The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032185	Klebsiella pneumoniae strain AR_0075 chromosome, complete genome	5312321	752457	807228	5312321	integrase,head,terminase,lysis,tail,tRNA,protease,coat	Cronobacter_phage(25.0%)	74	765167:765213	807700:807746
AXZ06121.1|752457_753084_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
AXZ06122.1|753051_753738_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
AXZ06123.1|753734_756149_+	ABC transporter permease	NA	NA	NA	NA	NA
AXZ06124.1|756330_757476_+	porin	NA	NA	NA	NA	NA
AXZ06125.1|757583_758660_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AXZ06126.1|758771_759839_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AXZ06127.1|759835_760345_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AXZ06128.1|760277_760445_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ06129.1|760441_760780_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ06130.1|760887_761610_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AXZ06131.1|761613_762108_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
AXZ06132.1|762283_763669_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AXZ06133.1|763714_763927_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AXZ06134.1|763928_764795_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AXZ06135.1|764833_765157_+	hypothetical protein	NA	NA	NA	NA	NA
765167:765213	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
AXZ10359.1|765226_766270_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	85.9	2.2e-178
AXZ06136.1|766266_766602_-	DNA-binding protein	NA	NA	NA	NA	NA
AXZ06137.1|766603_766822_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
AXZ06138.1|766818_767346_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.1e-56
AXZ06139.1|767374_767998_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.2	5.8e-57
AXZ06140.1|767994_768741_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
AXZ06141.1|768757_769042_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	1.7e-40
AXZ06142.1|769131_769326_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ06143.1|769827_770760_-	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	55.5	1.9e-91
AXZ06144.1|770756_771230_-	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	58.5	1.1e-52
AXZ06145.1|771337_771457_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ06146.1|771479_772202_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	9.4e-75
AXZ06147.1|772270_772498_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
AXZ06148.1|772537_772759_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AXZ06149.1|773681_774554_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.4	3.8e-94
AXZ06150.1|774550_774844_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
AXZ06151.1|774840_775296_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.5	2.6e-06
AXZ06152.1|775292_775529_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	1.5e-13
AXZ06153.1|775521_776061_+	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	37.6	9.3e-19
AXZ10360.1|776737_777214_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	35.4	3.0e-13
AXZ06154.1|777213_777462_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06155.1|777620_778217_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
AXZ10361.1|778222_778390_+	NinE family protein	NA	NA	NA	NA	NA
AXZ06156.1|778386_779055_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	76.0	4.1e-101
AXZ06157.1|779047_779656_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	65.7	2.3e-50
AXZ06158.1|779652_779883_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06159.1|779879_780020_+	YlcG family protein	NA	NA	NA	NA	NA
AXZ06160.1|780016_780706_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	1.1e-56
AXZ06161.1|781480_781795_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	8.3e-44
AXZ06162.1|781797_782301_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
AXZ06163.1|782297_782765_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	7.5e-57
AXZ06164.1|782973_783624_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	89.4	6.2e-102
AXZ06165.1|783620_785189_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	91.2	2.4e-301
AXZ06166.1|785200_786649_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	51.0	2.1e-118
AXZ06167.1|786566_787580_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	1.8e-116
AXZ06168.1|787576_787780_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ06169.1|787830_789186_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	53.1	5.1e-130
AXZ06170.1|789185_789647_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
AXZ06171.1|789643_790699_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	2.2e-101
AXZ06172.1|790731_790971_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06173.1|790973_791354_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	4.1e-29
AXZ06174.1|791353_791527_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
AXZ06175.1|791526_791889_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	50.8	1.6e-27
AXZ06176.1|791891_792260_+	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	82.0	1.9e-47
AXZ06177.1|792256_792640_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06178.1|793531_794245_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	2.1e-63
AXZ06179.1|794462_795020_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	88.2	6.7e-89
AXZ06180.1|795332_795806_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
AXZ10362.1|795988_796240_+	hypothetical protein	NA	H6WRV3	Salmonella_phage	62.7	2.8e-26
AXZ06181.1|796295_796766_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06182.1|796857_799428_+|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	40.3	8.5e-94
AXZ06183.1|799468_799648_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AXZ06184.1|799667_800081_-	hypothetical protein	NA	G0ZNE8	Cronobacter_phage	89.8	5.0e-65
AXZ10363.1|800251_800671_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	1.8e-30
AXZ06185.1|800670_801141_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.2e-27
AXZ06186.1|801137_801533_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	4.7e-36
AXZ06187.1|801519_803997_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	1.4e-197
AXZ06188.1|806082_806883_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06189.1|806988_807228_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
807700:807746	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 2
CP032185	Klebsiella pneumoniae strain AR_0075 chromosome, complete genome	5312321	1288821	1298295	5312321	protease,tRNA	Dickeya_phage(16.67%)	9	NA	NA
AXZ06608.1|1288821_1289937_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AXZ06609.1|1289933_1291874_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AXZ06610.1|1291813_1292017_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06611.1|1291950_1292172_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXZ06612.1|1292497_1292815_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXZ06613.1|1292845_1295125_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXZ06614.1|1295255_1295474_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXZ06615.1|1295827_1296529_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXZ06616.1|1296573_1298295_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 3
CP032185	Klebsiella pneumoniae strain AR_0075 chromosome, complete genome	5312321	1537307	1606923	5312321	integrase,plate,terminase,tail,tRNA,capsid,portal	Enterobacteria_phage(51.43%)	82	1564503:1564520	1601679:1601696
AXZ10404.1|1537307_1538414_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AXZ06819.1|1538470_1538929_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AXZ06820.1|1538945_1539596_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AXZ06821.1|1539836_1541087_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AXZ06822.1|1541359_1542073_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ06823.1|1542069_1542462_-	amino acid-binding protein	NA	NA	NA	NA	NA
AXZ06824.1|1542454_1542778_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AXZ06825.1|1542866_1543073_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ06826.1|1543020_1543206_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06827.1|1543226_1543454_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AXZ06828.1|1543566_1544760_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AXZ06829.1|1545383_1545569_+	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AXZ06830.1|1545659_1546154_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXZ06831.1|1546180_1546687_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXZ06832.1|1546703_1547591_+	manganese catalase family protein	NA	NA	NA	NA	NA
AXZ06833.1|1547646_1549053_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXZ06834.1|1549049_1550060_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AXZ06835.1|1550175_1550373_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ06836.1|1550939_1551572_+	DNA-binding protein	NA	NA	NA	NA	NA
AXZ06837.1|1551611_1551791_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06838.1|1552188_1552875_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXZ06839.1|1553185_1554694_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
AXZ06840.1|1554814_1555705_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ06841.1|1555711_1557496_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AXZ06842.1|1557569_1558778_-	HD domain-containing protein	NA	NA	NA	NA	NA
AXZ06843.1|1559080_1560124_+	type II asparaginase	NA	NA	NA	NA	NA
AXZ06844.1|1560378_1560570_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ06845.1|1560785_1561700_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AXZ06846.1|1561789_1562428_+	leucine efflux protein	NA	NA	NA	NA	NA
AXZ06847.1|1562558_1562822_+	DUF2534 family protein	NA	NA	NA	NA	NA
AXZ06848.1|1562881_1563007_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10405.1|1563124_1563241_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ06849.1|1563198_1563300_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ06850.1|1563357_1564371_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
1564503:1564520	attL	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
AXZ06851.1|1564635_1565619_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	79.8	1.4e-150
AXZ06852.1|1565734_1566034_-	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
AXZ06853.1|1566154_1566433_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AXZ06854.1|1566453_1566672_+	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AXZ06855.1|1566687_1567065_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06856.1|1567080_1567353_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06857.1|1567421_1567646_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06858.1|1567642_1568209_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.8e-13
AXZ06859.1|1568217_1568445_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	2.5e-05
AXZ06860.1|1568441_1569398_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.4	1.5e-83
AXZ06861.1|1572287_1574558_-	DNA helicase UvrD	NA	NA	NA	NA	NA
AXZ06862.1|1574557_1575349_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ06863.1|1576193_1577255_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	9.1e-143
AXZ06864.1|1577248_1578976_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	67.1	1.0e-228
AXZ06865.1|1579132_1579972_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
AXZ06866.1|1579981_1581016_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
AXZ06867.1|1581065_1581923_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	9.8e-71
AXZ06868.1|1582035_1582551_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	48.8	2.7e-39
AXZ06869.1|1582550_1582751_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AXZ06870.1|1582741_1583026_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXZ06871.1|1583022_1583568_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
AXZ10406.1|1583579_1583909_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AXZ06872.1|1584090_1584558_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
AXZ06873.1|1584554_1585190_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
AXZ06874.1|1585186_1585774_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
AXZ06875.1|1585770_1586121_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.2	1.8e-23
AXZ06876.1|1586122_1587046_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
AXZ06877.1|1587035_1590062_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AXZ06878.1|1590058_1590271_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06879.1|1590270_1591368_+|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
AXZ06880.1|1591967_1593191_+	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
AXZ06881.1|1593208_1593871_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06882.1|1594334_1594808_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.9	6.6e-53
AXZ06883.1|1594823_1597799_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.0e-219
AXZ10407.1|1597785_1597944_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AXZ06884.1|1597943_1598261_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AXZ06885.1|1598306_1598822_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AXZ06886.1|1598821_1599994_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	5.0e-158
AXZ06887.1|1600148_1601288_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
AXZ06888.1|1601331_1601583_+	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AXZ06889.1|1601847_1602087_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
1601679:1601696	attR	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
AXZ06890.1|1602076_1602433_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AXZ06891.1|1602419_1602929_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AXZ06892.1|1603074_1603767_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ06893.1|1603798_1604983_-	cyanate MFS transporter	NA	NA	NA	NA	NA
AXZ10408.1|1605084_1605876_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ06894.1|1605859_1606306_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AXZ06895.1|1606422_1606923_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 4
CP032185	Klebsiella pneumoniae strain AR_0075 chromosome, complete genome	5312321	1761472	1850221	5312321	plate,head,terminase,holin,tail,tRNA,capsid,portal,protease	Klebsiella_phage(62.96%)	101	NA	NA
AXZ07040.1|1761472_1762234_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.1e-20
AXZ07041.1|1762450_1763983_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.5e-21
AXZ07042.1|1764181_1764730_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
AXZ07043.1|1764926_1766108_+	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	1.3e-201
AXZ07044.1|1766088_1766331_-	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AXZ07045.1|1766509_1767394_-	hypothetical protein	NA	A0A2H4FNA9	Salmonella_phage	70.6	5.1e-06
AXZ07046.1|1767390_1767615_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	94.6	1.7e-30
AXZ07047.1|1767604_1768330_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	99.6	1.4e-131
AXZ07048.1|1768335_1768854_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	97.7	9.4e-93
AXZ07049.1|1768894_1769335_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	80.8	7.5e-59
AXZ07050.1|1769521_1769776_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	89.3	1.4e-36
AXZ07051.1|1769768_1770134_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
AXZ07052.1|1770134_1770359_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07053.1|1770541_1770955_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07054.1|1771118_1771793_-	helix-turn-helix transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.6	8.7e-99
AXZ07055.1|1771933_1772167_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	4.9e-17
AXZ07056.1|1772291_1772576_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	70.2	1.1e-31
AXZ07057.1|1772837_1773206_+	hypothetical protein	NA	A0A286S263	Klebsiella_phage	82.8	6.7e-53
AXZ07058.1|1773247_1774906_+	ATP-dependent helicase	NA	A0A286N2P9	Klebsiella_phage	97.5	0.0e+00
AXZ07059.1|1774907_1775870_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	98.8	3.1e-182
AXZ07060.1|1775866_1776649_+	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	6.5e-114
AXZ10413.1|1776802_1777060_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
AXZ07061.1|1776965_1777412_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07062.1|1777974_1778370_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AXZ07063.1|1778356_1778638_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AXZ07064.1|1778637_1779267_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
AXZ07065.1|1779274_1779550_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	9.9e-09
AXZ07066.1|1779500_1779695_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.9	1.5e-24
AXZ07067.1|1779785_1780070_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07068.1|1780202_1780475_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ07069.1|1780407_1780668_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07070.1|1780799_1781036_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
AXZ07071.1|1781116_1781323_+	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	1.1e-33
AXZ07072.1|1781393_1781684_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
AXZ07073.1|1781696_1781906_+	serine acetyltransferase	NA	A0A286N2R4	Klebsiella_phage	84.1	2.4e-23
AXZ07074.1|1782027_1782462_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
AXZ07075.1|1782471_1784004_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
AXZ07076.1|1784006_1785284_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
AXZ07077.1|1785289_1785970_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	2.7e-124
AXZ07078.1|1785981_1787145_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.2	3.8e-211
AXZ07079.1|1787371_1787698_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	99.1	9.8e-56
AXZ07080.1|1787758_1787956_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
AXZ07081.1|1787957_1788290_+|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	98.2	1.0e-55
AXZ07082.1|1788282_1788822_+	hypothetical protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
AXZ07083.1|1788818_1789184_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
AXZ07084.1|1789239_1789731_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
AXZ07085.1|1789774_1790128_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
AXZ07086.1|1790160_1790424_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
AXZ07087.1|1790489_1790957_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ07088.1|1791001_1793449_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.3	8.5e-277
AXZ07089.1|1793448_1793928_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
AXZ07090.1|1793914_1794397_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	98.8	6.0e-86
AXZ07091.1|1794406_1794787_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AXZ07092.1|1794783_1797852_+	kinase	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
AXZ07093.1|1799901_1800702_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ07094.1|1800713_1800896_+	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	87.0	2.6e-18
AXZ07095.1|1800973_1801396_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AXZ07096.1|1801803_1802052_-	DinI family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
AXZ07097.1|1802897_1803389_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXZ07098.1|1803431_1804976_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXZ10414.1|1804988_1806329_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXZ07099.1|1806325_1807015_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AXZ07100.1|1807011_1808718_+	OmpA family protein	NA	NA	NA	NA	NA
AXZ07101.1|1808722_1809214_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AXZ07102.1|1809478_1812133_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	7.7e-98
AXZ07103.1|1812125_1814504_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	2.4e-18
AXZ07104.1|1814507_1815284_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXZ07105.1|1815308_1815839_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXZ07106.1|1815826_1818226_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXZ07107.1|1818268_1818526_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXZ07108.1|1818474_1819656_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ07109.1|1819645_1823095_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AXZ07110.1|1823091_1824684_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AXZ07111.1|1824762_1826517_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXZ07112.1|1826480_1827566_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXZ07113.1|1827543_1828086_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXZ07114.1|1828213_1828708_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ07115.1|1828774_1829488_-	oxidoreductase	NA	NA	NA	NA	NA
AXZ07116.1|1829561_1830155_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ07117.1|1830159_1830915_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXZ07118.1|1831073_1831952_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ07119.1|1832002_1832209_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXZ07120.1|1832234_1833164_-	aromatic alcohol reductase	NA	NA	NA	NA	NA
AXZ07121.1|1833308_1834214_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ07122.1|1834233_1835157_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ07123.1|1835247_1836114_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXZ07124.1|1836106_1837018_+	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
AXZ07125.1|1837072_1837621_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ07126.1|1837709_1838744_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AXZ07127.1|1838788_1839964_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AXZ07128.1|1840184_1840991_+	methionine-binding protein	NA	NA	NA	NA	NA
AXZ07129.1|1842004_1842673_+	ABC transporter permease	NA	NA	NA	NA	NA
AXZ07130.1|1842963_1843710_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ07131.1|1843822_1844017_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07132.1|1844253_1845318_-	oxidoreductase	NA	NA	NA	NA	NA
AXZ10415.1|1845334_1846078_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.1	1.0e-15
AXZ07133.1|1846096_1846288_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07134.1|1846357_1847341_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AXZ07135.1|1847657_1847852_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ07136.1|1847866_1849240_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
AXZ07137.1|1849285_1850221_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
>prophage 5
CP032185	Klebsiella pneumoniae strain AR_0075 chromosome, complete genome	5312321	2024870	2035758	5312321		Escherichia_phage(87.5%)	10	NA	NA
AXZ07297.1|2024870_2025491_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AXZ07298.1|2025483_2026749_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
AXZ07299.1|2026760_2027663_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AXZ07300.1|2027700_2027934_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07301.1|2027924_2028686_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXZ07302.1|2028706_2029567_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AXZ07303.1|2029864_2030125_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AXZ07304.1|2030211_2031300_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
AXZ07305.1|2031330_2032596_-	MFS transporter	NA	NA	NA	NA	NA
AXZ07306.1|2032650_2035758_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 6
CP032185	Klebsiella pneumoniae strain AR_0075 chromosome, complete genome	5312321	2701322	2786300	5312321	integrase,plate,head,terminase,lysis,holin,tail,tRNA	Salmonella_phage(30.16%)	104	NA	NA
AXZ07932.1|2701322_2701907_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AXZ07933.1|2702024_2703116_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AXZ07934.1|2703196_2703526_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
AXZ07935.1|2703609_2704524_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ07936.1|2704655_2706071_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07937.1|2706090_2706534_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXZ07938.1|2706536_2707079_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXZ07939.1|2707053_2708100_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXZ07940.1|2708099_2709863_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXZ07941.1|2709996_2712963_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AXZ07942.1|2713427_2714639_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07943.1|2714643_2714901_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXZ07944.1|2714926_2715334_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07945.1|2716737_2718765_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	31.6	2.6e-74
AXZ07946.1|2718767_2721395_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.5	2.3e-17
AXZ07947.1|2721853_2723551_-	OmpA family protein	NA	NA	NA	NA	NA
AXZ07948.1|2723554_2724208_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AXZ07949.1|2724204_2725545_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXZ07950.1|2725592_2725772_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ07951.1|2726110_2726440_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AXZ10452.1|2726554_2727094_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
AXZ07952.1|2727119_2727818_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
AXZ07953.1|2728009_2728492_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
AXZ07954.1|2729466_2729784_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.8e-22
AXZ07955.1|2729783_2730023_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	1.4e-14
AXZ07956.1|2730127_2730928_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07957.1|2730937_2732920_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	27.6	1.2e-26
AXZ07958.1|2732938_2733712_-	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	49.2	8.6e-26
AXZ07959.1|2733711_2734485_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	51.0	1.8e-68
AXZ07960.1|2734481_2735681_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	75.3	5.8e-162
AXZ07961.1|2735680_2736034_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	78.6	3.0e-50
AXZ07962.1|2736030_2736687_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	64.8	1.7e-83
AXZ10453.1|2737277_2737586_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	90.9	2.4e-35
AXZ07963.1|2737621_2738683_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	69.9	2.1e-139
AXZ07964.1|2738685_2738988_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.1	2.8e-25
AXZ07965.1|2738988_2739564_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	71.2	1.7e-66
AXZ07966.1|2739563_2741561_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	61.7	7.5e-231
AXZ07967.1|2741550_2741703_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	76.0	1.0e-15
AXZ07968.1|2741744_2742164_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	66.7	3.0e-41
AXZ07969.1|2742167_2742611_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	2.1e-61
AXZ07970.1|2742620_2743766_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.7	1.3e-166
AXZ07971.1|2743769_2744210_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AXZ07972.1|2744304_2744691_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	75.8	5.8e-47
AXZ07973.1|2744690_2745305_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07974.1|2745301_2745721_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	4.4e-40
AXZ07975.1|2745689_2745971_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07976.1|2746805_2747324_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ07977.1|2747342_2747531_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07978.1|2747879_2748395_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07979.1|2748895_2749432_-	peptidase M41 family protein	NA	NA	NA	NA	NA
AXZ07980.1|2750568_2752914_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	39.9	1.3e-146
AXZ07981.1|2752910_2753129_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AXZ07982.1|2753134_2753353_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07983.1|2753349_2753613_-|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
AXZ07984.1|2753609_2753789_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07985.1|2753781_2754660_-|integrase	integrase	integrase	NA	NA	NA	NA
AXZ07986.1|2754652_2754835_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10454.1|2754827_2755352_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	43.7	1.4e-14
AXZ07987.1|2756137_2756350_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXZ07988.1|2756473_2757703_-	DUF4102 domain-containing protein	NA	A0A1V0E8G8	Vibrio_phage	40.5	3.6e-74
AXZ07989.1|2758292_2758787_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	61.5	2.1e-49
AXZ07990.1|2758790_2759993_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	52.8	5.3e-107
AXZ07991.1|2760002_2760197_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ07992.1|2760242_2760791_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
AXZ07993.1|2760846_2762298_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	7.2e-191
AXZ07994.1|2762535_2763936_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	7.2e-188
AXZ07995.1|2763886_2764663_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	2.4e-12
AXZ07996.1|2764871_2765339_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	7.5e-57
AXZ07997.1|2765335_2765839_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
AXZ07998.1|2765841_2766156_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	8.3e-44
AXZ07999.1|2766930_2767620_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	1.1e-56
AXZ08000.1|2767616_2767757_-	YlcG family protein	NA	NA	NA	NA	NA
AXZ08001.1|2767753_2767984_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ08002.1|2767980_2768589_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	65.7	2.3e-50
AXZ08003.1|2768581_2769250_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	76.0	4.1e-101
AXZ10455.1|2769246_2769414_-	NinE family protein	NA	NA	NA	NA	NA
AXZ08004.1|2769419_2770016_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
AXZ08005.1|2770174_2770423_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10456.1|2770422_2770899_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	35.4	3.0e-13
AXZ08006.1|2771575_2772115_-	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	37.6	9.3e-19
AXZ08007.1|2772107_2772344_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	1.5e-13
AXZ08008.1|2772340_2772796_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.5	2.6e-06
AXZ08009.1|2772792_2773086_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
AXZ08010.1|2773082_2773955_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.4	3.8e-94
AXZ08011.1|2773939_2774794_-	replication protein	NA	K7PGT1	Enterobacteria_phage	54.8	2.8e-62
AXZ08012.1|2774879_2775101_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AXZ08013.1|2775141_2775360_-	XRE family transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
AXZ08014.1|2775468_2776128_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	61.5	1.9e-69
AXZ08015.1|2776624_2776831_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
AXZ08016.1|2776911_2777196_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	4.3e-39
AXZ08017.1|2777211_2778057_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
AXZ08018.1|2778287_2778674_+	hypothetical protein	NA	A0A221SAP1	Ralstonia_phage	52.8	1.4e-16
AXZ08019.1|2778666_2779353_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	90.6	4.8e-113
AXZ08020.1|2779349_2779508_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
AXZ08021.1|2779504_2780032_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	62.2	1.3e-57
AXZ08022.1|2780028_2780799_+	dcm methylase	NA	D5LH17	Escherichia_phage	51.0	3.2e-65
AXZ08023.1|2781015_2781780_+	hypothetical protein	NA	Q71T76	Escherichia_phage	58.3	3.0e-71
AXZ08024.1|2781776_2781968_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	64.4	1.3e-12
AXZ08025.1|2781964_2782174_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ08026.1|2782170_2782389_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
AXZ08027.1|2782392_2782638_+	excisionase	NA	A0A286S2A4	Klebsiella_phage	92.1	1.9e-35
AXZ08028.1|2782680_2783943_+	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	95.0	1.7e-233
AXZ08029.1|2784183_2784990_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ08030.1|2785004_2786300_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
>prophage 7
CP032185	Klebsiella pneumoniae strain AR_0075 chromosome, complete genome	5312321	3120334	3127239	5312321		Bacillus_phage(33.33%)	6	NA	NA
AXZ08314.1|3120334_3121813_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
AXZ08315.1|3121809_3122532_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AXZ08316.1|3122850_3124212_+	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AXZ10475.1|3124457_3125351_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AXZ08317.1|3125591_3126365_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AXZ10476.1|3126375_3127239_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 8
CP032185	Klebsiella pneumoniae strain AR_0075 chromosome, complete genome	5312321	3326137	3389848	5312321	head,terminase,holin,tail,tRNA,capsid,portal,protease	Klebsiella_phage(18.87%)	77	NA	NA
AXZ08485.1|3326137_3326950_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AXZ08486.1|3326949_3327963_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXZ10486.1|3328026_3329139_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.9	2.1e-20
AXZ08487.1|3329273_3330251_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AXZ08488.1|3330337_3331513_-	arabinose transporter	NA	NA	NA	NA	NA
AXZ08489.1|3331722_3332943_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AXZ10487.1|3333101_3335090_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AXZ10488.1|3335151_3335433_-	YfcL family protein	NA	NA	NA	NA	NA
AXZ08490.1|3335464_3336013_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AXZ08491.1|3336012_3336822_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ08492.1|3336821_3337646_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AXZ08493.1|3337648_3338734_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	7.7e-89
AXZ08494.1|3338775_3339708_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXZ08495.1|3339875_3340427_+	endonuclease SmrB	NA	NA	NA	NA	NA
AXZ08496.1|3340447_3340933_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AXZ08497.1|3341142_3343287_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AXZ08498.1|3343286_3344597_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AXZ08499.1|3344756_3345041_-	DUF406 family protein	NA	NA	NA	NA	NA
AXZ08500.1|3345408_3346737_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AXZ08501.1|3346798_3347560_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AXZ08502.1|3347849_3348779_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
AXZ08503.1|3348985_3349357_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	9.2e-26
AXZ08504.1|3349313_3349553_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	54.4	1.5e-21
AXZ08505.1|3349660_3349843_-	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	92.7	4.8e-20
AXZ08506.1|3349854_3350655_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ08507.1|3352700_3355778_-	kinase	NA	A0A286S259	Klebsiella_phage	62.2	0.0e+00
AXZ08508.1|3355774_3356155_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	81.0	2.5e-58
AXZ08509.1|3356167_3356644_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	63.9	3.4e-49
AXZ08510.1|3356630_3357104_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
AXZ08511.1|3357125_3360512_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.7	2.8e-302
AXZ08512.1|3360572_3360806_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
AXZ08513.1|3360879_3361185_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
AXZ08514.1|3361187_3361592_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
AXZ08515.1|3361622_3362327_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.5	1.6e-79
AXZ08516.1|3362383_3362731_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
AXZ08517.1|3362727_3363177_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
AXZ08518.1|3363173_3363512_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	6.6e-39
AXZ08519.1|3363520_3363838_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	7.4e-24
AXZ08520.1|3363915_3365154_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	67.0	3.9e-153
AXZ08521.1|3365163_3365763_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
AXZ08522.1|3365755_3366982_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	2.5e-208
AXZ08523.1|3367129_3368881_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.0	3.3e-251
AXZ08524.1|3368884_3369382_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	71.3	7.4e-63
AXZ08525.1|3369539_3370076_-	HNH endonuclease	NA	NA	NA	NA	NA
AXZ08526.1|3370204_3370561_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.0	3.9e-50
AXZ08527.1|3371164_3371362_-	hypothetical protein	NA	H9C188	Pectobacterium_phage	48.5	7.3e-06
AXZ08528.1|3371475_3371718_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ08529.1|3371704_3371899_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	96.4	2.9e-23
AXZ08530.1|3371849_3372125_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	97.8	5.8e-09
AXZ08531.1|3372121_3372469_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.9	4.7e-40
AXZ08532.1|3372465_3373005_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
AXZ08533.1|3373001_3373313_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.5	1.1e-40
AXZ10489.1|3373851_3374565_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	90.7	7.7e-122
AXZ08534.1|3374568_3375012_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	69.4	1.0e-47
AXZ08535.1|3375034_3375397_-	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	95.0	9.5e-60
AXZ08536.1|3375411_3376392_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	3.8e-135
AXZ08537.1|3376404_3376782_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	72.8	8.7e-48
AXZ08538.1|3376791_3377601_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	1.6e-110
AXZ08539.1|3377597_3378566_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	68.5	9.6e-91
AXZ08540.1|3378555_3378735_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
AXZ08541.1|3378972_3379434_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	3.8e-69
AXZ08542.1|3379468_3379711_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
AXZ08543.1|3379808_3380504_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
AXZ08544.1|3381136_3381436_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.9	2.7e-12
AXZ08545.1|3381435_3382221_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	3.8e-61
AXZ10490.1|3382223_3382670_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	55.8	5.0e-18
AXZ08546.1|3382666_3382927_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.0	7.4e-30
AXZ08547.1|3382923_3383130_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	98.5	6.2e-32
AXZ08548.1|3383126_3383480_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ08549.1|3383479_3383692_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	1.1e-10
AXZ08550.1|3383688_3384330_+	DUF550 domain-containing protein	NA	A0A193GZ33	Enterobacter_phage	71.0	5.1e-40
AXZ08551.1|3384337_3384523_+	DNA-binding protein	NA	G3CFG7	Escherichia_phage	63.0	1.2e-13
AXZ08552.1|3384620_3385481_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ08553.1|3385511_3386681_-	DUF4102 domain-containing protein	NA	A0A2R2Z2Y0	Escherichia_phage	85.3	1.4e-200
AXZ08554.1|3387199_3387682_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AXZ08555.1|3388048_3388930_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
AXZ08556.1|3388939_3389848_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
>prophage 1
CP032186	Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence	202373	59177	143354	202373	transposase,protease,holin,integrase	Escherichia_phage(19.23%)	78	63756:63815	72079:72901
AXZ10612.1|59177_59831_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXZ10613.1|60050_60515_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AXZ10614.1|60511_60616_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10615.1|60651_63549_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
63756:63815	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AXZ10616.1|63818_64523_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ10617.1|64468_64660_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10618.1|66679_67240_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AXZ10619.1|67365_67980_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AXZ10620.1|67918_68932_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ10748.1|69223_69778_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AXZ10749.1|69908_70739_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AXZ10621.1|71370_72075_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ10750.1|73696_73939_+	relaxase	NA	NA	NA	NA	NA
72079:72901	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCACTTCGACGACTACCTGCTGCCGGCCGAGAAGTTCGCCGCACTCAAGCGCGAGCAGGCCCTGCCCCTGGCGATCAACCCGAACAGCGACCAGTACCTGGAAGAGCGTTTGCAGCTGCTGGACGAGCAGTTGGCCACCGTCACCCGCCTGGCCAAGGACAACGAGCTGCCCGATGCCATCCTCACCGAGTCAGGGCTGAAAATCACCCCGCTGGATGCGGCGGTGCCGGATCGGGCGCAGGCGCTGATCGACCAAACCAGCCAGTTACTGCCGCGCATCAAGATCACCGAACTGCTGATGGACGTGGACGACTGGACGGGCTTCAGCCGCCACTTCACCCACTTGAAGGACGGGGCCGAGGCCAAAGACAGGACGTTGCTGCTGTCCGCAATCCTCGGTGATGCGATCAACCTCGGGCTGACCAAGATGGCCGAGTCGAGCCCCGGCCTGACCTACGCCAAGCTGTCCTGGCTGCAAGCCTGGCACATCCGCGACGAAACCTATTCGGCGGCCTTGGCCGAGCTGGTCAACCACCAGTATCGCCACGCCTTTGCCGCCCACTGGGGCGACGGCACGACCTCATCCTCCGATGGCCAGCGCTTCCGCGCGGGTGGCCGGGGCGAGAGCACCGGGCACGTCAACCCGAAGTACGGTAGCGAGCCGGGACGGCTGTTCTATACCCATATCTCCGACCAGTACGCGCCGTTCAGCACCCGCGTGGTGAATGTCGGCGTCCGCGATTCCACCTATGTGCTCGACGGCCT	NA	NA	NA	NA
AXZ10622.1|73970_74648_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ10623.1|74726_75926_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AXZ10624.1|75957_76842_-	EamA family transporter	NA	NA	NA	NA	NA
AXZ10751.1|76979_77372_-	cysteine hydrolase	NA	NA	NA	NA	NA
AXZ10752.1|78148_78673_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	34.4	8.8e-14
AXZ10625.1|78702_79371_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
AXZ10626.1|80674_81379_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXZ10627.1|82234_83062_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	9.0e-21
AXZ10628.1|83058_83922_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ10753.1|83930_84758_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AXZ10629.1|84766_85777_+	phosphonate dehydrogenase	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
AXZ10630.1|85770_86640_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ10755.1|87345_87672_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10754.1|87723_87810_+	ABC transporter	NA	NA	NA	NA	NA
AXZ10631.1|87848_88829_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	2.6e-184
AXZ10756.1|90815_91097_+	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AXZ10632.1|91131_91701_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXZ10633.1|91815_94611_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AXZ10634.1|94610_94808_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10635.1|95045_95795_+	diguanylate cyclase	NA	NA	NA	NA	NA
AXZ10636.1|95781_96744_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AXZ10757.1|98586_99933_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXZ10637.1|100144_100627_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXZ10638.1|100614_100881_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AXZ10639.1|101056_101311_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10640.1|101386_101644_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10641.1|101692_101896_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AXZ10642.1|101929_102298_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10643.1|102341_102836_-	DNA-binding protein	NA	NA	NA	NA	NA
AXZ10644.1|102866_103442_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10645.1|103429_103699_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10646.1|104056_104407_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AXZ10647.1|104456_104819_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AXZ10648.1|104836_106588_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AXZ10649.1|106635_107925_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AXZ10650.1|107937_108363_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AXZ10651.1|108395_108932_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXZ10652.1|110828_111191_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AXZ10653.1|111266_111812_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AXZ10758.1|111820_112531_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AXZ10654.1|112530_112857_-	transcriptional regulator	NA	NA	NA	NA	NA
AXZ10655.1|113188_113686_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXZ10656.1|113735_114245_-	porin	NA	NA	NA	NA	NA
AXZ10759.1|115987_116167_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXZ10657.1|116398_116833_-	copper-binding protein	NA	NA	NA	NA	NA
AXZ10658.1|117049_118450_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AXZ10659.1|118446_119127_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AXZ10660.1|119181_120111_-	copper resistance protein D	NA	NA	NA	NA	NA
AXZ10661.1|120115_120496_-	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AXZ10662.1|120535_121432_-	copper resistance protein B	NA	NA	NA	NA	NA
AXZ10663.1|121431_123249_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AXZ10664.1|123482_123932_+	copper resistance protein	NA	NA	NA	NA	NA
AXZ10665.1|124220_124958_+	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AXZ10666.1|124991_125189_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AXZ10667.1|125229_127677_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AXZ10668.1|127803_128244_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10669.1|128330_131477_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AXZ10670.1|131487_132780_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXZ10671.1|132893_133247_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ10672.1|133275_134661_-	Cu(I)/Ag(I) efflux RND transporter outer membrane protein	NA	NA	NA	NA	NA
AXZ10673.1|134850_135531_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AXZ10674.1|135523_136999_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AXZ10675.1|137249_137681_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AXZ10760.1|139109_140316_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
AXZ10676.1|141350_143354_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
>prophage 1
CP032187	Klebsiella pneumoniae strain AR_0075 plasmid unnamed2, complete sequence	110928	0	9343	110928		Salmonella_phage(100.0%)	10	NA	NA
AXZ10871.1|700_1135_+	hypothetical protein	NA	J9Q719	Salmonella_phage	42.9	3.7e-18
AXZ10765.1|1127_1538_+	hypothetical protein	NA	J9Q6F2	Salmonella_phage	38.6	9.2e-19
AXZ10766.1|1720_2446_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	1.3e-127
AXZ10767.1|2510_3851_+	DNA helicase	NA	J9Q7G4	Salmonella_phage	95.7	7.0e-241
AXZ10768.1|4855_6022_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10769.1|6310_7099_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	6.9e-71
AXZ10770.1|7178_7646_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	7.5e-49
AXZ10771.1|7645_8968_+	putative DNA ligase	NA	J9Q7G5	Salmonella_phage	85.2	4.8e-226
AXZ10772.1|8967_9144_+	hypothetical protein	NA	J9Q729	Salmonella_phage	74.5	1.2e-15
AXZ10773.1|9127_9343_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	77.1	3.2e-23
>prophage 2
CP032187	Klebsiella pneumoniae strain AR_0075 plasmid unnamed2, complete sequence	110928	12730	110861	110928	capsid,terminase,integrase,tail	Salmonella_phage(88.89%)	102	2473:2493	55094:55114
2473:2493	attL	GAAAACAATTTGTTTAAGCAC	NA	NA	NA	NA
AXZ10775.1|12730_13504_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.0	1.1e-89
AXZ10872.1|13634_13880_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	5.3e-14
AXZ10873.1|14169_14580_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10776.1|14589_15000_+	toxin YafO	NA	NA	NA	NA	NA
AXZ10777.1|15064_15424_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10778.1|15773_16874_+|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	30.0	9.4e-18
AXZ10779.1|16868_17249_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXZ10780.1|17850_20130_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	63.1	5.0e-247
AXZ10781.1|20226_21459_+	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	86.4	2.2e-212
AXZ10782.1|21461_21665_+	hypothetical protein	NA	J9Q6I7	Salmonella_phage	79.1	8.0e-24
AXZ10783.1|21639_25158_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.2	0.0e+00
AXZ10784.1|25154_25598_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	80.9	6.0e-56
AXZ10785.1|25697_26672_-	FRG domain-containing protein	NA	NA	NA	NA	NA
AXZ10786.1|26776_27424_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10874.1|27574_28006_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.4	3.4e-64
AXZ10787.1|28125_29133_+	regulator	NA	J9Q7Z3	Salmonella_phage	88.6	5.4e-145
AXZ10788.1|29193_30138_+	exonuclease	NA	J9Q7S6	Salmonella_phage	93.0	1.1e-171
AXZ10789.1|30137_30404_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
AXZ10790.1|30406_31483_+	recombinase	NA	J9Q736	Salmonella_phage	96.4	3.8e-197
AXZ10791.1|31913_32528_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.3e-37
AXZ10792.1|32527_32740_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
AXZ10793.1|33191_34289_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.2e-73
AXZ10794.1|34300_34513_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10795.1|34609_35254_+	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	8.3e-99
AXZ10796.1|35567_37127_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	52.3	6.6e-57
AXZ10797.1|37779_38865_+	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	84.2	2.0e-182
AXZ10875.1|38903_39098_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	2.8e-18
AXZ10798.1|39094_41011_+	exonuclease	NA	J9Q741	Salmonella_phage	84.8	3.3e-300
AXZ10799.1|41000_41747_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.7	1.2e-77
AXZ10800.1|41756_42326_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	90.5	3.8e-95
AXZ10801.1|42401_44705_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
AXZ10802.1|44835_45978_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
AXZ10803.1|46055_46931_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	84.7	4.5e-140
AXZ10804.1|47124_48228_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
AXZ10805.1|48229_48643_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	76.6	2.3e-54
AXZ10806.1|48639_49116_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.0	1.9e-71
AXZ10807.1|49115_49760_+	hypothetical protein	NA	J9Q7H4	Salmonella_phage	76.6	6.8e-93
AXZ10808.1|49823_50243_+	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
AXZ10809.1|50252_50810_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
AXZ10810.1|50935_51769_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.1	1.2e-62
AXZ10811.1|51953_52547_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	83.8	1.2e-96
AXZ10812.1|52744_52978_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.7e-31
AXZ10813.1|53550_54138_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
AXZ10814.1|54569_54848_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10815.1|54844_55033_+	hypothetical protein	NA	J9Q800	Salmonella_phage	52.5	3.3e-08
AXZ10816.1|55135_55561_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
55094:55114	attR	GAAAACAATTTGTTTAAGCAC	NA	NA	NA	NA
AXZ10817.1|55560_55716_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	61.2	1.3e-05
AXZ10818.1|55843_56422_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	3.9e-55
AXZ10819.1|56550_58236_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	91.1	0.0e+00
AXZ10820.1|58297_59026_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	69.7	3.1e-78
AXZ10876.1|59177_59441_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	1.7e-29
AXZ10821.1|59687_60047_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10822.1|60320_60749_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
AXZ10823.1|60893_61640_-	NYN domain-containing protein	NA	NA	NA	NA	NA
AXZ10824.1|62254_62572_+	hypothetical protein	NA	J9Q750	Salmonella_phage	74.3	9.2e-43
AXZ10825.1|62742_63969_+	hypothetical protein	NA	J9Q803	Salmonella_phage	54.2	1.6e-119
AXZ10826.1|64429_64744_-	hypothetical protein	NA	J9Q7T6	Salmonella_phage	66.7	6.4e-12
AXZ10877.1|65519_65738_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
AXZ10827.1|65750_65963_+	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
AXZ10828.1|66099_66411_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	67.0	1.8e-30
AXZ10829.1|66530_66938_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	45.0	2.1e-23
AXZ10830.1|67064_67346_+	ABC transporter	NA	J9Q753	Salmonella_phage	83.9	5.3e-42
AXZ10831.1|67373_67562_-	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	61.1	1.1e-11
AXZ10832.1|67787_68270_+	hypothetical protein	NA	J9Q805	Salmonella_phage	70.6	1.3e-64
AXZ10833.1|68861_69065_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
AXZ10834.1|69115_69766_-	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
AXZ10835.1|70399_70930_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
AXZ10836.1|71085_71523_+	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
AXZ10837.1|71573_71849_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
AXZ10838.1|71851_73411_-	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	92.5	4.4e-279
AXZ10839.1|73494_74175_+	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	89.3	2.1e-108
AXZ10840.1|74174_74843_+	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	91.4	1.9e-106
AXZ10841.1|74839_75478_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
AXZ10842.1|75470_75725_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	2.0e-40
AXZ10843.1|75721_76621_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	4.2e-165
AXZ10844.1|76630_76897_+	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
AXZ10845.1|77072_77714_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
AXZ10846.1|77716_78973_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
AXZ10847.1|78990_80580_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.2	4.8e-273
AXZ10848.1|80602_81502_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
AXZ10849.1|81528_82407_+|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.2	4.7e-153
AXZ10850.1|82485_82914_+	hypothetical protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
AXZ10851.1|82961_83396_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
AXZ10852.1|83395_84229_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	84.1	2.2e-131
AXZ10853.1|84326_84671_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
AXZ10854.1|84661_85135_+	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
AXZ10855.1|85136_85529_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	69.0	5.3e-48
AXZ10856.1|85596_86343_+	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
AXZ10857.1|86404_86722_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
AXZ10858.1|86838_87072_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
AXZ10859.1|87079_91615_+|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	69.7	0.0e+00
AXZ10860.1|91658_91994_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	83.6	5.7e-51
AXZ10861.1|92080_92779_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.0	1.2e-122
AXZ10862.1|92771_93569_+|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
AXZ10863.1|93556_94168_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
AXZ10864.1|94184_106355_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	59.8	2.8e-30
AXZ10865.1|106407_107853_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	37.1	1.3e-38
AXZ10866.1|107948_108272_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
AXZ10867.1|108285_108978_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	89.1	1.2e-119
AXZ10868.1|108980_109232_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	74.7	1.2e-24
AXZ10869.1|109434_109956_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10870.1|110195_110861_+	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	83.3	8.3e-102
>prophage 1
CP032188	Klebsiella pneumoniae strain AR_0075 plasmid unnamed3, complete sequence	93870	18148	54148	93870	integrase,transposase	Escherichia_phage(35.29%)	36	32770:32784	54871:54885
AXZ10893.1|18148_18310_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.7	4.7e-11
AXZ10894.1|18231_18546_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ10895.1|18484_19498_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ10896.1|19670_20123_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
AXZ10897.1|20203_21457_-	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	29.7	3.0e-12
AXZ10898.1|22177_22732_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
AXZ10899.1|23142_23922_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtF1	NA	NA	NA	NA	NA
AXZ10900.1|25271_25466_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10969.1|25570_26203_-	type B chloramphenicol O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.9	2.6e-28
AXZ10901.1|26985_27486_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXZ10902.1|27791_27905_-	NTP-binding protein	NA	NA	NA	NA	NA
AXZ10903.1|27992_28757_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXZ10904.1|28798_29011_+	resolvase	NA	NA	NA	NA	NA
AXZ10905.1|29023_30232_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AXZ10906.1|30265_31699_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AXZ10907.1|32017_32722_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
32770:32784	attL	CTCAGTGGAACGAAA	NA	NA	NA	NA
AXZ10908.1|35600_35933_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AXZ10909.1|35979_36855_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AXZ10910.1|37087_37792_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ10911.1|40670_41003_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AXZ10912.1|41049_41925_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AXZ10913.1|42157_42862_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ10914.1|42908_43145_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10915.1|43218_43635_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXZ10916.1|43631_43862_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXZ10917.1|43845_44280_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10918.1|44424_44739_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10970.1|44787_45099_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10919.1|45163_46168_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10920.1|46365_47160_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
AXZ10921.1|47631_47811_-	Par-like protein	NA	NA	NA	NA	NA
AXZ10922.1|47930_48557_-	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
AXZ10923.1|49189_50065_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AXZ10924.1|50476_51748_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.0	2.6e-152
AXZ10925.1|51747_52179_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.7	7.2e-30
AXZ10926.1|53122_54148_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
54871:54885	attR	CTCAGTGGAACGAAA	NA	NA	NA	NA
>prophage 1
CP032189	Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence	127285	0	42687	127285	integrase,transposase	Escherichia_phage(42.86%)	45	34312:34371	42691:43511
AXZ10973.1|33_384_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
AXZ10974.1|380_821_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
AXZ10975.1|1501_2284_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
AXZ10976.1|2280_3303_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.6	8.7e-175
AXZ10977.1|4332_6060_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10978.1|6505_6754_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10979.1|6750_7323_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10980.1|7353_7848_+	DNA-binding protein	NA	NA	NA	NA	NA
AXZ10981.1|7891_8191_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10982.1|8080_8389_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ10983.1|8514_8751_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10984.1|8882_9431_+	thioredoxin-like domain protein	NA	NA	NA	NA	NA
AXZ10985.1|9477_9912_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AXZ10986.1|10182_11586_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AXZ10987.1|11614_12247_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11111.1|12472_13819_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXZ10988.1|13867_14263_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXZ10989.1|15621_16905_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AXZ10990.1|17034_19227_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AXZ10991.1|19644_20568_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AXZ10992.1|20868_21069_+	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AXZ10993.1|21483_22488_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXZ10994.1|22566_25533_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
AXZ10995.1|25607_25898_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AXZ10996.1|25894_26296_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AXZ10997.1|26285_26642_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXZ10998.1|26896_27211_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ10999.1|28913_29519_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AXZ11000.1|30900_33894_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	46.6	1.3e-258
AXZ11001.1|33897_34308_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
34312:34371	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AXZ11002.1|34374_35079_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ11003.1|35112_35346_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ11004.1|35314_36328_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ11005.1|36500_36953_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AXZ11006.1|37087_37561_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
AXZ11007.1|37654_38134_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ11008.1|38264_38612_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXZ11009.1|38605_39445_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXZ11010.1|39374_39554_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11011.1|39572_40073_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXZ11012.1|40378_40492_-	NTP-binding protein	NA	NA	NA	NA	NA
AXZ11013.1|40579_41344_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXZ11014.1|41385_41607_+	resolvase	NA	NA	NA	NA	NA
AXZ11015.1|41686_41926_+	methionine repressor-like protein	NA	NA	NA	NA	NA
AXZ11016.1|41982_42687_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
42691:43511	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCTATTGCGTGACGTAGATTCGTGACGTATAGTTACTGCAACTTATTTGTTTATAACTACCGTCAGGTACAAAATTATGTCTCCCGTACAAGCTAAACAAAAGCAGCATGAACGCTACGAAGCCGTAGCGGTGCAGGTTTTGCGTGGTCGTGCCGGTTACAAACCTGCCGTGAAAAGCCGCTTCAGTAAGTCAGCTAGTAGCAAATTCGCTCATACTATCGCTTTTGCCTGATCCTGAACTTTGAGGCACAATAAACCATCATTCGCTGATGGTTTTTTTATGCCTGTTCAAGACGTTATTCCCCCCTATGAGCAGATGTACCTGCTAAATCAGCAGCTGATCTGCAACGCTGATCAGTTCAAACATGCCGTTATCACAGTTGGCGGTCAGGCTGTGCAATACTGGATATCCTATTATCATGCACAATACGGCGACAGATTGCCTGATGAGCGCCTCACCACATCTGTTGACTGCGACTACAGCGCCCGGAAAGATGATATTGCGGCTATAGCAAAAACGCTCAACGTTAAGACGTGGGAGAACAAAGACGGTCAGCCCCCATCCCTTGCGCAGTTTATGCTTATCGATCAGGATACACACGATATCAAACGGGATGATGGACGCTTATTTGCCGTACCGGATGCGCCTGACGAGCCAAATGTGGTGGATATTATCGACCGCCCCGGAGGCTTTGACCGTTCTGATTTTCAGGGGAAAAAGCTTTACCTGTATACCGCCCCGTTTTATGTAGAAGCAACC	NA	NA	NA	NA
>prophage 2
CP032189	Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence	127285	48891	58827	127285		Wolbachia_phage(25.0%)	8	NA	NA
AXZ11114.1|48891_49443_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	1.8e-17
AXZ11023.1|49546_49855_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.4	1.7e-17
AXZ11024.1|49851_50502_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AXZ11025.1|50557_51202_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11026.1|51251_51848_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11027.1|52014_52608_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXZ11028.1|52763_53489_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
AXZ11029.1|53568_58827_-	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.8	8.0e-06
>prophage 3
CP032189	Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence	127285	87865	98370	127285	transposase	Escherichia_phage(28.57%)	16	NA	NA
AXZ11064.1|87865_88687_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
AXZ11065.1|89516_89930_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXZ11066.1|89930_90209_-	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AXZ11067.1|90198_90519_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
AXZ11068.1|90599_90824_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11069.1|90834_91047_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11070.1|91139_92120_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AXZ11071.1|92220_92430_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11072.1|92485_92812_-	theronine dehydrogenase	NA	NA	NA	NA	NA
AXZ11073.1|92808_93537_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AXZ11074.1|93533_93965_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AXZ11075.1|94009_96067_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.2	3.4e-21
AXZ11076.1|96136_96385_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXZ11077.1|96433_96976_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
AXZ11117.1|97213_97474_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ11078.1|97806_98370_-	SAM-dependent methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
>prophage 4
CP032189	Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence	127285	101509	116435	127285	integrase	Escherichia_phage(40.0%)	18	110302:110315	124714:124727
AXZ11084.1|101509_101764_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
AXZ11085.1|101951_102143_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11086.1|102185_102692_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
AXZ11087.1|102734_103163_-	antirestriction protein	NA	NA	NA	NA	NA
AXZ11088.1|103842_104610_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11089.1|104663_105083_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AXZ11090.1|105092_105314_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11091.1|105313_106015_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	2.4e-27
AXZ11092.1|106451_106682_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11093.1|106744_107416_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
AXZ11094.1|107418_108390_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	8.2e-74
AXZ11095.1|108623_109055_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AXZ11096.1|109054_110326_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	1.1e-150
110302:110315	attL	TATTCCTGCAGCGA	NA	NA	NA	NA
AXZ11097.1|110407_111385_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
AXZ11098.1|111381_112587_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
AXZ11099.1|113696_114563_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AXZ11100.1|115340_115598_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ11101.1|115655_116435_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
124714:124727	attR	TCGCTGCAGGAATA	NA	NA	NA	NA
>prophage 1
CP032191	Klebsiella pneumoniae strain AR_0075 plasmid unnamed6, complete sequence	78188	7083	51134	78188	head,portal,tail,terminase,capsid	Klebsiella_phage(80.77%)	57	NA	NA
AXZ11171.1|7083_7434_+	hypothetical protein	NA	O64343	Escherichia_phage	77.6	5.1e-50
AXZ11172.1|7768_8761_+	hypothetical protein	NA	A0A2H5BFZ4	Vibrio_phage	40.8	1.4e-23
AXZ11173.1|9003_9324_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11174.1|9902_10067_+	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
AXZ11175.1|10063_10294_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ11176.1|10290_11091_+	hypothetical protein	NA	O64341	Escherichia_phage	78.1	3.2e-116
AXZ11177.1|11145_13059_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	93.4	0.0e+00
AXZ11178.1|13439_15353_+	protelomerase	NA	Q6UAV6	Klebsiella_phage	93.4	0.0e+00
AXZ11179.1|15407_16208_-	hypothetical protein	NA	O64341	Escherichia_phage	78.1	3.2e-116
AXZ11180.1|16204_16435_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11181.1|16431_16596_-	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
AXZ11182.1|17174_17600_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ11183.1|17738_18731_-	hypothetical protein	NA	A0A2H5BFZ4	Vibrio_phage	40.8	1.4e-23
AXZ11184.1|19065_19416_-	hypothetical protein	NA	O64343	Escherichia_phage	77.6	5.1e-50
AXZ11185.1|19412_19709_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ11186.1|19701_23706_-	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.3	0.0e+00
AXZ11187.1|23956_24565_-	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	92.1	2.8e-104
AXZ11188.1|24645_24855_+	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
AXZ11189.1|24844_25582_+	phage antitermination protein	NA	Q6UAU4	Klebsiella_phage	84.5	1.7e-119
AXZ11190.1|25993_26602_+	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	89.0	1.0e-98
AXZ11191.1|27105_27432_+	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	3.9e-52
AXZ11192.1|27452_27680_+	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
AXZ11193.1|27783_27987_+	hypothetical protein	NA	Q6UAT5	Klebsiella_phage	76.6	3.5e-19
AXZ11194.1|28031_28319_-	XRE family transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
AXZ11195.1|28318_28627_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
AXZ11230.1|28797_29019_+	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
AXZ11196.1|29030_29258_+	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
AXZ11197.1|29622_30684_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	93.2	1.6e-171
AXZ11198.1|30742_31054_+	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
AXZ11199.1|31050_31542_+	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.8	6.4e-83
AXZ11200.1|31558_32035_+	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	1.7e-61
AXZ11201.1|32288_32588_+	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
AXZ11202.1|32856_34128_+	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	37.7	3.1e-36
AXZ11203.1|34111_34474_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	92.5	7.8e-62
AXZ11204.1|34470_34755_+	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	2.4e-05
AXZ11205.1|34751_35183_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	60.6	2.6e-40
AXZ11231.1|35268_35469_+	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	90.9	1.0e-10
AXZ11206.1|35684_36119_+|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
AXZ11207.1|36153_37863_+|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
AXZ11208.1|37856_38036_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	80.7	2.4e-16
AXZ11209.1|38035_39295_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.5	1.2e-221
AXZ11210.1|39331_40252_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	1.6e-148
AXZ11211.1|40329_41616_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	83.9	5.9e-205
AXZ11212.1|41675_41963_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.6	4.2e-18
AXZ11213.1|41943_42261_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	4.4e-45
AXZ11214.1|42257_42596_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AXZ11215.1|42576_42966_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	85.3	1.2e-57
AXZ11216.1|42962_43364_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
AXZ11217.1|43395_43857_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AXZ11218.1|43914_44280_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AXZ11219.1|44300_44513_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
AXZ11220.1|44512_47848_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.5	0.0e+00
AXZ11221.1|47847_48186_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	8.3e-58
AXZ11222.1|48182_48938_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	81.3	1.2e-125
AXZ11223.1|48939_49650_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	6.7e-134
AXZ11224.1|49696_50524_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	44.0	1.3e-08
AXZ11225.1|50540_51134_+|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.7	3.7e-85
