20145.1|3358787_3359192_+	antitermination protein	NA	S5M7R9	Escherichia_phage	54.0	5.5e-32
AXZ20146.1|3359401_3359788_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
AXZ20147.1|3359774_3360056_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
AXZ20148.1|3360055_3360685_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	8.4e-88
AXZ20149.1|3360687_3360963_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	37.1	6.0e-06
AXZ20150.1|3360913_3361093_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.3	1.9e-21
AXZ20151.1|3361154_3361400_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ20152.1|3361467_3361662_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	4.3e-19
AXZ20153.1|3362064_3362310_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	2.1e-34
AXZ20154.1|3362371_3362722_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.9	1.2e-51
AXZ20155.1|3362880_3363378_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	71.3	7.4e-63
AXZ20156.1|3363381_3365133_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	71.6	9.7e-251
AXZ20157.1|3365280_3366507_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.0	2.5e-208
AXZ20158.1|3366499_3367099_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
AXZ20159.1|3367108_3368347_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	70.1	4.7e-159
AXZ20160.1|3368424_3368742_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	1.2e-21
AXZ20161.1|3368811_3369009_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
AXZ20162.1|3369010_3369343_+|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
AXZ20163.1|3369335_3369875_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
AXZ20164.1|3369871_3370237_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
AXZ20165.1|3370293_3370785_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	8.6e-88
AXZ20166.1|3370828_3371182_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
AXZ20167.1|3371214_3371478_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
AXZ20168.1|3371543_3372011_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ20169.1|3372055_3374503_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.6	2.0e-278
AXZ20170.1|3374502_3374982_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.1	3.9e-93
AXZ20171.1|3374968_3375451_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	97.5	6.7e-85
AXZ20172.1|3375460_3375841_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	96.0	2.8e-70
AXZ20173.1|3375837_3378909_+	kinase	NA	A0A286S259	Klebsiella_phage	98.0	0.0e+00
AXZ20174.1|3382691_3382931_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	6.1e-15
AXZ20175.1|3382930_3383257_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	9.6e-27
AXZ20176.1|3383689_3383935_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ20177.1|3384679_3385609_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.1	4.4e-133
3384564:3384591	attR	TCGTTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AXZ20178.1|3385898_3386660_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AXZ20179.1|3386721_3388050_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AXZ20180.1|3388417_3388702_+	DUF406 family protein	NA	NA	NA	NA	NA
AXZ20181.1|3388861_3390172_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AXZ20182.1|3390171_3392316_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AXZ20183.1|3392525_3393011_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AXZ20184.1|3393031_3393583_-	endonuclease SmrB	NA	NA	NA	NA	NA
AXZ20185.1|3393750_3394683_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXZ20186.1|3394724_3395810_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
AXZ20187.1|3395812_3396634_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AXZ20188.1|3396633_3397443_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ20189.1|3397442_3397991_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AXZ20190.1|3398022_3398304_+	YfcL family protein	NA	NA	NA	NA	NA
AXZ22093.1|3398365_3400354_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AXZ20191.1|3400512_3401733_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AXZ20192.1|3401942_3403118_+	arabinose transporter	NA	NA	NA	NA	NA
AXZ20193.1|3403204_3404182_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AXZ20194.1|3404292_3405429_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
AXZ20195.1|3405492_3406506_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXZ20196.1|3406505_3407318_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 4
CP032200	Klebsiella pneumoniae strain AR_0097 chromosome, complete genome	5309987	3606348	3613252	5309987		Planktothrix_phage(33.33%)	6	NA	NA
AXZ22101.1|3606348_3607212_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AXZ20364.1|3607222_3607996_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AXZ22102.1|3608235_3609129_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AXZ20365.1|3609374_3610736_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AXZ20366.1|3611054_3611777_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AXZ20367.1|3611773_3613252_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
CP032200	Klebsiella pneumoniae strain AR_0097 chromosome, complete genome	5309987	4576123	4587010	5309987		Escherichia_phage(87.5%)	9	NA	NA
AXZ21244.1|4576123_4579231_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.4	0.0e+00
AXZ21245.1|4579285_4580551_+	MFS transporter	NA	NA	NA	NA	NA
AXZ21246.1|4580581_4581670_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AXZ21247.1|4581756_4582017_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AXZ21248.1|4582314_4583175_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AXZ21249.1|4583195_4583957_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXZ21250.1|4584217_4585120_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AXZ21251.1|4585131_4586397_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
AXZ21252.1|4586389_4587010_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
CP032200	Klebsiella pneumoniae strain AR_0097 chromosome, complete genome	5309987	4622301	4720578	5309987	portal,head,transposase,protease,integrase,holin,capsid,tail,terminase	Klebsiella_phage(60.78%)	112	4626923:4626939	4702852:4702868
AXZ22150.1|4622301_4623039_+|protease	serine protease	protease	NA	NA	NA	NA
AXZ21286.1|4623052_4623169_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ21287.1|4623212_4623542_-	spermidine export protein MdtI	NA	NA	NA	NA	NA
AXZ21288.1|4623528_4623891_-	multidrug transporter subunit MdtJ	NA	NA	NA	NA	NA
AXZ21289.1|4624333_4625368_+	AI-2E family transporter	NA	NA	NA	NA	NA
AXZ21290.1|4625592_4627248_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
4626923:4626939	attL	TGCCGCTGGCGCCGGTG	NA	NA	NA	NA
AXZ21291.1|4627247_4628090_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
AXZ21292.1|4628107_4628407_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
AXZ21293.1|4628399_4629233_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
AXZ21294.1|4629232_4630033_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
AXZ21295.1|4630169_4631129_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
AXZ21296.1|4631132_4631750_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
AXZ21297.1|4631749_4632652_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
AXZ21298.1|4632641_4633568_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ21299.1|4633830_4634034_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ22151.1|4634221_4635400_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21300.1|4635402_4635798_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21301.1|4635958_4637614_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AXZ21302.1|4637878_4638799_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AXZ21303.1|4638962_4639319_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ21304.1|4639474_4641091_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
AXZ21305.1|4641087_4641807_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
AXZ21306.1|4641787_4642738_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AXZ21307.1|4642805_4645583_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	1.1e-65
AXZ21308.1|4645669_4645801_-	transcriptional regulator	NA	NA	NA	NA	NA
AXZ21309.1|4646225_4647737_+	anion permease	NA	NA	NA	NA	NA
AXZ21310.1|4647791_4649444_+	class I fumarate hydratase	NA	NA	NA	NA	NA
AXZ21311.1|4649615_4651223_+	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AXZ21312.1|4651827_4652217_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AXZ21313.1|4652209_4652974_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AXZ21314.1|4652963_4654316_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
AXZ21315.1|4654325_4655528_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AXZ21316.1|4655537_4656194_-	CoA transferase subunit B	NA	NA	NA	NA	NA
AXZ21317.1|4656204_4656891_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
AXZ21318.1|4657060_4657867_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ21319.1|4657863_4658427_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AXZ21320.1|4658528_4659437_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ21321.1|4659603_4660914_+	amidohydrolase	NA	NA	NA	NA	NA
AXZ21322.1|4660913_4662359_+	amidohydrolase	NA	NA	NA	NA	NA
AXZ21323.1|4662482_4663601_+	aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
AXZ21324.1|4663729_4664830_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	2.2e-115
AXZ21325.1|4665015_4665432_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	46.1	6.1e-26
AXZ21326.1|4666110_4666383_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ21327.1|4666379_4666913_-	acyltransferase	NA	NA	NA	NA	NA
AXZ21328.1|4667236_4668356_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
AXZ21329.1|4668598_4671388_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ21330.1|4671465_4674534_-	kinase	NA	A0A286S259	Klebsiella_phage	97.8	0.0e+00
AXZ21331.1|4674530_4674911_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
AXZ21332.1|4674920_4675403_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	97.5	4.3e-84
AXZ21333.1|4675389_4675869_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
AXZ21334.1|4675868_4678304_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	88.5	0.0e+00
AXZ21335.1|4678829_4679093_-|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	98.9	6.9e-44
AXZ21336.1|4679125_4679479_-|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	80.3	1.3e-48
AXZ21337.1|4679522_4680014_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
AXZ21338.1|4680070_4680436_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
AXZ21339.1|4680432_4680972_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
AXZ21340.1|4680964_4681297_-|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
AXZ21341.1|4681298_4681496_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
AXZ21342.1|4681556_4681883_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
AXZ21343.1|4682109_4683273_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	100.0	2.7e-212
AXZ21344.1|4683284_4683965_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
AXZ21345.1|4683970_4685248_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	99.5	1.8e-246
AXZ21346.1|4685250_4686783_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
AXZ21347.1|4686792_4687227_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
AXZ21348.1|4687439_4687730_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	91.7	2.5e-50
AXZ21349.1|4687738_4688053_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ21350.1|4688214_4688460_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	51.3	5.9e-13
AXZ21351.1|4688564_4688858_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.1	1.3e-30
AXZ21352.1|4688854_4689049_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.9	6.9e-25
AXZ21353.1|4688999_4689275_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	42.7	4.4e-09
AXZ21354.1|4689271_4689619_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	1.2e-40
AXZ21355.1|4689615_4690155_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
AXZ21356.1|4690151_4690463_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.5	1.1e-40
AXZ21357.1|4690739_4691522_-	antitermination protein	NA	F1C595	Cronobacter_phage	78.3	8.5e-114
AXZ21358.1|4691518_4691887_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.3	2.1e-38
AXZ21359.1|4691873_4693253_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	65.0	1.6e-160
AXZ21360.1|4693249_4694128_-	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	62.7	1.9e-82
AXZ21361.1|4694139_4694970_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	67.9	1.8e-85
AXZ21362.1|4694966_4695155_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AXZ21363.1|4695230_4695458_-	transcriptional regulator	NA	A0A0N7C1T6	Escherichia_phage	60.0	9.0e-16
AXZ21364.1|4695582_4696290_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	50.6	4.0e-54
AXZ21365.1|4696448_4696757_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	59.6	3.5e-23
AXZ21366.1|4696746_4696941_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	50.0	2.6e-08
AXZ21367.1|4697112_4697337_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21368.1|4697337_4697703_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
AXZ21369.1|4698135_4698561_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AXZ21370.1|4698557_4698752_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21371.1|4698748_4699576_+	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AXZ21372.1|4699680_4700199_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.3	1.1e-93
AXZ21373.1|4700204_4700921_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	83.9	5.1e-105
AXZ21374.1|4700917_4701481_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	37.2	3.7e-26
AXZ21375.1|4701477_4701702_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	2.0e-28
AXZ21376.1|4702215_4702476_+	pyocin activator protein PrtN	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
AXZ21377.1|4703086_4703245_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
4702852:4702868	attR	TGCCGCTGGCGCCGGTG	NA	NA	NA	NA
AXZ21378.1|4703537_4704053_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
AXZ21379.1|4704247_4705000_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
AXZ21380.1|4705138_4706089_+	universal stress protein UspE	NA	NA	NA	NA	NA
AXZ22152.1|4706198_4706387_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ21381.1|4706535_4707924_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
AXZ21382.1|4707934_4709464_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AXZ21383.1|4709806_4709989_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21384.1|4709985_4710936_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXZ21385.1|4710913_4711114_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ21386.1|4711113_4712496_+	amino acid permease	NA	NA	NA	NA	NA
AXZ21387.1|4712532_4713255_+	dihydromonapterin reductase	NA	NA	NA	NA	NA
AXZ21388.1|4713251_4713587_-	GlpM family protein	NA	NA	NA	NA	NA
AXZ21389.1|4713715_4714435_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
AXZ21390.1|4714677_4715040_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21391.1|4715296_4716598_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
AXZ21392.1|4716673_4717606_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
AXZ21393.1|4717595_4718996_-	class II fumarate hydratase	NA	NA	NA	NA	NA
AXZ21394.1|4719214_4720578_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	3.0e-74
>prophage 7
CP032200	Klebsiella pneumoniae strain AR_0097 chromosome, complete genome	5309987	5031558	5112262	5309987	portal,head,tRNA,transposase,protease,integrase,holin,capsid,tail,terminase	Enterobacterial_phage(16.33%)	102	5024088:5024105	5120294:5120311
5024088:5024105	attL	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
AXZ21677.1|5031558_5032059_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AXZ21678.1|5032175_5032622_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AXZ22160.1|5032605_5033397_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ21679.1|5033498_5034683_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AXZ21680.1|5034714_5035407_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ21681.1|5035552_5036062_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AXZ21682.1|5036048_5036405_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AXZ21683.1|5036394_5036634_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AXZ21684.1|5036934_5037948_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
AXZ21685.1|5038005_5038107_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ22161.1|5038106_5038181_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21686.1|5038298_5038424_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21687.1|5038483_5038747_-	DUF2534 family protein	NA	NA	NA	NA	NA
AXZ21688.1|5038877_5039516_-	leucine efflux protein	NA	NA	NA	NA	NA
AXZ21689.1|5039605_5040520_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AXZ21690.1|5040735_5040927_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21691.1|5041181_5042225_-	type II asparaginase	NA	NA	NA	NA	NA
AXZ21692.1|5042527_5043736_+	HD domain-containing protein	NA	NA	NA	NA	NA
AXZ21693.1|5043808_5045593_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AXZ21694.1|5045599_5046490_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ21695.1|5046610_5048119_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
AXZ21696.1|5048429_5049116_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AXZ21697.1|5049724_5050357_-	DNA-binding protein	NA	NA	NA	NA	NA
AXZ21698.1|5050923_5051121_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21699.1|5051236_5052247_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AXZ21700.1|5052243_5053650_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXZ21701.1|5053705_5054581_-	manganese catalase family protein	NA	NA	NA	NA	NA
AXZ21702.1|5054597_5055104_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXZ21703.1|5055130_5055625_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXZ21704.1|5055715_5055901_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AXZ21705.1|5056523_5057717_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AXZ21706.1|5057829_5058057_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AXZ21707.1|5058077_5058263_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ21708.1|5058506_5058830_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AXZ21709.1|5058822_5059215_+	amino acid-binding protein	NA	NA	NA	NA	NA
AXZ21710.1|5059211_5059925_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ21711.1|5060197_5060350_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AXZ21712.1|5060528_5060900_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	1.4e-26
AXZ21713.1|5060856_5061096_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	54.4	9.8e-21
AXZ21714.1|5061507_5061930_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.8e-26
AXZ21715.1|5062007_5062556_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	91.7	1.5e-88
AXZ21716.1|5062643_5064416_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21717.1|5064425_5064647_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
AXZ21718.1|5064684_5064906_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ21719.1|5064907_5067241_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ21720.1|5067301_5070385_-	kinase	NA	A0A286S259	Klebsiella_phage	71.9	0.0e+00
AXZ21721.1|5070381_5070762_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
AXZ21722.1|5070771_5071257_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
AXZ21723.1|5071243_5071717_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.4	1.6e-54
AXZ21724.1|5071737_5075124_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	58.2	1.6e-305
AXZ21725.1|5075184_5075418_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.4e-08
AXZ21726.1|5075491_5075797_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
AXZ21727.1|5075799_5076204_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
AXZ21728.1|5076234_5076939_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.9	5.5e-80
AXZ21729.1|5076995_5077343_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
AXZ21730.1|5077339_5077789_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	1.5e-62
AXZ21731.1|5077785_5078124_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	5.1e-39
AXZ21732.1|5078132_5078450_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	7.4e-24
AXZ21733.1|5078527_5079766_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.4	5.2e-158
AXZ21734.1|5079775_5080375_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
AXZ21735.1|5080367_5081594_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.0	7.1e-208
AXZ21736.1|5081741_5083493_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	5.2e-252
AXZ21737.1|5083496_5083994_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	1.9e-63
AXZ21738.1|5084151_5084502_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	80.2	1.2e-51
AXZ21739.1|5084504_5084825_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ21740.1|5084948_5085098_-	Rz1 lytic protein	NA	S5FXQ4	Shigella_phage	71.4	1.1e-09
AXZ21741.1|5085090_5085480_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	1.5e-23
AXZ22162.1|5085476_5085974_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	83.6	9.6e-79
AXZ21742.1|5085951_5086221_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
AXZ21743.1|5087401_5088223_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21744.1|5088247_5088733_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21745.1|5088781_5089123_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	87.6	3.5e-56
AXZ21746.1|5089141_5090122_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	4.2e-134
AXZ21747.1|5090134_5090512_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	1.9e-47
AXZ21748.1|5090521_5091331_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	1.2e-110
AXZ21749.1|5091327_5092296_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	71.3	2.4e-97
AXZ21750.1|5092285_5092465_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
AXZ21751.1|5092702_5093155_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.2	7.7e-67
AXZ21752.1|5093183_5093447_-	Cro/Cl family transcriptional regulator	NA	D0UIL8	Aggregatibacter_phage	47.9	3.7e-13
AXZ21753.1|5093548_5094025_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	1.1e-12
AXZ21754.1|5094196_5095351_+	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	28.2	1.5e-34
AXZ21755.1|5095823_5096123_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	1.2e-12
AXZ21756.1|5096122_5096908_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	3.1e-63
AXZ21757.1|5097555_5098008_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21758.1|5098009_5098282_+	hypothetical protein	NA	K7PMC8	Enterobacterial_phage	84.4	2.5e-36
AXZ21759.1|5098278_5098857_+	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	37.4	2.1e-21
AXZ21760.1|5098849_5099068_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ21761.1|5099067_5099340_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	39.4	1.7e-08
AXZ21762.1|5099368_5099605_+	excisionase	NA	NA	NA	NA	NA
AXZ21763.1|5099594_5100737_+|integrase	integrase	integrase	Q77Z02	Phage_21	82.2	9.1e-173
AXZ21764.1|5100849_5102100_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AXZ21765.1|5102340_5102991_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AXZ21766.1|5103007_5103466_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXZ22163.1|5103522_5104629_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AXZ21767.1|5104683_5105325_+	lysogenization regulator HflD	NA	NA	NA	NA	NA
AXZ21768.1|5105328_5106699_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	4.7e-107
AXZ21769.1|5106753_5107116_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AXZ21770.1|5107199_5108006_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ21771.1|5108288_5108960_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AXZ21772.1|5108959_5110426_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AXZ21773.1|5110511_5111633_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXZ21774.1|5111770_5112262_-|transposase	transposase	transposase	NA	NA	NA	NA
5120294:5120311	attR	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
>prophage 1
CP032195	Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence	143515	0	2021	143515		uncultured_virus(100.0%)	2	NA	NA
AXZ16671.1|1095_1527_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AXZ16672.1|1670_2021_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
>prophage 2
CP032195	Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence	143515	15701	26435	143515	integrase	Macacine_betaherpesvirus(42.86%)	13	11324:11337	20054:20067
11324:11337	attL	TCGTCTGATTAAAC	NA	NA	NA	NA
AXZ16681.1|15701_16442_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AXZ16682.1|16624_16822_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16683.1|17158_18169_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	8.8e-87
AXZ16684.1|18920_20087_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
20054:20067	attR	TCGTCTGATTAAAC	NA	NA	NA	NA
AXZ16685.1|20086_21058_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	3.1e-150
AXZ16686.1|22167_22473_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16687.1|22526_22778_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AXZ16688.1|22856_24128_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	1.9e-155
AXZ16689.1|24127_24553_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	50.4	3.7e-31
AXZ16820.1|24765_24996_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16690.1|25259_25481_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16691.1|25518_25944_+	antirestriction protein	NA	NA	NA	NA	NA
AXZ16692.1|26180_26435_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.7	1.2e-11
>prophage 3
CP032195	Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence	143515	29575	33939	143515		Thalassomonas_phage(33.33%)	6	NA	NA
AXZ16699.1|29575_30139_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	33.5	1.1e-17
AXZ16700.1|30033_30354_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16701.1|30650_30869_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16702.1|30972_31515_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
AXZ16703.1|31563_31812_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXZ16704.1|31881_33939_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	1.8e-22
>prophage 4
CP032195	Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence	143515	38229	41832	143515		Klebsiella_phage(25.0%)	8	NA	NA
AXZ16713.1|38229_38586_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
AXZ16714.1|38646_38859_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16715.1|38869_39094_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16716.1|39174_39495_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
AXZ16717.1|39484_39763_+	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AXZ16718.1|39763_40177_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXZ16719.1|40694_40913_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16720.1|41010_41832_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 5
CP032195	Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence	143515	75816	76542	143515		Xanthomonas_phage(100.0%)	1	NA	NA
AXZ16754.1|75816_76542_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.0	6.0e-05
>prophage 6
CP032195	Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence	143515	87313	112060	143515	transposase,integrase	Escherichia_phage(37.5%)	25	88706:88721	111302:111317
AXZ16762.1|87313_88018_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
88706:88721	attL	AGGGCACTGTTGCAAA	NA	NA	NA	NA
AXZ16763.1|88770_89475_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ16764.1|89931_90546_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AXZ16765.1|90484_91498_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ16766.1|91642_92140_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AXZ16767.1|92251_92542_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AXZ16768.1|92547_93339_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AXZ16769.1|93502_93850_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXZ16770.1|93843_94683_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXZ16771.1|94612_94792_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16772.1|94810_95083_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16773.1|95264_96269_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXZ16774.1|96629_97049_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AXZ16775.1|97131_99195_+	TonB-dependent copper receptor	NA	NA	NA	NA	NA
AXZ16776.1|99251_99512_+	DUF2534 family protein	NA	NA	NA	NA	NA
AXZ16777.1|100390_100561_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AXZ16778.1|100617_101871_-	MFS transporter	NA	NA	NA	NA	NA
AXZ16779.1|101922_104997_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
AXZ16780.1|105118_106201_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.1	4.4e-185
AXZ16781.1|106423_106639_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16782.1|108074_109079_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXZ16783.1|110217_110508_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AXZ16784.1|110504_110906_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AXZ16785.1|110895_111252_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXZ16786.1|111355_112060_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
111302:111317	attR	AGGGCACTGTTGCAAA	NA	NA	NA	NA
>prophage 7
CP032195	Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence	143515	117087	126488	143515	transposase	Stx2-converting_phage(50.0%)	14	NA	NA
AXZ16790.1|117087_118315_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	3.5e-170
AXZ16791.1|118448_118679_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16792.1|118692_118896_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AXZ16793.1|118956_119451_-	DNA-binding protein	NA	NA	NA	NA	NA
AXZ16794.1|119481_120054_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16795.1|120058_120304_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16796.1|120616_120796_+	antitoxin	NA	NA	NA	NA	NA
AXZ16797.1|120761_120881_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXZ16798.1|121254_121662_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
AXZ16799.1|121658_122009_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.1e-39
AXZ16800.1|122038_123628_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	8.1e-188
AXZ16801.1|123760_124195_-	copper-binding protein	NA	NA	NA	NA	NA
AXZ16802.1|124410_125811_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
AXZ16803.1|125807_126488_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 8
CP032195	Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence	143515	131581	138838	143515		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
AXZ16809.1|131581_132319_+	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AXZ16810.1|132352_132550_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AXZ16811.1|132590_135038_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AXZ16812.1|135164_135605_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16813.1|135691_138838_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.6	3.1e-61
>prophage 9
CP032195	Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence	143515	142211	142892	143515		Bacillus_phage(100.0%)	1	NA	NA
AXZ16817.1|142211_142892_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
>prophage 1
CP032196	Klebsiella pneumoniae strain AR_0097 plasmid unnamed2, complete sequence	109398	0	109171	109398	capsid,tail,terminase,integrase	Salmonella_phage(82.95%)	117	42857:42877	66907:66927
AXZ16828.1|535_2113_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	71.5	9.8e-210
AXZ16829.1|2167_2506_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16830.1|2569_3118_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16831.1|3417_4071_+	hypothetical protein	NA	J9Q754	Salmonella_phage	50.2	3.5e-52
AXZ16832.1|4681_5164_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16833.1|5395_5842_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	44.4	3.6e-24
AXZ16834.1|5967_6297_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	55.6	4.5e-16
AXZ16835.1|6465_6828_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16836.1|6988_7357_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16941.1|7356_7569_-	hypothetical protein	NA	J9Q804	Salmonella_phage	50.0	1.6e-11
AXZ16837.1|7589_7808_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	35.7	8.1e-06
AXZ16838.1|9340_9652_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16839.1|9842_10163_-	hypothetical protein	NA	J9Q750	Salmonella_phage	70.8	4.6e-42
AXZ16840.1|10233_10461_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16841.1|10534_11146_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16842.1|11187_11367_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16843.1|11375_13040_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	65.2	1.6e-210
AXZ16844.1|13162_13801_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	53.1	4.9e-51
AXZ16845.1|13797_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16846.1|13988_14249_-	hypothetical protein	NA	I6WB67	Aeromonas_phage	35.7	4.8e-05
AXZ16847.1|14380_14677_+	hypothetical protein	NA	G8C7R5	Escherichia_phage	39.6	4.5e-07
AXZ16848.1|14686_15337_+	hypothetical protein	NA	G8C7R6	Escherichia_phage	50.5	5.2e-56
AXZ16849.1|15949_16267_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16850.1|16311_16746_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16851.1|16831_17620_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	64.9	1.3e-82
AXZ16852.1|17808_18234_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	77.3	4.1e-54
AXZ16942.1|18952_19453_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	54.1	8.3e-46
AXZ16853.1|20103_20328_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	51.4	5.4e-13
AXZ16854.1|20506_21121_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	71.3	3.5e-78
AXZ16855.1|21290_21644_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	42.9	1.8e-15
AXZ16856.1|21643_22462_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	44.1	4.1e-26
AXZ16857.1|22598_23141_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	59.8	6.2e-55
AXZ16858.1|23137_23545_-	hypothetical protein	NA	J9Q743	Salmonella_phage	33.3	9.2e-11
AXZ16859.1|23599_24250_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	46.2	5.9e-28
AXZ16860.1|24246_24729_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	52.5	2.8e-43
AXZ16861.1|24725_25127_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	36.5	9.7e-13
AXZ16862.1|25140_26232_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	60.9	8.2e-131
AXZ16863.1|26427_27294_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	47.1	9.9e-63
AXZ16864.1|27367_28510_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	82.4	2.5e-183
AXZ16865.1|28629_30957_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	71.6	0.0e+00
AXZ16866.1|31037_31610_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	58.1	4.8e-58
AXZ16867.1|31626_32259_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16868.1|33091_35008_-	exonuclease	NA	J9Q741	Salmonella_phage	55.3	1.6e-185
AXZ16869.1|35004_36090_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	72.0	1.5e-148
AXZ16870.1|36325_36973_-	hypothetical protein	NA	J9Q739	Salmonella_phage	51.6	1.8e-61
AXZ16871.1|37289_38402_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	47.5	4.1e-77
AXZ16872.1|38766_38982_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	42.9	8.8e-05
AXZ16873.1|38981_39320_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16943.1|39509_39716_-	hypothetical protein	NA	J9Q738	Salmonella_phage	52.2	2.0e-14
AXZ16874.1|39883_40081_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16875.1|40271_40583_-	hypothetical protein	NA	A0A2H4FWM4	Salmonella_phage	69.8	1.0e-09
AXZ16876.1|40572_41313_-	hypothetical protein	NA	G4KK93	Yersinia_phage	32.7	1.4e-25
AXZ16877.1|41448_41706_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16878.1|41795_42623_-	SPFH/Band 7/PHB domain protein	NA	G0YQD7	Erwinia_phage	67.9	1.9e-103
AXZ16879.1|42619_42889_-	hypothetical protein	NA	NA	NA	NA	NA
42857:42877	attL	AGATAAGCACTTACTTATCAT	NA	NA	NA	NA
AXZ16880.1|42945_43671_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16944.1|43688_44729_-	recombinase	NA	J9Q736	Salmonella_phage	72.6	5.4e-148
AXZ16881.1|44772_45033_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16882.1|45029_46007_-	exonuclease	NA	J9Q7S6	Salmonella_phage	65.4	1.4e-121
AXZ16883.1|46052_47030_-	regulator	NA	J9Q7Z3	Salmonella_phage	45.6	3.6e-61
AXZ16884.1|47096_47537_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	48.3	3.5e-32
AXZ16885.1|47746_48169_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16886.1|48165_49326_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	62.6	3.0e-139
AXZ16887.1|49396_51769_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	66.7	8.7e-311
AXZ16888.1|51765_51954_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	48.2	2.3e-09
AXZ16889.1|51946_53197_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	62.6	1.5e-144
AXZ16890.1|53295_55308_-	hypothetical protein	NA	J9Q7G6	Salmonella_phage	45.7	3.3e-125
AXZ16891.1|55394_55613_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16892.1|55918_56224_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXZ16893.1|56213_57260_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	2.1e-19
AXZ16894.1|57431_58016_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16895.1|58320_58644_-	hypothetical protein	NA	A0A2H4IBK3	Erwinia_phage	48.6	8.3e-23
AXZ16896.1|58733_58979_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.6	1.9e-11
AXZ16897.1|59204_59450_-	hypothetical protein	NA	A0A1S6UB66	Serratia_phage	56.8	7.4e-16
AXZ16945.1|59446_59887_-	DUF2829 domain-containing protein	NA	K4N0H8	Escherichia_phage	43.8	3.9e-23
AXZ16898.1|59978_60809_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.2	9.1e-90
AXZ16899.1|60975_61587_-	hypothetical protein	NA	S4TP42	Salmonella_phage	33.7	1.7e-16
AXZ16900.1|62828_63080_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16901.1|63231_63447_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	62.9	3.1e-18
AXZ16902.1|63430_63631_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16903.1|63627_64956_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	70.6	1.5e-182
AXZ16904.1|64955_65426_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16905.1|65962_66874_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16906.1|66936_68052_-	DNA primase	NA	J9Q720	Salmonella_phage	66.6	2.0e-148
66907:66927	attR	ATGATAAGTAAGTGCTTATCT	NA	NA	NA	NA
AXZ16907.1|68186_69548_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	70.1	4.5e-179
AXZ16908.1|69592_70333_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	53.0	3.1e-73
AXZ16909.1|70661_71033_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	52.6	6.4e-19
AXZ16910.1|71034_71703_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	70.5	1.8e-88
AXZ16911.1|72020_72272_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	47.0	1.3e-12
AXZ16912.1|72268_72961_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	78.0	1.1e-99
AXZ16913.1|72971_73286_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	69.8	2.3e-33
AXZ16914.1|73367_74909_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	43.1	6.1e-47
AXZ16915.1|74955_88440_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	55.2	1.2e-37
AXZ16916.1|88451_89063_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	62.6	6.5e-69
AXZ16917.1|89050_89854_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	76.4	2.2e-117
AXZ16918.1|89843_90542_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	76.1	2.3e-102
AXZ16919.1|90598_90934_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	73.6	2.7e-45
AXZ16920.1|90982_95539_-	hypothetical protein	NA	J9Q712	Salmonella_phage	36.1	2.3e-174
AXZ16921.1|95543_95771_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	75.3	2.0e-23
AXZ16922.1|95899_96217_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	64.8	3.1e-30
AXZ16923.1|97166_97616_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16924.1|97705_98086_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	46.8	1.7e-30
AXZ16925.1|98085_98580_-	hypothetical protein	NA	J9Q711	Salmonella_phage	51.2	7.2e-34
AXZ16926.1|98570_98915_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	57.9	1.1e-33
AXZ16927.1|98925_99759_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	49.3	9.2e-74
AXZ16928.1|99758_100184_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	64.3	9.5e-43
AXZ16929.1|100225_100660_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	43.4	4.7e-21
AXZ16930.1|100733_101606_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	81.4	1.0e-131
AXZ16931.1|101635_102520_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	59.1	1.7e-81
AXZ16932.1|102532_104107_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	71.6	6.3e-225
AXZ16933.1|104138_105395_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	90.0	4.7e-231
AXZ16934.1|105394_105982_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	57.5	2.0e-54
AXZ16935.1|106152_106419_-	hypothetical protein	NA	J9Q757	Salmonella_phage	74.7	6.8e-31
AXZ16936.1|106428_107319_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	79.8	1.1e-138
AXZ16937.1|107315_107873_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16938.1|107862_108504_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	87.2	2.0e-97
AXZ16939.1|108496_109171_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	67.3	1.8e-72
>prophage 1
CP032197	Klebsiella pneumoniae strain AR_0097 plasmid unnamed3, complete sequence	73502	0	69285	73502	integrase,transposase	Escherichia_phage(21.21%)	76	32311:32327	64854:64870
AXZ16947.1|325_1579_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXZ16948.1|2314_2494_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16949.1|2486_2609_+	plasmid mobilization protein	NA	NA	NA	NA	NA
AXZ16950.1|2697_3108_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16951.1|3281_4412_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AXZ16952.1|4424_4694_-	metal resistance protein	NA	NA	NA	NA	NA
AXZ16953.1|4799_6098_-	MFS transporter	NA	NA	NA	NA	NA
AXZ16954.1|6331_7090_-	Tat pathway signal sequence	NA	NA	NA	NA	NA
AXZ16955.1|7143_8064_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16956.1|8126_8498_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16957.1|9409_10729_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AXZ16958.1|10978_11860_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
AXZ16959.1|12178_12958_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AXZ16960.1|12954_13980_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AXZ16961.1|14086_17116_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
AXZ16962.1|17225_18941_+|integrase	integrase	integrase	NA	NA	NA	NA
AXZ16963.1|20055_20613_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AXZ17017.1|20846_21401_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
AXZ16964.1|21470_22259_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AXZ16965.1|22318_23143_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
AXZ16966.1|23842_24703_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXZ16967.1|24912_25452_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXZ16968.1|25423_26260_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXZ16969.1|26259_27063_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AXZ16970.1|27123_27939_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AXZ16971.1|28268_28445_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AXZ16972.1|28626_29631_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AXZ16973.1|31527_32232_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ17018.1|32267_32573_+	IncN plasmid KikA protein	NA	NA	NA	NA	NA
32311:32327	attL	CTGCCAGCCATGCTGAA	NA	NA	NA	NA
AXZ16974.1|32608_32920_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17019.1|33128_33617_+	restriction endonuclease	NA	NA	NA	NA	NA
AXZ16975.1|34615_34882_-|transposase	IS1 family transposase	transposase	U5P0U6	Shigella_phage	92.0	3.6e-40
AXZ16976.1|34986_36420_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AXZ16977.1|36453_37662_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AXZ16978.1|37674_37887_-	resolvase	NA	NA	NA	NA	NA
AXZ16979.1|37928_38693_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXZ16980.1|38835_39102_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AXZ16981.1|39322_39796_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AXZ16982.1|39951_40881_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.1	1.5e-45
AXZ16983.1|40771_41476_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ16984.1|41522_41759_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16985.1|41832_42249_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXZ16986.1|42245_42476_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXZ16987.1|43389_44028_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17020.1|44039_44816_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	1.9e-52
AXZ16988.1|44873_45131_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16989.1|45570_45756_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ16990.1|46003_46759_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
AXZ16991.1|46846_48385_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
AXZ16992.1|48433_48781_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AXZ16993.1|48777_49182_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
AXZ16994.1|49770_49998_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ16995.1|49963_51169_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
AXZ16996.1|51165_52143_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.0	9.4e-86
AXZ16997.1|52224_53496_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.5	1.6e-149
AXZ16998.1|53495_53927_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
AXZ16999.1|54159_55131_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AXZ17000.1|55133_55805_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AXZ17001.1|55866_56097_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17002.1|56533_57235_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
AXZ17003.1|57234_57456_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17004.1|57465_57885_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AXZ17005.1|57938_58706_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17006.1|59386_59815_+	antirestriction protein	NA	NA	NA	NA	NA
AXZ17021.1|59859_60366_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
AXZ17007.1|60408_60600_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17022.1|60793_61048_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.7	2.6e-11
AXZ17008.1|61083_61404_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17009.1|62078_62621_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.4	1.7e-49
AXZ17010.1|62669_62918_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXZ17011.1|62986_64987_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.5	3.2e-24
64854:64870	attR	CTGCCAGCCATGCTGAA	NA	NA	NA	NA
AXZ17012.1|65031_65463_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AXZ17013.1|65459_66188_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AXZ17014.1|66184_66511_+	theronine dehydrogenase	NA	NA	NA	NA	NA
AXZ17015.1|66699_68074_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
AXZ17016.1|68244_69285_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
>prophage 1
CP032198	Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence	58029	0	17106	58029	transposase	Escherichia_phage(22.22%)	25	NA	NA
AXZ17024.1|143_368_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ17025.1|791_1310_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17026.1|1639_2287_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.5	9.7e-39
AXZ17027.1|2277_2553_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17028.1|2745_2946_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ17029.1|3047_4319_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	7.3e-147
AXZ17089.1|4330_4780_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	52.0	5.2e-31
AXZ17030.1|4776_5022_-	DinI family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.5e-08
AXZ17031.1|5225_5456_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17032.1|5891_6824_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AXZ17033.1|6859_7093_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17034.1|7089_7425_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17035.1|7810_8512_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
AXZ17036.1|8511_8733_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17037.1|8742_9162_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AXZ17038.1|9215_9983_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17039.1|10663_11092_+	antirestriction protein	NA	NA	NA	NA	NA
AXZ17040.1|11134_11641_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
AXZ17041.1|11683_11875_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17042.1|12062_12326_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.4e-12
AXZ17043.1|12350_12671_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ17044.1|13291_13441_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AXZ17045.1|13471_14029_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	72.4	1.8e-49
AXZ17046.1|14078_14327_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXZ17090.1|16182_17106_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.1e-176
>prophage 2
CP032198	Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence	58029	42131	47393	58029		Virus_Rctr197k(100.0%)	1	NA	NA
AXZ17075.1|42131_47393_+	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.8	3.0e-05
>prophage 3
CP032198	Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence	58029	51443	52001	58029		Wolbachia_phage(100.0%)	1	NA	NA
AXZ17082.1|51443_52001_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	2.4e-17
>prophage 4
CP032198	Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence	58029	56632	57586	58029	transposase	Sodalis_phage(100.0%)	1	NA	NA
AXZ17087.1|56632_57586_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.4	1.4e-62
