The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032175	Klebsiella pneumoniae strain AR_0160 chromosome, complete genome	5330135	383676	390581	5330135		Bacillus_phage(33.33%)	6	NA	NA
AXZ25091.1|383676_385155_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.9	1.9e-29
AXZ25092.1|385151_385874_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AXZ25093.1|386192_387554_+	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AXZ29605.1|387799_388693_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AXZ25094.1|388933_389707_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AXZ29606.1|389717_390581_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 2
CP032175	Klebsiella pneumoniae strain AR_0160 chromosome, complete genome	5330135	3882070	3891534	5330135	protease,tRNA	Dickeya_phage(16.67%)	9	NA	NA
AXZ28248.1|3882070_3883186_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AXZ28249.1|3883182_3885123_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AXZ28250.1|3885062_3885266_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28251.1|3885199_3885421_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXZ28252.1|3885746_3886064_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXZ28253.1|3886094_3888374_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXZ28254.1|3888494_3888713_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXZ28255.1|3889066_3889768_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXZ28256.1|3889812_3891534_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.8	9.0e-15
>prophage 3
CP032175	Klebsiella pneumoniae strain AR_0160 chromosome, complete genome	5330135	4006607	4019041	5330135	protease,integrase	Pectobacterium_phage(54.55%)	16	3996077:3996093	4015775:4015791
3996077:3996093	attL	AGAAAAAACTGGCTGAG	NA	NA	NA	NA
AXZ28340.1|4006607_4007267_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
AXZ28341.1|4007536_4009189_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AXZ28342.1|4009464_4010493_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	54.4	4.0e-95
AXZ28343.1|4010496_4010721_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	66.7	5.9e-20
AXZ28344.1|4010686_4010881_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	60.7	6.3e-10
AXZ28345.1|4010930_4011116_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ28346.1|4011117_4011684_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	61.5	3.3e-51
AXZ28347.1|4011683_4013813_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.3	2.8e-98
AXZ28348.1|4013842_4014088_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	59.5	3.7e-15
AXZ29754.1|4014095_4014329_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ28349.1|4015270_4015657_-	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	57.8	3.4e-15
AXZ28350.1|4015737_4015932_+	transcriptional regulator	NA	NA	NA	NA	NA
4015775:4015791	attR	AGAAAAAACTGGCTGAG	NA	NA	NA	NA
AXZ28351.1|4015992_4016439_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	5.7e-30
AXZ29755.1|4016522_4016681_+	adenylate cyclase	NA	NA	NA	NA	NA
AXZ29756.1|4016698_4017667_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.5	5.5e-38
AXZ28352.1|4018276_4019041_-	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	36.0	5.3e-36
>prophage 4
CP032175	Klebsiella pneumoniae strain AR_0160 chromosome, complete genome	5330135	4172789	4241395	5330135	terminase,portal,tail,capsid,tRNA,integrase,plate	Enterobacteria_phage(51.43%)	83	4199993:4200010	4236151:4236168
AXZ29767.1|4172789_4173896_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AXZ28488.1|4173952_4174411_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AXZ28489.1|4174427_4175078_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AXZ28490.1|4175318_4176569_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AXZ28491.1|4176841_4177555_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ28492.1|4177551_4177944_-	amino acid-binding protein	NA	NA	NA	NA	NA
AXZ28493.1|4177936_4178260_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AXZ28494.1|4178502_4178682_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28495.1|4178708_4178936_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AXZ28496.1|4179048_4180242_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AXZ28497.1|4180863_4181049_+	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AXZ28498.1|4181139_4181634_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXZ28499.1|4181660_4182167_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXZ28500.1|4182183_4183071_+	manganese catalase family protein	NA	NA	NA	NA	NA
AXZ28501.1|4183126_4184533_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXZ28502.1|4184529_4185540_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AXZ28503.1|4185655_4185853_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ28504.1|4186431_4187064_+	DNA-binding protein	NA	NA	NA	NA	NA
AXZ28505.1|4187103_4187283_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28506.1|4187680_4188367_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXZ28507.1|4188677_4190186_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
AXZ28508.1|4191202_4192987_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AXZ28509.1|4193060_4194269_-	HD domain-containing protein	NA	NA	NA	NA	NA
AXZ28510.1|4194571_4195615_+	type II asparaginase	NA	NA	NA	NA	NA
AXZ28511.1|4195869_4196061_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ28512.1|4196276_4197191_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AXZ28513.1|4197280_4197919_+	leucine efflux protein	NA	NA	NA	NA	NA
AXZ28514.1|4198049_4198313_+	DUF2534 family protein	NA	NA	NA	NA	NA
AXZ28515.1|4198371_4198497_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ29768.1|4198614_4198689_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ28516.1|4198688_4198790_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ28517.1|4198847_4199861_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
4199993:4200010	attL	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
AXZ28518.1|4200126_4201110_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	79.8	8.4e-151
AXZ28519.1|4201225_4201525_-	XRE family transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	85.9	3.0e-43
AXZ28520.1|4201646_4201925_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	87.6	2.0e-41
AXZ28521.1|4201945_4202164_+	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	4.7e-06
AXZ28522.1|4202179_4202557_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28523.1|4202572_4202845_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28524.1|4202913_4203138_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28525.1|4203134_4203701_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	32.6	3.6e-13
AXZ29769.1|4203709_4203937_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AXZ28526.1|4203933_4204890_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	52.9	6.6e-84
AXZ28527.1|4204907_4207535_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	50.7	1.7e-190
AXZ28528.1|4208069_4208768_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28529.1|4208840_4209443_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28530.1|4209433_4209889_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28531.1|4210244_4210925_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AXZ28532.1|4211060_4211273_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ28533.1|4211459_4212521_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.7	1.2e-142
AXZ28534.1|4212514_4214242_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	67.9	2.6e-232
AXZ28535.1|4214398_4215238_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	5.6e-95
AXZ28536.1|4215247_4216282_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
AXZ28537.1|4216331_4217189_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.1	1.1e-69
AXZ28538.1|4217301_4217817_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
AXZ28539.1|4217816_4218017_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AXZ28540.1|4218007_4218292_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXZ28541.1|4218288_4218834_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
AXZ29770.1|4218845_4219175_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AXZ28542.1|4219356_4219824_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	5.4e-47
AXZ28543.1|4219820_4220456_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	50.5	6.6e-56
AXZ28544.1|4220452_4221040_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.0	2.2e-61
AXZ28545.1|4221036_4221387_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	54.8	2.1e-27
AXZ28546.1|4221388_4222312_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	9.9e-53
AXZ28547.1|4222301_4225328_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AXZ28548.1|4225324_4225537_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28549.1|4225536_4226634_+|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	46.7	8.8e-08
AXZ28550.1|4226864_4228595_-	deoxycytidylate deaminase	NA	NA	NA	NA	NA
AXZ28551.1|4228842_4229280_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	67.4	1.8e-52
AXZ28552.1|4229295_4232271_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.7	6.3e-218
AXZ29771.1|4232257_4232416_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AXZ28553.1|4232415_4232733_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AXZ28554.1|4232778_4233294_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AXZ28555.1|4233293_4234466_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	2.9e-158
AXZ28556.1|4234620_4235760_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.6e-145
AXZ29772.1|4235803_4236055_+	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AXZ28557.1|4236319_4236559_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
4236151:4236168	attR	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
AXZ28558.1|4236548_4236905_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AXZ28559.1|4236891_4237401_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AXZ28560.1|4237546_4238239_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28561.1|4238270_4239455_-	cyanate MFS transporter	NA	NA	NA	NA	NA
AXZ29773.1|4239556_4240348_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ28562.1|4240331_4240778_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AXZ28563.1|4240894_4241395_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 5
CP032175	Klebsiella pneumoniae strain AR_0160 chromosome, complete genome	5330135	4351822	4410066	5330135	transposase,holin,terminase,tail,integrase	Enterobacteria_phage(21.82%)	73	4342661:4342676	4377505:4377520
4342661:4342676	attL	GGTGGCCGCAGCGGCT	NA	NA	NA	NA
AXZ28670.1|4351822_4352632_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
AXZ28671.1|4352633_4353626_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AXZ28672.1|4353625_4354516_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AXZ28673.1|4354692_4355880_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
AXZ28674.1|4355776_4356091_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AXZ28675.1|4356100_4356340_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
AXZ28676.1|4356380_4357490_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	86.7	1.0e-184
AXZ28677.1|4357502_4360547_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.4	1.0e-292
AXZ28678.1|4360684_4360840_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	1.5e-14
AXZ28679.1|4360848_4361040_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXZ28680.1|4361146_4361245_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ28681.1|4361336_4361645_-	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
AXZ28682.1|4361871_4362228_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ28683.1|4362324_4362588_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXZ28684.1|4362590_4363127_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	68.3	3.1e-59
AXZ28685.1|4363474_4364395_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	61.3	1.7e-92
AXZ28686.1|4364391_4365135_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	54.8	6.9e-65
AXZ28687.1|4365127_4365463_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.4e-11
AXZ28688.1|4365455_4366241_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	53.3	1.7e-66
AXZ28689.1|4366368_4366776_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.3	6.6e-09
AXZ28690.1|4366772_4367255_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	83.4	2.9e-72
AXZ28691.1|4368101_4368359_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28692.1|4368474_4369470_-	SppA protein	NA	NA	NA	NA	NA
AXZ28693.1|4369817_4370177_+	XRE family transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	50.9	9.2e-23
AXZ28694.1|4370179_4370656_+	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	30.7	2.6e-17
AXZ28695.1|4371261_4371495_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
AXZ28696.1|4371572_4371794_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28697.1|4371851_4372451_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.9	1.3e-90
AXZ28698.1|4372450_4372657_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	71.2	5.3e-23
AXZ28699.1|4372659_4372956_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.9	2.1e-36
AXZ28700.1|4372952_4373309_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.5e-41
AXZ28701.1|4373424_4374246_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.1	4.0e-98
AXZ28702.1|4374605_4374830_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ29776.1|4374937_4375339_+	hypothetical protein	NA	G8C7V8	Escherichia_phage	71.7	4.3e-37
AXZ28703.1|4375324_4376089_-	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	36.0	5.3e-36
AXZ28704.1|4376085_4377585_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
4377505:4377520	attR	GGTGGCCGCAGCGGCT	NA	NA	NA	NA
AXZ28705.1|4377734_4378016_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.1	1.3e-32
AXZ28706.1|4378015_4378645_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.4	1.3e-85
AXZ28707.1|4378647_4378923_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	44.9	4.3e-12
AXZ28708.1|4378873_4379050_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.7	2.2e-22
AXZ28709.1|4379106_4379307_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	5.9e-19
AXZ28710.1|4379752_4379941_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28711.1|4380047_4380269_+	DNA gyrase subunit B	NA	NA	NA	NA	NA
AXZ28712.1|4380553_4380799_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	95.1	6.7e-33
AXZ28713.1|4381147_4382152_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.0	1.3e-37
AXZ28714.1|4382129_4383437_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
AXZ28715.1|4383436_4384837_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.7	4.9e-128
AXZ28716.1|4384820_4385933_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	2.1e-110
AXZ28717.1|4386463_4387249_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.6	4.6e-67
AXZ28718.1|4387259_4388213_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	1.1e-131
AXZ28719.1|4388534_4388930_+	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	44.2	2.5e-13
AXZ28720.1|4388931_4389186_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
AXZ28721.1|4389195_4389429_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	47.7	1.7e-09
AXZ28722.1|4389415_4389799_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
AXZ28723.1|4389800_4390352_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	40.4	1.7e-28
AXZ28724.1|4390348_4390741_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AXZ28725.1|4390764_4391937_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
AXZ28726.1|4391990_4392473_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28727.1|4392640_4392808_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28728.1|4393019_4393397_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28729.1|4393460_4396397_+|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	37.7	5.7e-102
AXZ28730.1|4396480_4396816_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ28731.1|4397127_4397592_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	59.9	1.3e-53
AXZ28732.1|4397588_4398071_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	90.6	7.2e-79
AXZ28733.1|4398081_4398462_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	92.9	1.7e-67
AXZ28734.1|4398458_4401527_+	kinase	NA	A0A286S259	Klebsiella_phage	94.3	0.0e+00
AXZ28735.1|4401732_4405110_+	hypothetical protein	NA	A0A2H5BNP5	Klebsiella_phage	58.8	0.0e+00
AXZ28736.1|4405109_4405454_+	hypothetical protein	NA	A0A2H5BNP5	Klebsiella_phage	55.5	5.3e-28
AXZ28737.1|4405570_4406464_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ28738.1|4407184_4407607_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
AXZ28739.1|4408156_4408576_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AXZ28740.1|4408577_4409843_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.9	1.5e-208
AXZ28741.1|4409835_4410066_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	49.3	7.0e-16
>prophage 6
CP032175	Klebsiella pneumoniae strain AR_0160 chromosome, complete genome	5330135	4676962	4687850	5330135		Escherichia_phage(87.5%)	10	NA	NA
AXZ28985.1|4676962_4677583_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AXZ28986.1|4677575_4678841_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
AXZ28987.1|4678852_4679755_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	3.8e-158
AXZ28988.1|4679792_4680026_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ28989.1|4680016_4680778_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXZ28990.1|4680798_4681659_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AXZ28991.1|4681956_4682217_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AXZ28992.1|4682303_4683392_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	1.8e-210
AXZ28993.1|4683422_4684688_-	MFS transporter	NA	NA	NA	NA	NA
AXZ28994.1|4684742_4687850_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 1
CP032173	Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence	153522	2957	76232	153522	protease,transposase,integrase	Escherichia_phage(16.67%)	57	52514:52542	76847:76875
AXZ24555.1|2957_3662_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
AXZ24556.1|3805_3994_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ24557.1|4986_5802_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ24558.1|5826_7335_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.2	7.6e-34
AXZ24559.1|7344_8067_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ24560.1|8066_8903_+	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
AXZ24561.1|8943_10398_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AXZ24562.1|11186_11837_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ24563.1|12176_13421_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AXZ24564.1|13429_14203_+	LamB/YcsF family protein	NA	NA	NA	NA	NA
AXZ24565.1|14199_15006_+	putative hydro-lyase	NA	NA	NA	NA	NA
AXZ24566.1|15018_16602_+	allophanate hydrolase	NA	NA	NA	NA	NA
AXZ24567.1|16601_18347_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AXZ24568.1|19814_20279_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ24569.1|22681_23182_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ24570.1|23224_24580_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXZ24571.1|24595_24880_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	55.9	6.4e-19
AXZ24572.1|24869_25118_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AXZ24666.1|26865_27147_+	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	6.8e-05
AXZ24573.1|27181_27751_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXZ24574.1|27856_30652_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AXZ24575.1|30651_30849_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ24576.1|31086_31836_+	diguanylate cyclase	NA	NA	NA	NA	NA
AXZ24577.1|31822_32785_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AXZ24667.1|34180_34267_-	ABC transporter	NA	NA	NA	NA	NA
AXZ24578.1|34413_36999_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.5e-23
AXZ24579.1|37157_37862_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ24580.1|38012_38279_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AXZ24581.1|38266_38749_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXZ24668.1|38956_40303_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXZ24582.1|40361_41156_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXZ24583.1|41194_42904_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ24584.1|43268_45080_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ24585.1|45076_46963_-	AAA family ATPase	NA	NA	NA	NA	NA
AXZ24586.1|47118_47595_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ24587.1|47783_48773_+|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	28.0	2.7e-08
AXZ24669.1|49512_49833_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.0e-20
AXZ24588.1|49877_51167_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.9	7.6e-168
AXZ24589.1|51562_52486_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	1.0e-174
52514:52542	attL	ACCCGAAATCTGATTTATTCAACAAAGCC	NA	NA	NA	NA
AXZ24590.1|53573_55073_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AXZ24591.1|55069_55834_+	hypothetical protein	NA	A0A059NT77	Lactococcus_phage	35.4	9.7e-30
AXZ24592.1|55884_56931_-	FUSC family protein	NA	NA	NA	NA	NA
AXZ24593.1|57196_57706_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
AXZ24594.1|59448_59721_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
AXZ24595.1|59720_61109_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
AXZ24596.1|61101_62214_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
AXZ24597.1|62210_62846_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
AXZ24670.1|63402_63780_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
AXZ24598.1|63776_64124_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
AXZ24599.1|67947_69681_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
AXZ24600.1|69688_70636_-	acetamidase	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
AXZ24601.1|70680_72285_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ24602.1|72297_73218_-	ABC transporter permease	NA	NA	NA	NA	NA
AXZ24603.1|73217_74066_-	ABC transporter permease	NA	NA	NA	NA	NA
AXZ24604.1|74062_74656_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
AXZ24605.1|74652_75780_-	regulator	NA	NA	NA	NA	NA
AXZ24606.1|76064_76232_-|integrase	integrase	integrase	NA	NA	NA	NA
76847:76875	attR	ACCCGAAATCTGATTTATTCAACAAAGCC	NA	NA	NA	NA
>prophage 2
CP032173	Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence	153522	86140	148728	153522	integrase,transposase,holin	Bacillus_phage(18.18%)	47	85690:85705	118500:118515
85690:85705	attL	AATTCAAACTGTCCTG	NA	NA	NA	NA
AXZ24615.1|86140_87145_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXZ24616.1|87548_88541_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AXZ24617.1|88910_89993_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
AXZ24618.1|90114_93189_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
AXZ24619.1|93240_94494_+	MFS transporter	NA	NA	NA	NA	NA
AXZ24620.1|94609_95533_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	1.2e-172
AXZ24621.1|97279_98020_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AXZ24622.1|98716_99727_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
AXZ24623.1|100467_101634_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
AXZ24624.1|101633_102605_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	1.4e-150
AXZ24672.1|102818_103211_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ24625.1|103681_103987_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ24626.1|104040_104292_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AXZ24627.1|104370_105642_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.5	3.6e-154
AXZ24628.1|105641_105845_-	umuDC operon-like protein	NA	A0A1W6JNS2	Morganella_phage	57.9	1.5e-09
AXZ24629.1|105903_106608_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ24673.1|106736_107585_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AXZ24674.1|108128_109037_+	HNH endonuclease	NA	NA	NA	NA	NA
AXZ24630.1|109222_109573_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
AXZ24631.1|109720_110152_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AXZ24632.1|110402_111878_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AXZ24633.1|111870_112551_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
AXZ24634.1|112740_114126_+	Cu(I)/Ag(I) efflux RND transporter outer membrane protein	NA	NA	NA	NA	NA
AXZ24635.1|114154_114508_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ24636.1|114621_115914_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXZ24637.1|115924_119071_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
118500:118515	attR	CAGGACAGTTTGAATT	NA	NA	NA	NA
AXZ24638.1|119157_119598_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ24639.1|119724_122172_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	4.4e-84
AXZ24640.1|122212_122410_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AXZ24641.1|122443_123181_-	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
AXZ24642.1|123469_123919_-	copper resistance protein	NA	NA	NA	NA	NA
AXZ24643.1|124152_125970_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AXZ24644.1|125969_126866_+	copper resistance protein B	NA	NA	NA	NA	NA
AXZ24645.1|126905_127286_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AXZ24646.1|127290_128220_+	copper resistance protein D	NA	NA	NA	NA	NA
AXZ24647.1|128274_128955_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AXZ24648.1|128951_130352_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
AXZ24649.1|130567_131002_+	copper-binding protein	NA	NA	NA	NA	NA
AXZ24675.1|133131_133746_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ24650.1|134096_134522_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
AXZ24651.1|134534_135824_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.1e-170
AXZ24652.1|135871_137623_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AXZ24653.1|137640_138003_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AXZ24654.1|138050_138404_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
AXZ24655.1|140004_142008_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	24.9	4.1e-19
AXZ24656.1|142070_143348_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AXZ24657.1|147228_148728_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
