The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032194	Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 chromosome, complete genome	4916886	103958	202316	4916886	lysis,terminase,capsid,tail,tRNA,protease,head,portal	Salmonella_phage(76.92%)	104	NA	NA
AXZ35507.1|103958_104762_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AXZ35508.1|104754_106077_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AXZ35509.1|106057_106762_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AXZ35510.1|106761_111228_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AXZ35511.1|111572_113420_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AXZ35512.1|113679_114228_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AXZ35513.1|114255_114903_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXZ35514.1|114964_116155_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AXZ35515.1|116339_117431_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
AXZ35516.1|118037_119438_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
AXZ35517.1|119638_120100_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ35518.1|120416_121631_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
AXZ35519.1|121876_123313_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AXZ35520.1|123390_124593_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AXZ35521.1|124787_126080_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
AXZ35522.1|126124_126373_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AXZ35523.1|126413_126653_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AXZ35524.1|126695_127853_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	99.5	1.0e-216
AXZ35525.1|127815_130743_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	98.6	0.0e+00
AXZ35526.1|130869_131220_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	94.8	2.0e-59
AXZ35527.1|131241_131400_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
AXZ35528.1|131796_132201_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	100.0	4.2e-72
AXZ35529.1|132330_132567_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
AXZ35530.1|132532_132907_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AXZ35531.1|132998_133904_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
AXZ35532.1|133900_134602_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	99.6	8.4e-129
AXZ39995.1|134646_135048_+	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	99.2	6.4e-73
AXZ35533.1|135044_135827_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	92.8	8.6e-66
AXZ35534.1|135826_136300_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	4.3e-68
AXZ39996.1|136657_137215_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	50.5	1.1e-38
AXZ35535.1|137313_137580_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AXZ35536.1|137734_137974_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AXZ35537.1|137963_138269_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AXZ35538.1|138308_138911_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
AXZ35539.1|138910_139117_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	98.5	3.9e-34
AXZ35540.1|139119_139761_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	100.0	3.3e-116
AXZ35541.1|139757_139904_+	YlcG family protein	NA	H6WRZ0	Salmonella_phage	100.0	1.5e-19
AXZ35542.1|139893_140691_+	antitermination protein	NA	H6WRZ1	Salmonella_phage	100.0	5.2e-151
AXZ35543.1|141084_141399_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	100.0	2.4e-51
AXZ35544.1|141401_141944_+	lysozyme	NA	H6WRZ4	Salmonella_phage	100.0	1.6e-103
AXZ35545.1|142341_142809_+|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	99.4	1.5e-78
AXZ35546.1|142859_143171_+	KilA-N domain-containing protein	NA	S4TSR0	Salmonella_phage	93.1	1.4e-48
AXZ35547.1|143192_143516_+	DNA-binding protein	NA	A0A1V0E5R9	Salmonella_phage	99.1	3.6e-58
AXZ35548.1|143512_143770_+	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	100.0	3.8e-39
AXZ35549.1|143914_144460_-	hypothetical protein	NA	S4TR57	Salmonella_phage	100.0	5.0e-97
AXZ35550.1|144536_144872_+	hypothetical protein	NA	S4TTH3	Salmonella_phage	73.9	3.7e-42
AXZ35551.1|144992_145721_+	Fur-regulated protein	NA	M9NZE9	Enterobacteria_phage	77.7	1.4e-97
AXZ35552.1|145735_147193_+	glycosyltransferase family 2 protein	NA	S4TSQ9	Salmonella_phage	97.5	7.8e-286
AXZ35553.1|147393_147756_+	HNH endonuclease	NA	K7PJS8	Enterobacterial_phage	61.6	1.3e-32
AXZ35554.1|147736_148330_+	hypothetical protein	NA	S4TR53	Salmonella_phage	100.0	5.3e-116
AXZ35555.1|148322_148691_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	100.0	3.1e-66
AXZ35556.1|148798_149293_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
AXZ35557.1|149289_150951_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	99.8	0.0e+00
AXZ35558.1|151009_152944_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	100.0	0.0e+00
AXZ35559.1|153148_154504_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	100.0	2.8e-261
AXZ35560.1|154500_155544_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TNN1	Salmonella_phage	100.0	2.0e-134
AXZ35561.1|155540_155867_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	100.0	2.2e-55
AXZ35562.1|155875_156226_+|head,tail	head-tail adaptor protein	head,tail	S4TND9	Salmonella_phage	100.0	1.7e-58
AXZ35563.1|156222_156672_+	hypothetical protein	NA	S4TR46	Salmonella_phage	100.0	1.5e-75
AXZ35564.1|156668_157016_+	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	100.0	1.7e-58
AXZ35565.1|157071_157515_+	hypothetical protein	NA	S4TNM8	Salmonella_phage	95.9	7.5e-75
AXZ35566.1|157523_157907_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
AXZ35567.1|157915_158194_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.6	5.3e-42
AXZ35568.1|158214_158634_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ35569.1|158718_162204_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	72.1	0.0e+00
AXZ35570.1|162249_162609_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ35571.1|162597_162822_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ35572.1|162987_163581_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.9	3.1e-108
AXZ35573.1|163580_164165_+	hypothetical protein	NA	S4TND4	Salmonella_phage	96.9	1.6e-104
AXZ35574.1|164171_164570_+	hypothetical protein	NA	S4TR39	Salmonella_phage	93.2	2.9e-70
AXZ35575.1|164569_167281_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	94.4	0.0e+00
AXZ35576.1|167289_168249_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.7	2.8e-183
AXZ35577.1|168259_169390_+|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	98.9	2.7e-201
AXZ35578.1|169596_169803_-	DinI family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
AXZ35579.1|170229_172842_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	3.7e-20
AXZ35580.1|173049_174060_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AXZ35581.1|174225_174768_+	cell division protein ZapC	NA	NA	NA	NA	NA
AXZ35582.1|174764_175874_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AXZ35583.1|175972_178081_+	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AXZ35584.1|178093_180001_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	5.4e-53
AXZ35585.1|180015_181269_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AXZ35586.1|181273_182914_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AXZ35587.1|182910_183474_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AXZ35588.1|183729_183897_+	ribosome modulation factor	NA	NA	NA	NA	NA
AXZ35589.1|183996_184515_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AXZ35590.1|184583_186344_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
AXZ35591.1|186529_186982_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AXZ39997.1|187053_188106_-	porin OmpA	NA	NA	NA	NA	NA
AXZ35592.1|188462_188972_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AXZ35593.1|189188_189794_+	DNA transformation protein	NA	NA	NA	NA	NA
AXZ35594.1|189780_191934_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AXZ35595.1|191952_192399_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AXZ35596.1|192522_194577_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AXZ35597.1|194612_195071_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AXZ35598.1|195165_195828_-	DUF2057 family protein	NA	NA	NA	NA	NA
AXZ35599.1|195998_196415_+	CoA-binding protein	NA	NA	NA	NA	NA
AXZ35600.1|196459_196777_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AXZ35601.1|196834_198046_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
AXZ35602.1|198260_198809_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AXZ35603.1|198834_199614_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ35604.1|199662_199944_+	acylphosphatase	NA	NA	NA	NA	NA
AXZ35605.1|199940_200270_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AXZ35606.1|200356_201016_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AXZ35607.1|201635_202316_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	1.7e-81
>prophage 2
CP032194	Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 chromosome, complete genome	4916886	1254830	1261127	4916886		Enterobacteria_phage(50.0%)	6	NA	NA
AXZ36661.1|1254830_1255361_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.5	1.4e-51
AXZ36662.1|1255365_1256244_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	3.0e-107
AXZ36663.1|1256291_1257191_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AXZ36664.1|1257190_1258276_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AXZ36665.1|1258652_1259546_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AXZ36666.1|1259723_1261127_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	2.3e-21
>prophage 3
CP032194	Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 chromosome, complete genome	4916886	1342077	1351248	4916886	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AXZ36733.1|1342077_1344111_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
AXZ36734.1|1344351_1344810_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AXZ36735.1|1344981_1345512_+	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AXZ36736.1|1345568_1346036_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AXZ36737.1|1346082_1346802_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXZ36738.1|1346798_1348484_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AXZ36739.1|1348706_1349438_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AXZ36740.1|1349497_1349605_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ36741.1|1349585_1350317_-	ABC transporter permease	NA	NA	NA	NA	NA
AXZ36742.1|1350300_1351248_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 4
CP032194	Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 chromosome, complete genome	4916886	1567385	1635993	4916886	lysis,terminase,capsid,tail,tRNA,protease,head,portal	Salmonella_phage(52.46%)	92	NA	NA
AXZ36940.1|1567385_1568198_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AXZ36941.1|1568197_1569211_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXZ36942.1|1569278_1570415_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.0e-22
AXZ36943.1|1570518_1571520_+	flagella biosynthesis regulator	NA	NA	NA	NA	NA
AXZ36944.1|1571516_1572695_-	MFS transporter	NA	NA	NA	NA	NA
AXZ36945.1|1572874_1573249_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ36946.1|1573421_1573604_+	DNA-binding protein	NA	NA	NA	NA	NA
AXZ36947.1|1573597_1573816_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ36948.1|1573815_1574334_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AXZ36949.1|1574400_1575057_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXZ36950.1|1575154_1576369_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AXZ36951.1|1576468_1578529_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AXZ36952.1|1578580_1578856_-	YfcL family protein	NA	NA	NA	NA	NA
AXZ36953.1|1578888_1579437_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AXZ36954.1|1579436_1580246_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ36955.1|1580245_1581070_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AXZ36956.1|1581073_1582159_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
AXZ36957.1|1582194_1583127_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXZ36958.1|1583292_1583844_+	endonuclease SmrB	NA	NA	NA	NA	NA
AXZ36959.1|1583943_1584429_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AXZ36960.1|1584637_1586785_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AXZ36961.1|1586784_1588095_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AXZ36962.1|1588272_1588557_-	DUF406 family protein	NA	NA	NA	NA	NA
AXZ36963.1|1588927_1590235_+	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AXZ36964.1|1590295_1591051_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AXZ36965.1|1591339_1592281_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	88.2	1.4e-147
AXZ36966.1|1592595_1593765_+	DUF4102 domain-containing protein	NA	C6ZR22	Salmonella_phage	90.0	2.3e-211
AXZ36967.1|1593792_1593906_+	virulence protein	NA	S4TND2	Salmonella_phage	83.8	2.1e-10
AXZ36968.1|1595252_1596212_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.7	2.8e-183
AXZ36969.1|1596220_1598932_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	94.4	0.0e+00
AXZ36970.1|1598931_1599330_-	hypothetical protein	NA	S4TR39	Salmonella_phage	93.2	2.9e-70
AXZ36971.1|1599919_1600513_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.9	3.1e-108
AXZ36972.1|1600678_1600903_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ36973.1|1600891_1601251_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ36974.1|1601296_1604611_-|tail	phage tail tape measure protein	tail	S4TTF9	Salmonella_phage	95.4	0.0e+00
AXZ36975.1|1604657_1604993_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	100.0	7.0e-57
AXZ40058.1|1605049_1605328_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
AXZ36976.1|1605351_1605723_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	94.2	3.0e-61
AXZ36977.1|1605750_1606455_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	74.4	4.4e-93
AXZ36978.1|1606511_1606859_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	97.4	3.2e-57
AXZ36979.1|1606855_1607305_-	hypothetical protein	NA	S4TR46	Salmonella_phage	96.6	2.5e-73
AXZ36980.1|1607301_1607640_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
AXZ36981.1|1607649_1607976_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
AXZ36982.1|1607975_1608173_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.2e-10
AXZ36983.1|1608216_1609434_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.6	1.0e-198
AXZ36984.1|1609443_1610292_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	87.9	1.3e-131
AXZ36985.1|1610305_1611613_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.7	3.8e-215
AXZ36986.1|1611612_1613355_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	1.6e-141
AXZ36987.1|1613308_1613773_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
AXZ36988.1|1613905_1614250_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	75.7	1.0e-47
AXZ36989.1|1614368_1614836_-|lysis	lysis protein	lysis	I6RSQ8	Salmonella_phage	96.8	2.5e-73
AXZ36990.1|1614924_1615422_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	93.3	1.9e-87
AXZ36991.1|1615421_1615694_-	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	100.0	1.1e-41
AXZ36992.1|1616085_1616850_-	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	97.6	8.0e-141
AXZ36993.1|1616846_1617026_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	100.0	7.1e-24
AXZ36994.1|1617006_1617210_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
AXZ36995.1|1617206_1617431_-	protein ninY	NA	Q76H69	Enterobacteria_phage	98.6	4.1e-37
AXZ36996.1|1617427_1618033_-	recombination protein NinG	NA	G9L693	Escherichia_phage	97.0	8.1e-96
AXZ36997.1|1618025_1618202_-	protein ninF	NA	Q76H71	Enterobacteria_phage	96.6	1.5e-26
AXZ36998.1|1618194_1618536_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
AXZ36999.1|1618538_1618715_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	96.6	1.9e-26
AXZ37000.1|1618711_1619158_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	98.6	7.8e-80
AXZ37001.1|1619114_1619411_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	98.0	2.0e-47
AXZ37002.1|1619675_1619939_-	hypothetical protein	NA	I6R992	Salmonella_phage	67.8	2.5e-25
AXZ40059.1|1619950_1620145_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ37003.1|1620159_1620366_-	hypothetical protein	NA	A0A192Y802	Salmonella_phage	97.1	1.2e-30
AXZ37004.1|1620438_1621815_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	99.8	4.3e-254
AXZ40060.1|1621811_1622699_-	replication protein	NA	G9L680	Escherichia_phage	98.0	9.9e-143
AXZ37005.1|1622761_1623034_-	hypothetical protein	NA	G9L679	Escherichia_phage	96.7	3.9e-42
AXZ37006.1|1623056_1623347_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	97.9	4.5e-44
AXZ37007.1|1623455_1623683_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	80.0	8.7e-27
AXZ37008.1|1623792_1624479_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	76.7	1.9e-93
AXZ37009.1|1624529_1625552_+	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	40.9	6.2e-72
AXZ37010.1|1625695_1625899_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	98.5	2.0e-27
AXZ37011.1|1626479_1626782_+	regulator	NA	B8K1E6	Salmonella_phage	93.0	3.5e-47
AXZ37012.1|1626784_1627381_+	hypothetical protein	NA	V5URU3	Shigella_phage	50.0	6.2e-48
AXZ37013.1|1627457_1628576_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	71.2	9.5e-66
AXZ37014.1|1628726_1628981_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ37015.1|1629066_1629201_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	78.0	2.1e-09
AXZ37016.1|1629185_1629380_+	hypothetical protein	NA	M9NZE2	Enterobacteria_phage	38.3	4.7e-05
AXZ37017.1|1629467_1629656_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	82.3	1.7e-23
AXZ37018.1|1629663_1630371_+	recombinase	NA	E7C9Q0	Salmonella_phage	96.2	7.9e-135
AXZ37019.1|1630371_1630830_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	89.0	2.6e-70
AXZ37020.1|1630838_1631318_+	hypothetical protein	NA	Q716E9	Shigella_phage	91.2	9.3e-87
AXZ37021.1|1631331_1631616_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ37022.1|1631779_1632331_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	59.4	8.8e-57
AXZ37023.1|1632621_1632843_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	54.3	1.6e-14
AXZ37024.1|1632842_1633916_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	67.6	2.0e-142
AXZ37025.1|1633878_1634121_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AXZ37026.1|1634230_1634476_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ40061.1|1634589_1634793_+	hypothetical protein	NA	I6RSG8	Salmonella_phage	56.7	7.3e-17
AXZ37027.1|1635054_1635993_-|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
>prophage 5
CP032194	Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 chromosome, complete genome	4916886	1867003	1960609	4916886	lysis,capsid,tail,plate,tRNA,head,portal,integrase	Salmonella_phage(72.0%)	89	1929312:1929358	1960727:1960773
AXZ37229.1|1867003_1867741_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AXZ37230.1|1867870_1869205_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AXZ40068.1|1869222_1870122_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ37231.1|1870224_1870812_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AXZ37232.1|1870873_1871257_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AXZ37233.1|1871575_1872265_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AXZ37234.1|1872380_1873418_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AXZ37235.1|1873621_1874041_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AXZ37236.1|1874113_1874794_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AXZ37237.1|1874847_1877508_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AXZ37238.1|1877622_1878978_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXZ37239.1|1879020_1879344_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
AXZ37240.1|1879340_1880642_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
AXZ37241.1|1880745_1881201_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
AXZ37242.1|1881217_1881448_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ37243.1|1887154_1889728_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
AXZ37244.1|1889857_1890589_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AXZ37245.1|1890585_1891566_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AXZ37246.1|1891697_1892435_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AXZ37247.1|1892706_1893045_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AXZ40069.1|1893148_1893196_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ37248.1|1893295_1894456_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AXZ37249.1|1894416_1895325_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AXZ37250.1|1895382_1896504_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AXZ37251.1|1896513_1897584_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AXZ37252.1|1898023_1898542_+	YfiR family protein	NA	NA	NA	NA	NA
AXZ37253.1|1898534_1899755_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
AXZ37254.1|1899911_1900259_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AXZ37255.1|1900299_1901067_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AXZ37256.1|1901111_1901660_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXZ40070.1|1901678_1901927_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXZ37257.1|1902240_1903602_-	signal recognition particle protein	NA	NA	NA	NA	NA
AXZ37258.1|1903767_1904559_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AXZ37259.1|1904623_1905865_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AXZ37260.1|1905985_1906591_+	cytoplasmic protein	NA	NA	NA	NA	NA
AXZ40071.1|1906625_1907216_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXZ37261.1|1907339_1908218_+	NAD(+) kinase	NA	NA	NA	NA	NA
AXZ37262.1|1908303_1909965_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AXZ37263.1|1910113_1910452_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXZ37264.1|1910617_1910908_-	RnfH family protein	NA	NA	NA	NA	NA
AXZ37265.1|1910897_1911374_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AXZ40072.1|1911523_1912006_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AXZ37266.1|1924164_1925574_+	type I secretion protein TolC	NA	NA	NA	NA	NA
AXZ37267.1|1925570_1927751_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
AXZ40073.1|1927758_1928922_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1929312:1929358	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
AXZ37268.1|1929452_1929836_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ40074.1|1929875_1930094_-	levansucrase regulator	NA	E5G6Q4	Salmonella_phage	75.0	9.8e-28
AXZ37269.1|1930161_1931262_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.6	3.7e-187
AXZ37270.1|1931258_1931744_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.8	2.9e-72
AXZ37271.1|1931740_1934518_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.3	5.9e-117
AXZ37272.1|1934510_1934630_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AXZ37273.1|1934644_1934947_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AXZ37274.1|1935001_1935517_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.8	2.3e-91
AXZ37275.1|1935526_1936699_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	5.0e-211
AXZ37276.1|1936833_1937430_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	49.5	3.3e-49
AXZ37277.1|1937429_1938689_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	50.5	2.7e-125
AXZ37278.1|1938685_1939291_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	95.0	1.6e-112
AXZ37279.1|1939283_1940192_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	93.7	2.1e-148
AXZ37280.1|1940178_1940538_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	92.4	2.4e-55
AXZ37281.1|1940534_1941113_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.4	2.8e-106
AXZ37282.1|1941181_1941628_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.0	3.2e-65
AXZ37283.1|1941620_1942052_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	96.5	3.1e-73
AXZ37284.1|1942147_1942573_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.2	5.5e-67
AXZ37285.1|1942572_1942950_-	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	96.0	9.9e-60
AXZ37286.1|1942954_1943464_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	1.9e-93
AXZ37287.1|1943444_1943660_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AXZ37288.1|1943663_1943867_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	97.0	4.2e-33
AXZ37289.1|1943866_1944331_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	97.4	5.4e-84
AXZ37290.1|1944424_1945075_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	99.5	1.4e-114
AXZ37291.1|1945078_1946140_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	98.9	2.3e-194
AXZ37292.1|1946156_1946990_-|capsid	capsid protein	capsid	E5G6M5	Salmonella_phage	97.5	3.8e-128
AXZ37293.1|1947132_1948899_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	94.9	0.0e+00
AXZ37294.1|1948898_1949942_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.9	1.6e-176
AXZ37295.1|1949989_1950685_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ37296.1|1950704_1951769_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ37297.1|1951765_1952830_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ37298.1|1952839_1953058_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ37299.1|1953153_1953387_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
AXZ37300.1|1953398_1953587_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
AXZ37301.1|1953748_1956157_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	97.0	0.0e+00
AXZ37302.1|1956147_1957008_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	82.8	6.2e-134
AXZ37303.1|1957004_1957232_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	1.1e-34
AXZ37304.1|1957231_1957465_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	79.2	9.2e-24
AXZ37305.1|1957532_1957874_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.8	7.6e-51
AXZ37306.1|1957837_1958038_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.4	6.7e-31
AXZ37307.1|1958045_1958555_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.2e-84
AXZ37308.1|1958587_1958830_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	96.2	5.2e-38
AXZ37309.1|1958949_1959582_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	91.9	8.1e-107
AXZ37310.1|1959583_1960609_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.3	2.2e-194
1960727:1960773	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 6
CP032194	Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 chromosome, complete genome	4916886	2431990	2481299	4916886	lysis,terminase,capsid,holin,transposase,tail,plate,tRNA,protease,head,portal,integrase	Salmonella_phage(46.3%)	65	2441802:2441850	2472494:2472542
AXZ37754.1|2431990_2433232_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
AXZ37755.1|2433335_2434157_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AXZ37756.1|2434254_2434614_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AXZ37757.1|2434720_2435332_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AXZ37758.1|2435339_2435678_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ37759.1|2435581_2436595_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
AXZ37760.1|2436822_2437038_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXZ37761.1|2437273_2439019_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AXZ37762.1|2439033_2441016_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AXZ37763.1|2441139_2441646_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
2441802:2441850	attL	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAAT	NA	NA	NA	NA
AXZ37764.1|2442004_2442223_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
AXZ37765.1|2442289_2443459_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.7	1.1e-210
AXZ37766.1|2443455_2443941_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	99.4	2.3e-85
AXZ37767.1|2443955_2446397_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	94.1	0.0e+00
AXZ37768.1|2446389_2446545_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
AXZ37769.1|2446541_2446877_-|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	100.0	1.4e-52
AXZ37770.1|2446939_2447458_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
AXZ37771.1|2447473_2448661_-|tail	phage tail protein	tail	Q6K1H0	Salmonella_virus	99.2	6.4e-222
AXZ37772.1|2448829_2449450_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	87.7	2.1e-99
AXZ37773.1|2449419_2451513_-|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	97.5	5.3e-227
AXZ37774.1|2451523_2452054_-|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	100.0	4.1e-104
AXZ37775.1|2452046_2452955_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	99.3	1.6e-159
AXZ37776.1|2452961_2453309_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	7.2e-57
AXZ37777.1|2453305_2453947_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	97.7	1.7e-112
AXZ37778.1|2454015_2454465_-	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	99.3	4.2e-73
AXZ37779.1|2454457_2454925_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
AXZ37780.1|2454887_2455061_-|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	96.5	1.1e-24
AXZ37781.1|2455032_2455446_-|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	98.5	6.4e-44
AXZ37782.1|2455442_2455940_-	lysozyme	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
AXZ37783.1|2455926_2456223_-|holin	holin	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
AXZ37784.1|2456226_2456430_-|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	97.0	8.8e-31
AXZ37785.1|2456429_2456936_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
AXZ37786.1|2457029_2457779_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	96.4	3.2e-126
AXZ37787.1|2457782_2458850_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	99.4	2.0e-198
AXZ37788.1|2458926_2459781_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	95.1	1.1e-151
AXZ37789.1|2459946_2461716_+	oxidoreductase	NA	A0A0M4RE51	Salmonella_phage	100.0	0.0e+00
AXZ37790.1|2461715_2462762_+|portal	phage portal protein	portal	A0A0M4S6E8	Salmonella_phage	100.0	4.0e-191
AXZ37791.1|2462782_2462983_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ37792.1|2462896_2463079_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ37793.1|2463364_2463574_-	hypothetical protein	NA	Q6K1F0	Salmonella_virus	92.8	1.4e-31
AXZ37794.1|2463781_2464513_-	hypothetical protein	NA	Q37850	Escherichia_phage	93.0	1.1e-126
AXZ37795.1|2464595_2465036_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	93.4	4.4e-67
AXZ37796.1|2465153_2467376_-	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	97.3	0.0e+00
AXZ40094.1|2467372_2467654_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AXZ37797.1|2467678_2467948_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	79.3	1.1e-33
AXZ37798.1|2467944_2468349_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ37799.1|2468345_2468930_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	97.4	7.5e-107
AXZ37800.1|2468926_2469154_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	81.9	1.6e-25
AXZ37801.1|2469153_2469381_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
AXZ37802.1|2469450_2469651_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	98.5	2.3e-31
AXZ37803.1|2469637_2469865_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	2.1e-36
AXZ37804.1|2469872_2470382_-	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	6.2e-89
AXZ37805.1|2470412_2470676_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.7	3.3e-38
AXZ37806.1|2470806_2471385_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	63.0	3.5e-64
AXZ37807.1|2471384_2472422_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	97.1	1.1e-198
AXZ37808.1|2473290_2474402_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	4.9e-06
2472494:2472542	attR	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAAT	NA	NA	NA	NA
AXZ37809.1|2474444_2475017_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ37810.1|2475104_2476766_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	94.2	1.5e-311
AXZ37811.1|2476749_2477106_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	93.2	3.3e-57
AXZ37812.1|2477246_2477690_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.9	1.2e-51
AXZ37813.1|2477690_2477981_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	57.7	1.8e-29
AXZ37814.1|2477973_2478312_-|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	46.8	6.6e-23
AXZ37815.1|2478308_2479538_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	86.2	2.8e-212
AXZ37816.1|2479539_2480100_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.7	2.2e-87
AXZ37817.1|2480144_2481299_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	67.5	7.8e-148
>prophage 7
CP032194	Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 chromosome, complete genome	4916886	3553806	3574035	4916886	plate,tail	Burkholderia_phage(38.1%)	25	NA	NA
AXZ38767.1|3553806_3554535_-	hypothetical protein	NA	A0A292GAQ8	Xanthomonas_phage	28.2	3.5e-13
AXZ38768.1|3555272_3555728_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ38769.1|3555724_3556426_-	DUF4376 domain-containing protein	NA	K7PMH7	Enterobacteria_phage	45.9	7.6e-29
AXZ38770.1|3556428_3557874_-	short-chain fatty acid transporter	NA	A0A0M3ULH6	Salmonella_phage	38.1	5.0e-75
AXZ38771.1|3557876_3558509_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
AXZ38772.1|3558501_3559617_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.7	1.5e-100
AXZ38773.1|3559607_3559967_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	3.1e-34
AXZ38774.1|3560130_3561678_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
AXZ38775.1|3561677_3562607_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
AXZ38776.1|3562603_3562966_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
AXZ38777.1|3563293_3564016_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AXZ38778.1|3564025_3565069_-	phage protein D	NA	A4JWL3	Burkholderia_virus	45.9	2.9e-77
AXZ38779.1|3565056_3565266_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AXZ38780.1|3565265_3566219_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
AXZ38781.1|3566218_3568585_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.9	2.7e-70
AXZ38782.1|3568681_3568810_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXZ38783.1|3568769_3569087_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXZ38784.1|3569138_3569663_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AXZ38785.1|3569662_3571090_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.4e-194
AXZ38786.1|3571079_3571277_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AXZ38787.1|3571273_3571729_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ38788.1|3571888_3572203_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AXZ38789.1|3572215_3572821_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	61.0	1.0e-61
AXZ38790.1|3572823_3573111_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
AXZ38791.1|3573687_3574035_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 8
CP032194	Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 chromosome, complete genome	4916886	3856182	3867960	4916886	tail	Salmonella_phage(33.33%)	14	NA	NA
AXZ39042.1|3856182_3857445_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	35.6	2.8e-66
AXZ39043.1|3857475_3858114_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ39044.1|3858484_3858715_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXZ40151.1|3858776_3859361_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AXZ39045.1|3859353_3859713_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ39046.1|3859744_3860029_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ39047.1|3860025_3860409_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ39048.1|3860405_3863078_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	2.1e-58
AXZ39049.1|3863478_3864240_+	septation initiation protein	NA	NA	NA	NA	NA
AXZ39050.1|3864239_3864512_+	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	46.9	6.3e-08
AXZ39051.1|3864689_3864869_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ39052.1|3864888_3865200_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	66.0	2.4e-27
AXZ40152.1|3865214_3865334_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AXZ39053.1|3865326_3867960_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	31.3	5.8e-106
>prophage 1
CP032192	Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed1, complete sequence	159356	40424	53469	159356	integrase,transposase	Salmonella_phage(33.33%)	15	35588:35602	52567:52581
35588:35602	attL	GATGTTTGAGCAGTA	NA	NA	NA	NA
AXZ35169.1|40424_41429_-|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AXZ35170.1|41507_44480_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AXZ35171.1|44482_45040_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AXZ35172.1|45077_45401_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ35173.1|45345_46359_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AXZ35309.1|46565_47144_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
AXZ35174.1|47312_47660_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXZ35175.1|47653_48493_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXZ35176.1|48422_48602_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ35177.1|48620_49121_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXZ35178.1|49426_49540_-	NTP-binding protein	NA	NA	NA	NA	NA
AXZ35179.1|49627_50392_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXZ35180.1|50593_51430_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXZ35310.1|51429_52233_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AXZ35181.1|52339_53469_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
52567:52581	attR	GATGTTTGAGCAGTA	NA	NA	NA	NA
>prophage 1
CP032193	Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence	87450	3878	39532	87450	protease,transposase	Escherichia_phage(28.57%)	37	NA	NA
AXZ35319.1|3878_5420_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXZ35407.1|6818_7592_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
AXZ35320.1|7572_7854_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ35321.1|8073_8259_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ35322.1|8307_9492_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
AXZ35323.1|9890_11366_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AXZ35324.1|11421_12306_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXZ35325.1|12664_13207_-	DNA-binding protein	NA	NA	NA	NA	NA
AXZ35326.1|14091_14796_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXZ35327.1|17461_17971_-	ROS/MUCR transcriptional regulator domain protein	NA	NA	NA	NA	NA
AXZ35328.1|18018_20106_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AXZ35329.1|20118_21069_-	DsbC family protein	NA	NA	NA	NA	NA
AXZ35408.1|21079_22342_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
AXZ35409.1|22386_22662_-	lytic transglycosylase	NA	NA	NA	NA	NA
AXZ35410.1|22886_23270_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
AXZ35330.1|23349_24003_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXZ35331.1|24095_24353_+	antitoxin	NA	NA	NA	NA	NA
AXZ35332.1|24354_24687_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AXZ35333.1|25031_25466_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	55.4	4.7e-29
AXZ35334.1|25453_26719_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	51.1	4.0e-113
AXZ35335.1|26741_27590_-	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	38.9	5.0e-27
AXZ35336.1|27592_27913_-	chromosome segregation protein ParM	NA	NA	NA	NA	NA
AXZ35411.1|28057_28309_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ35337.1|28764_28974_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ35338.1|28976_29195_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ35339.1|29239_29923_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ35340.1|29919_30192_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXZ35341.1|30209_31484_-	RelB antitoxin	NA	NA	NA	NA	NA
AXZ35342.1|32010_32355_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ35343.1|32537_33122_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ35344.1|33583_34288_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ35345.1|34520_35381_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AXZ35346.1|35393_35936_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AXZ35347.1|36417_36609_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ35348.1|36614_36860_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ35349.1|36910_38047_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AXZ35350.1|38161_39532_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
