The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032184	Citrobacter freundii strain AR_0116 chromosome, complete genome	5121015	1773922	1781834	5121015	holin	Enterobacteria_phage(33.33%)	14	NA	NA
AXZ47749.1|1773922_1774189_-	peptidase	NA	U5P461	Shigella_phage	76.6	2.3e-18
AXZ47750.1|1774488_1775259_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ47751.1|1775628_1776039_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ47752.1|1776178_1776538_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ50859.1|1776547_1777051_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	79.9	5.9e-60
AXZ47753.1|1777074_1777623_-	lysozyme	NA	K7PM52	Enterobacteria_phage	95.1	1.4e-99
AXZ47754.1|1777594_1777873_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	100.0	3.9e-45
AXZ47755.1|1778026_1778215_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ47756.1|1778955_1779153_+	oxidoreductase	NA	NA	NA	NA	NA
AXZ47757.1|1779239_1779854_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	76.9	7.7e-86
AXZ47758.1|1779867_1780908_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	49.4	5.3e-95
AXZ50860.1|1780904_1781264_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	63.6	1.7e-40
AXZ47759.1|1781266_1781467_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	63.1	7.2e-17
AXZ50861.1|1781594_1781834_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.4	1.7e-20
>prophage 2
CP032184	Citrobacter freundii strain AR_0116 chromosome, complete genome	5121015	1789575	1796680	5121015	integrase	Escherichia_phage(50.0%)	8	1794938:1794951	1803119:1803132
AXZ47767.1|1789575_1790370_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.2	5.5e-68
AXZ50862.1|1790424_1790979_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ47768.1|1790982_1791195_-	transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	59.7	4.9e-16
AXZ47769.1|1791300_1791681_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	66.7	6.5e-19
AXZ50863.1|1792172_1792499_+	transcriptional regulator	NA	NA	NA	NA	NA
AXZ47770.1|1792640_1795112_+	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.9	1.3e-112
1794938:1794951	attL	TGTTCCGTTCTGGA	NA	NA	NA	NA
AXZ47771.1|1795178_1795394_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	54.9	1.7e-19
AXZ47772.1|1795393_1796680_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	50.6	9.4e-110
1803119:1803132	attR	TGTTCCGTTCTGGA	NA	NA	NA	NA
>prophage 3
CP032184	Citrobacter freundii strain AR_0116 chromosome, complete genome	5121015	1865248	1871196	5121015		uncultured_Caudovirales_phage(57.14%)	8	NA	NA
AXZ47824.1|1865248_1866499_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
AXZ47825.1|1866634_1867144_-	DedA family protein	NA	NA	NA	NA	NA
AXZ47826.1|1867233_1867476_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
AXZ47827.1|1867863_1868562_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
AXZ50871.1|1868647_1868968_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
AXZ47828.1|1869012_1870302_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	69.7	4.6e-165
AXZ47829.1|1870314_1870740_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
AXZ47830.1|1870983_1871196_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	6.0e-22
>prophage 4
CP032184	Citrobacter freundii strain AR_0116 chromosome, complete genome	5121015	1966728	1976766	5121015	tRNA	Tupanvirus(14.29%)	10	NA	NA
AXZ47923.1|1966728_1967712_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AXZ47924.1|1967727_1970115_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXZ47925.1|1970119_1970419_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AXZ47926.1|1970572_1971553_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	5.1e-15
AXZ47927.1|1971613_1972165_+	glutathione peroxidase	NA	NA	NA	NA	NA
AXZ47928.1|1972164_1972914_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.1e-09
AXZ47929.1|1972991_1973456_+	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
AXZ47930.1|1973772_1974486_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXZ47931.1|1974547_1975990_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
AXZ47932.1|1975986_1976766_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	7.9e-11
>prophage 5
CP032184	Citrobacter freundii strain AR_0116 chromosome, complete genome	5121015	2076474	2116858	5121015	integrase,plate,tail,tRNA,head	Burkholderia_virus(42.11%)	54	2090465:2090479	2113672:2113686
AXZ48019.1|2076474_2077479_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AXZ48020.1|2077680_2079465_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	2.8e-19
AXZ48021.1|2079584_2080694_-	AI-2E family transporter	NA	NA	NA	NA	NA
AXZ48022.1|2080859_2081342_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.7	5.6e-23
AXZ48023.1|2081797_2082379_-	DNA-invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	71.5	4.0e-68
AXZ48024.1|2083171_2083579_+|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	65.0	8.0e-23
AXZ48025.1|2083550_2084144_-|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	47.5	1.1e-52
AXZ48026.1|2084143_2085121_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	43.5	7.5e-43
AXZ48027.1|2085123_2085702_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.3	7.5e-67
AXZ48028.1|2085694_2086798_-|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	53.3	9.2e-106
AXZ48029.1|2086788_2087136_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	7.8e-35
AXZ48030.1|2087190_2087703_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	37.9	2.1e-20
AXZ48031.1|2087702_2088872_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	48.9	6.0e-87
AXZ48032.1|2088859_2089075_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AXZ48033.1|2089071_2089956_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.5	8.9e-51
AXZ48034.1|2089955_2092421_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.4	7.0e-170
2090465:2090479	attL	GCAGGTCAACGCCGA	NA	NA	NA	NA
AXZ48035.1|2092513_2092651_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXZ48036.1|2092616_2092931_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXZ48037.1|2093029_2093311_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ48038.1|2093313_2093835_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.8	1.0e-67
AXZ48039.1|2093834_2095262_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	78.6	3.4e-217
AXZ48040.1|2095251_2095506_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ48041.1|2095502_2095967_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	4.1e-39
AXZ48042.1|2095966_2096413_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	1.1e-33
AXZ48043.1|2096414_2096771_-	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AXZ48044.1|2096781_2097735_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.6	3.4e-64
AXZ48045.1|2097748_2098846_-	peptidase	NA	A4JWJ9	Burkholderia_virus	50.1	2.0e-97
AXZ48046.1|2099060_2099519_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.0	1.1e-28
AXZ48047.1|2099521_2100343_-|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	61.9	9.0e-98
AXZ48048.1|2100323_2101820_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	61.5	2.8e-174
AXZ48049.1|2101819_2103343_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.2	1.3e-182
AXZ48050.1|2103339_2103885_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	1.2e-58
AXZ48051.1|2103884_2104196_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
AXZ48052.1|2104188_2104521_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
AXZ48053.1|2104517_2105171_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	31.6	1.4e-08
AXZ48054.1|2105160_2105883_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.4	1.8e-62
AXZ48055.1|2105885_2106236_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	1.2e-22
AXZ50884.1|2106454_2106691_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48056.1|2106611_2107178_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
AXZ48057.1|2107421_2108192_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.9	1.7e-98
AXZ48058.1|2108239_2108773_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ48059.1|2108808_2109219_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXZ48060.1|2109307_2109532_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48061.1|2109528_2109834_+	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	58.0	9.2e-24
AXZ48062.1|2109843_2110755_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.6	7.0e-75
AXZ48063.1|2110758_2112528_+|integrase	integrase	integrase	Q6QIE0	Burkholderia_phage	67.6	1.2e-227
AXZ48064.1|2112538_2113705_+	hypothetical protein	NA	A4JWN1	Burkholderia_virus	60.4	1.8e-120
2113672:2113686	attR	GCAGGTCAACGCCGA	NA	NA	NA	NA
AXZ48065.1|2113707_2113977_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48066.1|2113994_2114606_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	1.2e-75
AXZ48067.1|2114684_2114873_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48068.1|2114869_2115166_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48069.1|2115152_2115842_+	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	34.2	1.0e-25
AXZ48070.1|2115838_2116054_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48071.1|2116468_2116858_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	53.4	3.8e-30
>prophage 6
CP032184	Citrobacter freundii strain AR_0116 chromosome, complete genome	5121015	2606705	2693880	5121015	coat,integrase,tail,tRNA,holin,terminase,protease	Escherichia_phage(32.26%)	105	2640180:2640210	2691633:2691663
AXZ48511.1|2606705_2607401_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	35.4	5.8e-05
AXZ48512.1|2607459_2609370_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	9.1e-93
AXZ48513.1|2609510_2609855_+	RidA family protein	NA	NA	NA	NA	NA
AXZ48514.1|2609861_2610041_-	YoaH family protein	NA	NA	NA	NA	NA
AXZ48515.1|2610121_2611486_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	40.2	8.3e-40
AXZ48516.1|2611489_2612068_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
AXZ48517.1|2612251_2613616_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AXZ48518.1|2613746_2615348_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AXZ48519.1|2615354_2616914_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
AXZ48520.1|2617373_2618336_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AXZ48521.1|2618394_2619195_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AXZ48522.1|2619207_2620059_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AXZ48523.1|2620119_2620578_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48524.1|2620956_2621577_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AXZ48525.1|2621573_2622383_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AXZ48526.1|2622446_2624192_-	peptidoglycan synthase	NA	NA	NA	NA	NA
AXZ48527.1|2624411_2624621_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AXZ48528.1|2624633_2624777_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AXZ48529.1|2624738_2624921_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48530.1|2625413_2625698_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ48531.1|2625772_2625916_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AXZ48532.1|2626080_2626320_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48533.1|2626434_2627226_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AXZ48534.1|2627400_2628774_+	MFS transporter	NA	NA	NA	NA	NA
AXZ48535.1|2628820_2629702_-|protease	protease HtpX	protease	NA	NA	NA	NA
AXZ48536.1|2629894_2631943_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	9.5e-88
AXZ48537.1|2631962_2632649_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AXZ48538.1|2632745_2633243_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AXZ48539.1|2633371_2634655_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AXZ48540.1|2634623_2637257_+	MCE family protein	NA	NA	NA	NA	NA
AXZ48541.1|2637336_2638758_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AXZ48542.1|2638855_2639095_+	DUF1480 family protein	NA	NA	NA	NA	NA
AXZ48543.1|2639197_2639389_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXZ48544.1|2639389_2640031_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	1.1e-55
2640180:2640210	attL	CACATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AXZ48545.1|2640515_2641187_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	1.0e-78
AXZ48546.1|2641179_2642448_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	81.0	2.1e-202
AXZ48547.1|2642449_2642869_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.1	6.1e-34
AXZ48548.1|2642946_2643189_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	3.4e-29
AXZ48549.1|2643324_2644650_-|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.6	6.9e-116
AXZ48550.1|2644659_2645604_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	66.1	3.4e-117
AXZ48551.1|2645606_2648840_-	host specificity protein	NA	G8C7R4	Escherichia_phage	68.6	0.0e+00
AXZ48552.1|2648888_2649686_-	hypothetical protein	NA	A0A0E3D9J0	Bacillus_phage	40.7	4.6e-14
AXZ48553.1|2649784_2650378_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	80.4	3.2e-81
AXZ48554.1|2650365_2651097_-	peptidase P60	NA	G8C7R2	Escherichia_phage	90.9	2.5e-139
AXZ48555.1|2651109_2651883_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	88.2	3.6e-133
AXZ48556.1|2651891_2652242_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	94.8	9.5e-57
AXZ48557.1|2652290_2653064_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	56.2	4.2e-65
AXZ48558.1|2653147_2653786_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	62.0	2.6e-68
AXZ48559.1|2653858_2654026_-	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	70.9	1.1e-15
AXZ48560.1|2654150_2654414_+	hypothetical protein	NA	E7C9U8	Salmonella_phage	57.8	2.0e-06
AXZ48561.1|2654514_2654913_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48562.1|2655009_2655234_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ48563.1|2655233_2658467_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	43.0	4.0e-165
AXZ48564.1|2658466_2658754_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	63.1	1.4e-18
AXZ48565.1|2658771_2659110_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	94.6	2.5e-54
AXZ48566.1|2659180_2659735_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	91.0	1.8e-89
AXZ48567.1|2659963_2660896_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	92.9	1.1e-157
AXZ48568.1|2660942_2661392_-	hypothetical protein	NA	G8C7Q2	Escherichia_phage	91.9	2.1e-72
AXZ48569.1|2661381_2661981_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	89.4	7.7e-99
AXZ48570.1|2661983_2662337_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	91.5	8.4e-53
AXZ48571.1|2662338_2662821_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	85.0	5.1e-77
AXZ48572.1|2662823_2663129_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	89.7	3.3e-13
AXZ48573.1|2663168_2664305_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	92.1	1.0e-192
AXZ48574.1|2664321_2665074_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	90.4	1.6e-122
AXZ48575.1|2665180_2665390_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	51.5	1.7e-13
AXZ48576.1|2665393_2666500_-	hypothetical protein	NA	G8C7P5	Escherichia_phage	91.3	6.1e-190
AXZ48577.1|2666501_2667905_-	DNA-binding protein	NA	G8C7P4	Escherichia_phage	90.0	2.0e-238
AXZ48578.1|2667909_2669214_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	4.4e-147
AXZ48579.1|2669191_2670181_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	41.9	1.0e-34
AXZ48580.1|2670228_2670549_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48581.1|2670622_2670925_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ48582.1|2670969_2671488_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AXZ48583.1|2671484_2672033_-	lysozyme	NA	K7PM52	Enterobacteria_phage	96.7	3.4e-101
AXZ48584.1|2672004_2672283_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
AXZ48585.1|2672437_2672626_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ48586.1|2672834_2673275_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ48587.1|2673913_2674603_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.1	9.9e-66
AXZ48588.1|2674599_2674737_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	86.0	2.7e-15
AXZ48589.1|2674733_2675321_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	63.4	9.1e-60
AXZ48590.1|2675323_2675530_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	70.6	8.1e-24
AXZ48591.1|2675529_2676129_-	hypothetical protein	NA	K7PKS6	Enterobacteria_phage	96.0	3.2e-105
AXZ48592.1|2676563_2677223_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	44.7	9.9e-23
AXZ48593.1|2677219_2677597_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	100.0	1.7e-67
AXZ50906.1|2678161_2678605_-	hypothetical protein	NA	K7P801	Enterobacteria_phage	39.0	3.9e-07
AXZ48594.1|2678631_2678943_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ48595.1|2678961_2679711_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	87.1	2.5e-123
AXZ48596.1|2679713_2680661_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	30.3	1.1e-22
AXZ48597.1|2680828_2681368_-	regulator	NA	K7PJT7	Enterobacteria_phage	86.6	3.2e-80
AXZ48598.1|2681399_2681630_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	54.1	4.1e-16
AXZ48599.1|2681759_2682443_+	hypothetical protein	NA	G8C7U1	Escherichia_phage	76.2	9.5e-93
AXZ48600.1|2682587_2683412_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48601.1|2683408_2684227_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AXZ48602.1|2684264_2684489_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	64.7	1.2e-15
AXZ48603.1|2684912_2685128_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ48604.1|2685248_2685455_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48605.1|2685454_2685652_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXZ48606.1|2685961_2688790_+	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	59.8	8.0e-287
AXZ48607.1|2688801_2689887_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	63.6	1.1e-124
AXZ48608.1|2689926_2690169_+	DUF4060 domain-containing protein	NA	K7PHF4	Enterobacteria_phage	87.3	5.6e-32
AXZ48609.1|2690233_2690506_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	63.3	3.2e-28
AXZ48610.1|2690474_2691560_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	69.0	7.3e-148
AXZ48611.1|2691896_2692235_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
2691633:2691663	attR	CACATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AXZ48612.1|2692255_2693128_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ48613.1|2693131_2693506_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AXZ48614.1|2693649_2693880_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
>prophage 7
CP032184	Citrobacter freundii strain AR_0116 chromosome, complete genome	5121015	2926782	2933080	5121015		Enterobacteria_phage(66.67%)	6	NA	NA
AXZ48852.1|2926782_2927337_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.1	7.8e-53
AXZ48853.1|2927338_2928217_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	3.9e-107
AXZ48854.1|2928268_2929168_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.3	3.6e-31
AXZ48855.1|2929167_2930253_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	1.5e-100
AXZ48856.1|2930626_2931520_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.1	7.4e-45
AXZ48857.1|2931685_2933080_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	35.0	4.7e-22
>prophage 8
CP032184	Citrobacter freundii strain AR_0116 chromosome, complete genome	5121015	2974930	2984508	5121015	protease	Bacillus_phage(28.57%)	8	NA	NA
AXZ48887.1|2974930_2976334_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.6	3.9e-32
AXZ48888.1|2976330_2977053_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AXZ48889.1|2977188_2977521_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AXZ48890.1|2977680_2979042_+	U32 family peptidase	NA	Q6DW11	Phage_TP	92.9	4.1e-204
AXZ48891.1|2979311_2981588_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
AXZ48892.1|2981618_2981939_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AXZ48893.1|2982262_2982487_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AXZ48894.1|2982561_2984508_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
>prophage 9
CP032184	Citrobacter freundii strain AR_0116 chromosome, complete genome	5121015	3022754	3031173	5121015	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AXZ48929.1|3022754_3024788_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
AXZ48930.1|3024994_3025453_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.1e-50
AXZ50919.1|3025495_3025966_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
AXZ48931.1|3026012_3026732_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AXZ48932.1|3026728_3028414_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
AXZ48933.1|3028639_3029371_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
AXZ48934.1|3029422_3029530_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ48935.1|3029510_3030242_-	ABC transporter permease	NA	NA	NA	NA	NA
AXZ48936.1|3030225_3031173_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	2.6e-08
>prophage 10
CP032184	Citrobacter freundii strain AR_0116 chromosome, complete genome	5121015	3362393	3413884	5121015	tRNA,transposase,protease,integrase	Escherichia_phage(27.27%)	53	3367574:3367592	3415469:3415487
AXZ49225.1|3362393_3364409_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
AXZ49226.1|3364424_3365291_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
AXZ49227.1|3365419_3366133_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	35.7	2.0e-37
AXZ49228.1|3366244_3367279_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AXZ49229.1|3367295_3368174_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
3367574:3367592	attL	CATGACCACCGAGCTGCAT	NA	NA	NA	NA
AXZ49230.1|3368253_3368892_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
AXZ49231.1|3368891_3369362_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
AXZ49232.1|3370689_3371151_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ49233.1|3371152_3371812_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ49234.1|3371978_3373043_-	AI-2E family transporter	NA	NA	NA	NA	NA
AXZ49235.1|3373269_3374733_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AXZ49236.1|3374856_3375216_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AXZ49237.1|3375249_3375975_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AXZ49238.1|3376046_3377336_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.7	1.7e-63
AXZ49239.1|3377432_3378059_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AXZ49240.1|3378242_3379673_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AXZ50935.1|3379968_3381006_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.4	6.3e-72
AXZ49241.1|3381002_3381644_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.6	4.5e-28
AXZ49242.1|3381858_3383925_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AXZ49243.1|3383929_3385471_+	exopolyphosphatase	NA	NA	NA	NA	NA
AXZ49244.1|3385450_3387721_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AXZ49245.1|3388071_3388275_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	71.4	5.6e-17
AXZ49246.1|3388639_3389518_+	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AXZ49247.1|3389923_3390739_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AXZ49248.1|3390825_3391128_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXZ49249.1|3391021_3391273_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ49250.1|3391303_3392797_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXZ49251.1|3393007_3393232_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ49252.1|3393228_3393966_-	resolvase	NA	NA	NA	NA	NA
AXZ49253.1|3394247_3395261_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ49254.1|3396095_3396443_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXZ49255.1|3396436_3397276_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AXZ49256.1|3397205_3397385_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ49257.1|3397403_3397904_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXZ50936.1|3398079_3398862_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AXZ49258.1|3398851_3400375_-|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AXZ49259.1|3401331_3403047_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ50937.1|3402978_3403164_+	resolvase	NA	NA	NA	NA	NA
AXZ49260.1|3403225_3403558_+	transcriptional regulator	NA	NA	NA	NA	NA
AXZ49261.1|3403554_3404322_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	63.3	1.4e-76
AXZ49262.1|3404318_3404825_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	3.0e-27
AXZ49263.1|3404821_3405889_+	arsenical-resistance protein	NA	NA	NA	NA	NA
AXZ49264.1|3406003_3406207_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ49265.1|3406243_3406468_-	type I toxin-antitoxin system ptaRNA1 family toxin	NA	NA	NA	NA	NA
AXZ49266.1|3406531_3406780_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ50938.1|3406784_3408212_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
AXZ49267.1|3408222_3408459_-	entry exclusion lipoprotein TrbK	NA	NA	NA	NA	NA
AXZ49268.1|3408471_3409251_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
AXZ49269.1|3409391_3409580_-	stabilization protein	NA	NA	NA	NA	NA
AXZ49270.1|3410612_3411494_-	replication protein C	NA	NA	NA	NA	NA
AXZ49271.1|3411480_3412308_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ49272.1|3412312_3412534_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXZ49273.1|3412681_3413884_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	55.1	5.0e-121
3415469:3415487	attR	CATGACCACCGAGCTGCAT	NA	NA	NA	NA
>prophage 11
CP032184	Citrobacter freundii strain AR_0116 chromosome, complete genome	5121015	4129315	4190844	5121015	lysis,integrase,plate,tail,tRNA,portal,holin,head,terminase,capsid	Escherichia_phage(30.61%)	70	4138882:4138929	4169762:4169809
AXZ49874.1|4129315_4130329_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	7.4e-110
AXZ49875.1|4130565_4130781_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXZ49876.1|4131018_4132764_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
AXZ49877.1|4133123_4134971_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AXZ49878.1|4135131_4136181_+	YncE family protein	NA	NA	NA	NA	NA
AXZ49879.1|4136191_4138189_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.2	1.9e-08
AXZ49880.1|4138219_4138726_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4138882:4138929	attL	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAA	NA	NA	NA	NA
AXZ49881.1|4139085_4139304_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	100.0	4.3e-39
AXZ49882.1|4139371_4140541_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	95.6	4.4e-207
AXZ49883.1|4140537_4141023_-|tail	phage tail protein	tail	O80317	Escherichia_phage	92.5	5.0e-80
AXZ49884.1|4141036_4143478_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	94.6	0.0e+00
AXZ49885.1|4143470_4143590_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	100.0	1.4e-15
AXZ49886.1|4143622_4143958_-|tail	phage tail assembly protein	tail	Q37846	Escherichia_phage	97.3	4.0e-52
AXZ49887.1|4144019_4144541_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	99.4	3.8e-94
AXZ49888.1|4144556_4145735_-|tail	phage tail protein	tail	Q37844	Escherichia_phage	95.2	2.7e-212
AXZ49889.1|4146105_4146636_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	47.7	5.2e-38
AXZ50973.1|4147350_4147557_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ50974.1|4148847_4149381_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	92.6	8.7e-94
AXZ49890.1|4149373_4150282_-|plate	baseplate assembly protein	plate	Q37840	Escherichia_phage	93.7	5.4e-152
AXZ49891.1|4150288_4150636_-|plate	baseplate assembly protein	plate	O80315	Escherichia_phage	96.5	1.2e-54
AXZ49892.1|4150632_4151274_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	93.9	2.6e-108
AXZ49893.1|4151342_4151792_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	95.3	5.7e-70
AXZ49894.1|4151784_4152252_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	98.1	1.3e-82
AXZ49895.1|4152214_4152388_-|lysis	phage lysis protein	lysis	Q6K1H9	Salmonella_virus	94.7	6.8e-24
AXZ49896.1|4152359_4152773_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	92.7	1.2e-61
AXZ49897.1|4152769_4153267_-	lysozyme	NA	S4TUB1	Salmonella_phage	97.0	7.6e-92
AXZ49898.1|4153253_4153550_-|holin	holin	holin	O80308	Escherichia_phage	98.0	3.7e-46
AXZ49899.1|4153553_4153757_-|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	92.5	9.8e-30
AXZ49900.1|4153756_4154263_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	100.0	2.9e-91
AXZ49901.1|4154351_4155104_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	92.3	5.0e-119
AXZ49902.1|4155107_4156175_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.4	5.8e-198
AXZ49903.1|4156251_4157106_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	75.7	2.1e-118
AXZ49904.1|4157271_4159041_+	oxidoreductase	NA	Q9T0R3	Escherichia_phage	98.1	0.0e+00
AXZ49905.1|4159040_4160087_+|portal	phage portal protein	portal	A0A0M4S6E8	Salmonella_phage	98.3	1.3e-189
AXZ49906.1|4160106_4160307_+	hypothetical protein	NA	A0A0M5M1G4	Salmonella_phage	83.7	2.0e-11
AXZ49907.1|4160220_4160403_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ49908.1|4160519_4161458_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	77.6	7.5e-141
AXZ49909.1|4161531_4161741_-	hypothetical protein	NA	Q6K1F0	Salmonella_virus	95.7	7.4e-33
AXZ49910.1|4161920_4162652_-	hypothetical protein	NA	Q37850	Escherichia_phage	95.1	2.1e-130
AXZ49911.1|4162731_4163172_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	91.2	3.5e-64
AXZ49912.1|4163288_4165535_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	92.8	0.0e+00
AXZ49913.1|4165527_4165809_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	90.3	3.4e-41
AXZ49914.1|4165805_4166102_-	hypothetical protein	NA	A0A2D1GP44	Escherichia_phage	45.5	1.8e-11
AXZ49915.1|4166102_4166324_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	91.7	2.5e-31
AXZ49916.1|4166323_4166551_-	hypothetical protein	NA	A0A218M4I9	Erwinia_phage	62.7	2.4e-16
AXZ49917.1|4166618_4166957_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	93.8	8.0e-53
AXZ49918.1|4166920_4167121_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	98.5	7.9e-32
AXZ49919.1|4167128_4167638_-	hypothetical protein	NA	Q6K1F8	Salmonella_virus	90.5	9.5e-82
AXZ49920.1|4167668_4167932_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	71.3	1.7e-29
AXZ50975.1|4168024_4168654_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.5	2.2e-64
AXZ49921.1|4168653_4169697_+|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	96.5	4.8e-197
AXZ49922.1|4170027_4170351_-	DUF1889 family protein	NA	NA	NA	NA	NA
4169762:4169809	attR	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAA	NA	NA	NA	NA
AXZ49923.1|4170460_4172275_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
AXZ49924.1|4172285_4172714_-	propanediol dehydratase small subunit PduE	NA	NA	NA	NA	NA
AXZ49925.1|4172716_4173301_-	propanediol dehydratase medium subunit PduD	NA	NA	NA	NA	NA
AXZ49926.1|4173312_4174980_-	propanediol dehydratase large subunit PduC	NA	NA	NA	NA	NA
AXZ49927.1|4175372_4175801_+	heme-binding protein	NA	NA	NA	NA	NA
AXZ49928.1|4175823_4176987_+	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
AXZ49929.1|4177003_4177357_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ49930.1|4177357_4177888_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AXZ49931.1|4177865_4179791_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXZ49932.1|4179882_4180980_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AXZ49933.1|4181541_4183200_+	glycerone kinase	NA	NA	NA	NA	NA
AXZ49934.1|4183289_4184444_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.8	1.6e-84
AXZ50976.1|4184511_4185360_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ49935.1|4185356_4186139_-	siderophore-interacting protein	NA	NA	NA	NA	NA
AXZ49936.1|4186379_4187054_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ49937.1|4187107_4188628_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	49.3	2.9e-33
AXZ49938.1|4188962_4190438_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.7	2.8e-33
AXZ49939.1|4190511_4190844_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
>prophage 12
CP032184	Citrobacter freundii strain AR_0116 chromosome, complete genome	5121015	4342742	4419881	5121015	integrase,tail,tRNA,portal,terminase,head,protease,capsid	uncultured_Caudovirales_phage(50.0%)	80	4347481:4347497	4403687:4403703
AXZ50076.1|4342742_4343246_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
AXZ50077.1|4343251_4343890_-	stringent starvation protein A	NA	NA	NA	NA	NA
AXZ50078.1|4344004_4344289_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ50079.1|4344206_4344599_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AXZ50080.1|4344614_4345043_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AXZ50081.1|4345261_4346389_-	cell division protein ZapE	NA	NA	NA	NA	NA
AXZ50981.1|4346581_4346980_+	DUF1043 family protein	NA	NA	NA	NA	NA
AXZ50082.1|4347148_4348516_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	24.9	1.6e-19
4347481:4347497	attL	TAATCAGGCGCAAAAAA	NA	NA	NA	NA
AXZ50083.1|4348605_4349673_+|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AXZ50084.1|4349729_4350665_-	malate dehydrogenase	NA	NA	NA	NA	NA
AXZ50085.1|4351101_4351572_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
AXZ50086.1|4351948_4352215_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXZ50087.1|4352272_4352551_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ50088.1|4352670_4354638_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AXZ50089.1|4354643_4355576_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AXZ50090.1|4355583_4355787_-	protein AaeX	NA	NA	NA	NA	NA
AXZ50091.1|4355971_4356901_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AXZ50982.1|4356987_4358433_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AXZ50092.1|4358594_4362410_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
AXZ50093.1|4362521_4363991_-	ribonuclease G	NA	NA	NA	NA	NA
AXZ50983.1|4363980_4364565_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AXZ50094.1|4364569_4365058_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AXZ50095.1|4365058_4366081_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AXZ50096.1|4366147_4367191_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AXZ50984.1|4367288_4367489_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ50097.1|4367497_4369438_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AXZ50098.1|4369663_4370638_+	oxidoreductase	NA	NA	NA	NA	NA
AXZ50099.1|4370757_4371762_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AXZ50100.1|4371762_4372362_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AXZ50101.1|4372754_4373225_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AXZ50102.1|4373235_4374585_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AXZ50103.1|4374692_4374935_+	DUF997 family protein	NA	NA	NA	NA	NA
AXZ50104.1|4374924_4376376_+	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AXZ50105.1|4376387_4377269_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AXZ50106.1|4377397_4378174_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
AXZ50107.1|4378472_4379438_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AXZ50108.1|4379463_4379760_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXZ50109.1|4379908_4380097_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ50985.1|4380105_4380699_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	51.8	5.9e-51
AXZ50110.1|4380731_4382393_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.3	0.0e+00
AXZ50111.1|4382376_4382733_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	95.8	4.6e-59
AXZ50112.1|4383006_4383450_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	97.3	4.4e-83
AXZ50113.1|4383449_4383743_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	97.9	4.7e-49
AXZ50114.1|4383739_4384078_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	93.8	1.6e-53
AXZ50986.1|4384074_4385292_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	94.6	6.4e-225
AXZ50115.1|4385302_4385866_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	90.3	5.0e-92
AXZ50116.1|4385858_4386422_-	HNH endonuclease	NA	A0A2I7RZ08	Vibrio_phage	42.8	2.2e-31
AXZ50117.1|4386473_4387640_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.5	1.2e-215
AXZ50118.1|4387872_4388175_-	hypothetical protein	NA	A0A2H4JB54	uncultured_Caudovirales_phage	83.2	2.2e-41
AXZ50119.1|4388511_4390644_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.4	9.2e-211
AXZ50120.1|4390643_4391009_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ50121.1|4391005_4391374_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	5.7e-52
AXZ50122.1|4391370_4391685_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ50123.1|4391677_4391866_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ50987.1|4391858_4392128_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	95.5	2.2e-45
AXZ50124.1|4392261_4392456_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AXZ50125.1|4392579_4393359_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AXZ50126.1|4393369_4393654_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXZ50127.1|4393814_4394720_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ50128.1|4394812_4396039_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.4	9.5e-152
AXZ50129.1|4396315_4397200_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	2.1e-28
AXZ50130.1|4397282_4397447_+	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
AXZ50131.1|4397492_4398149_-	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
AXZ50132.1|4398568_4399729_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXZ50133.1|4399740_4402854_+	hydrophobe/amphiphile efflux-1 family RND transporter	NA	NA	NA	NA	NA
AXZ50134.1|4403124_4403346_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ50135.1|4403806_4404832_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	9.0e-71
4403687:4403703	attR	TAATCAGGCGCAAAAAA	NA	NA	NA	NA
AXZ50136.1|4404901_4406083_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXZ50137.1|4406092_4407196_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXZ50138.1|4407203_4407962_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.1e-20
AXZ50139.1|4413717_4413930_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ50140.1|4413957_4414512_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AXZ50141.1|4414487_4414745_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AXZ50142.1|4414741_4415563_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
AXZ50143.1|4415564_4416137_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AXZ50144.1|4416141_4416684_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ50145.1|4416710_4417184_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AXZ50146.1|4417155_4418280_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AXZ50147.1|4418409_4418919_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AXZ50148.1|4418933_4419881_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.8	2.0e-08
>prophage 1
CP032179	Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence	260460	115786	154344	260460	transposase	Escherichia_phage(36.36%)	45	NA	NA
AXZ45573.1|115786_116767_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	4.0e-185
AXZ45574.1|117101_117626_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45575.1|117958_118252_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45576.1|118272_118572_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45577.1|118635_118866_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45578.1|118887_119835_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45579.1|119831_120347_-	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.9	3.2e-08
AXZ45580.1|120569_121997_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.4	9.5e-103
AXZ45581.1|122122_122293_+	hypothetical protein	NA	A0A1P7WFU2	Pectobacterium_phage	56.4	2.3e-08
AXZ45582.1|122316_123636_+	DUF1173 family protein	NA	NA	NA	NA	NA
AXZ45583.1|123649_123853_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45584.1|123907_125128_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45726.1|125130_125943_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AXZ45727.1|126443_127109_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45585.1|127146_127599_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45586.1|127710_128115_+	DNA-binding protein	NA	NA	NA	NA	NA
AXZ45587.1|128775_131784_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.2	0.0e+00
AXZ45588.1|131943_132501_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	46.1	3.8e-39
AXZ45589.1|132517_133381_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
AXZ45590.1|133421_133826_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45591.1|134102_134501_-	TIR domain-containing protein	NA	NA	NA	NA	NA
AXZ45728.1|134505_135714_-	DUF4071 domain-containing protein	NA	NA	NA	NA	NA
AXZ45592.1|136032_136593_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45593.1|136604_137054_+	DNA-binding protein	NA	NA	NA	NA	NA
AXZ45594.1|137115_137520_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45595.1|137979_138444_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
AXZ45596.1|138689_140348_-	CoA-disulfide reductase	NA	NA	NA	NA	NA
AXZ45597.1|140508_140859_+	transcriptional regulator	NA	NA	NA	NA	NA
AXZ45598.1|141150_141627_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AXZ45599.1|141741_142179_-	PaaI family thioesterase	NA	NA	NA	NA	NA
AXZ45600.1|142339_142801_-	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
AXZ45601.1|142775_143096_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
AXZ45602.1|143555_144560_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AXZ45603.1|144624_145152_-	cytochrome C	NA	NA	NA	NA	NA
AXZ45604.1|145180_145891_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
AXZ45605.1|145892_147098_-	ABC transporter permease	NA	NA	NA	NA	NA
AXZ45606.1|147094_148246_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXZ45607.1|148242_148851_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ45608.1|149038_150043_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXZ45609.1|150646_150976_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
AXZ45610.1|150956_151238_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AXZ45611.1|151515_152496_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
AXZ45612.1|152534_152660_-	ABC transporter	NA	NA	NA	NA	NA
AXZ45613.1|152812_153313_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
AXZ45614.1|153639_154344_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP032180	Citrobacter freundii strain AR_0116 plasmid unnamed2, complete sequence	137578	2186	40367	137578	transposase,integrase	Salmonella_phage(22.22%)	35	38543:38556	40493:40506
AXZ45736.1|2186_3725_+|transposase	IS66 family transposase ISKpn24	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
AXZ45737.1|4197_4524_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45738.1|4529_5108_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45739.1|5412_6144_+	complement resistance protein TraT	NA	NA	NA	NA	NA
AXZ45740.1|6533_6845_-	cytotoxic protein CcdB	NA	NA	NA	NA	NA
AXZ45741.1|6841_7090_-	post-segregation antitoxin CcdA	NA	NA	NA	NA	NA
AXZ45871.1|7301_9872_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
AXZ45742.1|9868_15292_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
AXZ45743.1|15325_16108_+	DsbA family protein	NA	NA	NA	NA	NA
AXZ45744.1|16715_17573_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AXZ45745.1|18696_18993_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45872.1|19090_19756_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
AXZ45746.1|20053_21058_-|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AXZ45747.1|21136_24109_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AXZ45748.1|24111_24669_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AXZ45749.1|24781_25021_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ45750.1|24989_26003_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ45873.1|26148_26682_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AXZ45751.1|26838_27186_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXZ45752.1|27179_28019_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXZ45753.1|27948_28128_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45754.1|28146_28647_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXZ45874.1|28822_29605_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AXZ45755.1|29594_31118_-|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AXZ45756.1|32074_33790_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ45757.1|33911_34124_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AXZ45875.1|34086_34206_+	mercury resistance protein	NA	NA	NA	NA	NA
AXZ45758.1|34189_34426_-	mercury resistance protein	NA	NA	NA	NA	NA
AXZ45759.1|34422_34788_-	transcriptional regulator	NA	NA	NA	NA	NA
AXZ45760.1|34805_36491_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
AXZ45761.1|36529_36955_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AXZ45762.1|36982_37258_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AXZ45763.1|37273_37639_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AXZ45764.1|37710_38166_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
38543:38556	attL	CATCTCAGGGGTAA	NA	NA	NA	NA
AXZ45765.1|39584_40367_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.3	2.1e-51
AXZ45765.1|39584_40367_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.3	2.1e-51
40493:40506	attR	CATCTCAGGGGTAA	NA	NA	NA	NA
>prophage 2
CP032180	Citrobacter freundii strain AR_0116 plasmid unnamed2, complete sequence	137578	66713	111534	137578	transposase	uncultured_Caudovirales_phage(17.65%)	49	NA	NA
AXZ45791.1|66713_68252_+|transposase	IS66 family transposase ISKpn24	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
AXZ45792.1|68348_68675_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXZ45793.1|68661_68841_-	antitoxin	NA	NA	NA	NA	NA
AXZ45794.1|69154_69418_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45795.1|69414_70377_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45796.1|70747_71920_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.6	5.9e-220
AXZ45797.1|71916_72717_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	96.2	2.4e-140
AXZ45798.1|72972_73161_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45799.1|73592_75029_-	glutathione synthase	NA	NA	NA	NA	NA
AXZ45800.1|75135_75507_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ45801.1|75511_75832_+	hypothetical protein	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	57.8	4.2e-19
AXZ45802.1|76050_77055_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXZ45803.1|77403_78399_-	glycosyltransferase	NA	NA	NA	NA	NA
AXZ45804.1|78459_79287_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.0	3.0e-53
AXZ45805.1|79305_80784_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.6	8.6e-200
AXZ45806.1|81209_81833_+	serine recombinase	NA	NA	NA	NA	NA
AXZ45807.1|81887_84872_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.1	7.9e-301
AXZ45808.1|84950_85955_+|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AXZ45809.1|86825_87452_+	dna-binding plasmid partition protein	NA	A0A2H4EW66	Aeromonas_phage	33.5	2.7e-22
AXZ45810.1|87493_87721_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45811.1|88242_88995_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	91.5	7.6e-128
AXZ45812.1|89440_90715_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	9.5e-155
AXZ45813.1|90714_91137_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	54.0	7.0e-30
AXZ45814.1|91428_92382_+	recombinase	NA	A0A222YXF2	Escherichia_phage	56.3	5.7e-96
AXZ45815.1|92387_92777_+	plasmid stability protein	NA	NA	NA	NA	NA
AXZ45816.1|92763_93093_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45817.1|93563_94499_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AXZ45818.1|94531_94879_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45819.1|95255_95936_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
AXZ45820.1|95935_96157_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45821.1|96201_96621_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AXZ45822.1|96673_97453_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45823.1|97851_98280_+	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	25.3	4.6e-05
AXZ45877.1|98346_98769_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AXZ45824.1|98813_99224_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45825.1|99237_99429_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45826.1|100602_100830_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45827.1|100923_101151_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45828.1|101207_102590_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AXZ45829.1|102636_103200_+	class I SAM-dependent methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	38.9	1.0e-20
AXZ45830.1|103332_103575_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45878.1|103950_104226_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45831.1|104270_104636_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ45832.1|104704_106723_+	nuclease	NA	NA	NA	NA	NA
AXZ45833.1|106758_107193_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AXZ45834.1|107189_107912_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AXZ45835.1|107914_108241_+	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	34.5	1.9e-11
AXZ45836.1|108534_109875_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXZ45837.1|110295_111534_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.4	2.4e-09
>prophage 1
CP032181	Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence	81323	0	2726	81323		Faecalibacterium_phage(100.0%)	4	NA	NA
AXZ45881.1|532_1297_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45882.1|1347_1758_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AXZ45883.1|1803_2025_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45884.1|2024_2726_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	33.8	9.6e-24
>prophage 2
CP032181	Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence	81323	6003	24748	81323	transposase,integrase	Salmonella_phage(22.22%)	14	4385:4400	27123:27138
4385:4400	attL	GCCAGCCAGCGGGTGA	NA	NA	NA	NA
AXZ45889.1|6003_6984_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	48.6	4.9e-74
AXZ45890.1|6986_7418_+	plasmid stability family protein	NA	NA	NA	NA	NA
AXZ45891.1|7451_8057_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AXZ45892.1|8151_11049_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
AXZ45893.1|11137_11758_+	serine recombinase	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
AXZ45894.1|12923_13283_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
AXZ45895.1|13786_14971_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
AXZ45896.1|15247_16567_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AXZ45897.1|16816_17698_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AXZ45898.1|17749_17989_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45899.1|17985_18765_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AXZ45900.1|18761_19787_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AXZ45901.1|19893_22923_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
AXZ45902.1|23032_24748_+|integrase	integrase	integrase	NA	NA	NA	NA
27123:27138	attR	GCCAGCCAGCGGGTGA	NA	NA	NA	NA
>prophage 3
CP032181	Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence	81323	30552	34719	81323		Wolbachia_phage(33.33%)	7	NA	NA
AXZ45965.1|30552_31095_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.3	4.2e-19
AXZ45905.1|31198_31507_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
AXZ45906.1|31503_32154_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AXZ45907.1|32209_32431_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45908.1|32480_33077_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45909.1|33243_33837_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXZ45910.1|33993_34719_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.8	5.5e-06
>prophage 4
CP032181	Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence	81323	73817	77366	81323		Escherichia_phage(33.33%)	5	NA	NA
AXZ45952.1|73817_74096_-	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AXZ45953.1|74085_74406_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	5.2e-09
AXZ45954.1|74486_74711_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45955.1|74888_75320_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AXZ45956.1|75362_77366_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	31.1	1.7e-28
>prophage 1
CP032182	Citrobacter freundii strain AR_0116 plasmid unnamed4, complete sequence	49806	0	48917	49806	head,tail,terminase,portal,capsid	Klebsiella_phage(49.12%)	63	NA	NA
AXZ45974.1|856_1180_-|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	89.7	6.1e-50
AXZ45975.1|1425_1626_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	89.4	2.6e-11
AXZ45976.1|1622_1985_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	88.3	1.8e-58
AXZ45977.1|1968_2592_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45978.1|2742_3753_-	DNA cytosine methyltransferase	NA	O64366	Escherichia_phage	77.3	8.6e-151
AXZ45979.1|3764_4070_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2I6TCY5	Escherichia_phage	84.0	7.8e-47
AXZ45980.1|4338_4803_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	82.2	2.2e-61
AXZ45981.1|4822_5311_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	86.4	1.6e-78
AXZ45982.1|5307_5619_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	82.0	2.1e-39
AXZ45983.1|5681_6752_-	site-specific DNA-methyltransferase	NA	A0A2I6TC96	Escherichia_phage	84.3	1.4e-162
AXZ45984.1|7017_7245_-	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	76.0	1.2e-23
AXZ45985.1|7256_7478_-	hypothetical protein	NA	O64358	Escherichia_phage	90.4	5.1e-32
AXZ45986.1|7669_7852_+	mRNA interferase	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	53.3	8.5e-09
AXZ45987.1|7894_8329_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	74.1	4.3e-51
AXZ46031.1|8374_8590_-	hypothetical protein	NA	Q6UAT5	Klebsiella_phage	67.2	6.5e-16
AXZ45988.1|8693_8915_-	hypothetical protein	NA	O64355	Escherichia_phage	76.7	3.5e-25
AXZ45989.1|8935_9262_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	82.4	1.6e-45
AXZ46032.1|10301_10733_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	64.8	8.2e-42
AXZ45990.1|10932_11250_-	hypothetical protein	NA	A0A1Q1PUP2	Escherichia_phage	80.0	2.3e-17
AXZ45991.1|11246_11492_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45992.1|11743_12046_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.9	1.7e-33
AXZ46033.1|12039_12270_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	86.7	3.0e-27
AXZ45993.1|12275_12524_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ45994.1|12524_13139_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	68.0	9.8e-73
AXZ45995.1|13141_13342_-	hypothetical protein	NA	O21966	Escherichia_phage	64.1	1.9e-17
AXZ45996.1|13551_14289_-	phage antitermination protein	NA	Q6UAU4	Klebsiella_phage	74.7	4.1e-102
AXZ45997.1|14275_14491_-	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	87.9	1.1e-26
AXZ45998.1|14571_15180_+	XRE family transcriptional regulator	NA	Q37962	Escherichia_phage	92.1	9.6e-105
AXZ45999.1|15430_19435_+	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	83.2	0.0e+00
AXZ46000.1|19427_19634_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ46001.1|19620_19947_+	hypothetical protein	NA	O64345	Escherichia_phage	68.2	1.1e-38
AXZ46002.1|19953_20469_+	hypothetical protein	NA	Q6UAU9	Klebsiella_phage	74.7	1.5e-66
AXZ46003.1|20465_20801_+	hypothetical protein	NA	Q6UAV0	Klebsiella_phage	91.0	1.2e-56
AXZ46004.1|20877_21444_-	serine acetyltransferase	NA	NA	NA	NA	NA
AXZ46034.1|21862_22027_+	host cell division inhibitor Icd-like protein	NA	Q77WP0	Escherichia_phage	90.4	1.0e-16
AXZ46005.1|22023_22254_+	hypothetical protein	NA	A0A2I6TCC2	Escherichia_phage	65.7	1.3e-14
AXZ46006.1|22250_23024_+	hypothetical protein	NA	O64341	Escherichia_phage	75.8	5.6e-110
AXZ46007.1|23196_25113_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	84.1	3.9e-293
AXZ46008.1|25801_26965_+	plasmid-partitioning protein SopA	NA	O03951	Escherichia_phage	95.3	3.2e-218
AXZ46009.1|26967_27939_+	ParB/RepB/Spo0J family plasmid partition protein	NA	O64340	Escherichia_phage	80.5	8.0e-146
AXZ46010.1|28144_28654_+	sugar O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	33.0	1.0e-06
AXZ46011.1|28655_29240_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	56.2	3.8e-58
AXZ46012.1|29239_29851_-|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	72.7	1.2e-75
AXZ46013.1|29847_32595_-	hypothetical protein	NA	A0A077SK37	Escherichia_phage	37.4	4.2e-75
AXZ46014.1|32635_36040_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	70.2	0.0e+00
AXZ46015.1|36112_36790_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	70.2	5.9e-79
AXZ46016.1|36687_37422_-|tail	phage tail protein	tail	A5LH41	Enterobacteria_phage	76.6	2.7e-114
AXZ46017.1|37433_38129_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	72.7	8.4e-97
AXZ46018.1|38137_38470_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.9	2.4e-41
AXZ46019.1|38470_41773_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	65.8	0.0e+00
AXZ46035.1|41772_42003_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	61.8	1.9e-21
AXZ46020.1|42023_42386_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	58.5	5.1e-29
AXZ46021.1|42448_42931_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	79.9	1.4e-61
AXZ46022.1|42964_43366_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	87.2	1.5e-58
AXZ46023.1|43362_43752_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	66.1	3.0e-43
AXZ46024.1|43720_44071_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	74.8	3.2e-44
AXZ46036.1|44067_44385_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.1e-39
AXZ46025.1|44365_44737_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	59.5	3.2e-18
AXZ46026.1|44834_46121_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	90.4	7.5e-216
AXZ46027.1|46193_47111_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	79.9	7.4e-133
AXZ46028.1|47098_47446_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ46029.1|47478_48738_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	2.0e-221
AXZ46030.1|48737_48917_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	72.9	5.1e-14
>prophage 1
CP032183	Citrobacter freundii strain AR_0116 plasmid unnamed5, complete sequence	121983	0	37118	121983	terminase,capsid,tail	Salmonella_phage(100.0%)	52	NA	NA
AXZ46037.1|67_799_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	3.9e-137
AXZ46038.1|855_1191_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	100.0	1.4e-60
AXZ46039.1|1232_5804_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	90.6	0.0e+00
AXZ46040.1|5811_6081_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AXZ46041.1|6161_6479_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AXZ46042.1|6538_7285_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	98.0	2.0e-128
AXZ46043.1|7359_7743_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AXZ46044.1|7744_8218_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	6.8e-82
AXZ46045.1|8208_8553_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AXZ46046.1|8650_9484_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	98.6	9.3e-151
AXZ46047.1|9483_9918_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AXZ46048.1|10221_11097_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	100.0	3.8e-163
AXZ46049.1|11123_12017_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	91.9	3.4e-135
AXZ46050.1|12039_13614_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	7.1e-301
AXZ46051.1|13647_14904_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
AXZ46052.1|14906_15548_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.1	5.2e-109
AXZ46053.1|15743_16010_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AXZ46054.1|16019_16919_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	8.2e-169
AXZ46055.1|16915_17170_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	9.0e-41
AXZ46056.1|17162_17801_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	99.5	1.1e-111
AXZ46057.1|17797_18466_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AXZ46058.1|18465_19164_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	98.7	3.6e-124
AXZ46059.1|19228_20788_+	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	99.4	1.3e-294
AXZ46060.1|20790_21069_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AXZ46061.1|21128_21551_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	2.4e-62
AXZ46062.1|21555_22083_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	99.3	2.6e-82
AXZ46063.1|22406_23057_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.1	1.2e-113
AXZ46064.1|23107_23311_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	100.0	1.3e-29
AXZ46065.1|23955_24438_-	hypothetical protein	NA	J9Q805	Salmonella_phage	95.0	5.1e-85
AXZ46066.1|24450_24684_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ46176.1|24643_24931_-	ABC transporter	NA	J9Q753	Salmonella_phage	98.9	1.6e-49
AXZ46067.1|25052_25448_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	99.2	3.3e-66
AXZ46068.1|25575_25887_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	97.1	1.6e-47
AXZ46069.1|26027_26246_-	hypothetical protein	NA	J9Q804	Salmonella_phage	97.2	1.8e-34
AXZ46070.1|26256_26472_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	100.0	6.3e-35
AXZ46177.1|27383_27575_+	hypothetical protein	NA	J9Q7T6	Salmonella_phage	85.7	2.9e-23
AXZ46071.1|28069_28630_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ46178.1|28758_29034_-	hypothetical protein	NA	J9Q750	Salmonella_phage	98.9	6.8e-50
AXZ46072.1|29033_29270_-	DUF1380 domain-containing protein	NA	J9Q7H8	Salmonella_phage	98.7	4.2e-40
AXZ46073.1|29355_29622_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	97.7	2.8e-45
AXZ46074.1|29809_30013_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	97.0	6.8e-31
AXZ46075.1|30068_30758_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	87.5	3.3e-109
AXZ46076.1|30796_31348_-	hypothetical protein	NA	J9Q748	Salmonella_phage	92.9	1.0e-97
AXZ46077.1|32175_32376_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ46078.1|32385_32706_-	hypothetical protein	NA	J9Q750	Salmonella_phage	68.9	3.9e-41
AXZ46079.1|32776_33004_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ46080.1|33077_33692_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ46081.1|33733_33913_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ46082.1|33921_35595_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	72.3	8.7e-241
AXZ46083.1|35735_36308_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.4	1.5e-96
AXZ46084.1|36425_36614_-	hypothetical protein	NA	J9Q800	Salmonella_phage	96.8	2.3e-25
AXZ46085.1|36623_37118_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	97.6	7.8e-81
>prophage 2
CP032183	Citrobacter freundii strain AR_0116 plasmid unnamed5, complete sequence	121983	40985	121273	121983	integrase,transposase,tail	Salmonella_phage(85.33%)	94	41370:41395	106273:106298
AXZ46088.1|40985_41216_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
41370:41395	attL	TATTTATATATACGGAAGCAGGTTCT	NA	NA	NA	NA
AXZ46089.1|41418_42012_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	100.0	2.1e-112
AXZ46090.1|42197_43124_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.0	3.1e-107
AXZ46091.1|43168_43726_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	98.9	2.0e-101
AXZ46092.1|43735_44155_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
AXZ46093.1|44218_44863_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AXZ46094.1|44862_45339_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	99.4	8.9e-90
AXZ46095.1|45335_45749_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AXZ46096.1|45750_46866_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.9	2.4e-218
AXZ46097.1|47043_47913_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	98.3	3.9e-160
AXZ46098.1|47995_49138_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
AXZ46099.1|49245_51561_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AXZ46100.1|51638_52208_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	98.9	8.4e-103
AXZ46101.1|52219_52966_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.8	2.6e-136
AXZ46102.1|52955_54872_-	exonuclease	NA	J9Q741	Salmonella_phage	98.9	0.0e+00
AXZ46103.1|54868_55105_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AXZ46104.1|55101_56187_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	98.6	1.0e-205
AXZ46105.1|56362_56857_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	98.8	2.7e-89
AXZ46106.1|56932_57577_-	hypothetical protein	NA	J9Q739	Salmonella_phage	99.1	2.2e-123
AXZ46107.1|58321_59386_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	100.0	1.5e-190
AXZ46108.1|59995_60208_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
AXZ46109.1|60207_60543_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	95.5	4.2e-54
AXZ46110.1|60539_60719_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	96.6	9.5e-21
AXZ46111.1|60759_61035_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.4e-47
AXZ46112.1|61103_61514_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	9.1e-75
AXZ46113.1|61497_61869_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AXZ46114.1|62019_64362_-	intein-containing recombinase RecA	NA	J9Q736	Salmonella_phage	87.8	6.0e-30
AXZ46115.1|64364_64631_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AXZ46116.1|64630_65575_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.7	4.0e-182
AXZ46117.1|65635_66664_-	regulator	NA	J9Q7Z3	Salmonella_phage	99.7	1.3e-165
AXZ46118.1|66783_67215_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	99.3	4.4e-72
AXZ46180.1|67472_67697_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ46119.1|67778_68336_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	70.9	8.9e-65
AXZ46120.1|68401_69046_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ46121.1|69084_69528_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	99.3	3.9e-71
AXZ46122.1|69524_70694_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	95.1	1.3e-211
AXZ46123.1|70715_71417_-	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	36.5	1.9e-19
AXZ46124.1|71413_73777_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.4	0.0e+00
AXZ46125.1|73751_73955_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	100.0	5.5e-33
AXZ46126.1|73957_75193_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.8	6.0e-239
AXZ46127.1|75289_77662_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	93.7	0.0e+00
AXZ46128.1|77771_77984_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ46129.1|78247_78634_+	transcriptional regulator	NA	NA	NA	NA	NA
AXZ46130.1|78625_79732_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	32.2	2.8e-25
AXZ46131.1|79903_80320_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ46132.1|80310_80835_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ46133.1|80931_81177_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.0e-12
AXZ46134.1|81176_81542_-	hypothetical protein	NA	K7PH35	Enterobacteria_phage	66.4	5.1e-37
AXZ46135.1|81557_81761_-	hypothetical protein	NA	A0A2P1CDD4	Klebsiella_phage	50.7	5.6e-09
AXZ46136.1|81771_82545_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	63.6	4.7e-88
AXZ46137.1|82825_83830_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXZ46138.1|83908_84721_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	78.4	3.0e-37
AXZ46139.1|84885_86601_+|transposase	transposase	transposase	NA	NA	NA	NA
AXZ46140.1|87557_89081_+|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AXZ46181.1|89070_89853_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AXZ46141.1|90028_90529_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXZ46142.1|90547_90727_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ46143.1|90656_91496_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXZ46144.1|91489_91837_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXZ46182.1|91993_92527_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AXZ46145.1|92672_93686_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ46146.1|93624_93930_+|transposase	transposase	transposase	NA	NA	NA	NA
AXZ46147.1|94141_94498_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXZ46148.1|94752_95079_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ46149.1|95075_95576_+|transposase	transposase	transposase	NA	NA	NA	NA
AXZ46150.1|95572_95944_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ46151.1|95937_96495_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AXZ46152.1|96573_97578_+|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AXZ46153.1|99055_99409_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	99.0	2.8e-48
AXZ46154.1|99405_99558_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	98.0	8.9e-20
AXZ46183.1|99557_99764_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	6.2e-32
AXZ46155.1|99753_99930_-	hypothetical protein	NA	J9Q729	Salmonella_phage	96.6	2.6e-23
AXZ46156.1|99929_101252_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.1	2.4e-257
AXZ46184.1|101286_101544_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	97.6	4.0e-36
AXZ46185.1|101454_101796_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ46157.1|101844_102639_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	97.0	9.8e-142
AXZ46158.1|102719_103931_-	DNA primase	NA	J9Q720	Salmonella_phage	97.3	4.6e-215
AXZ46159.1|103993_105334_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	99.8	1.3e-247
AXZ46160.1|105394_106120_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	99.6	2.6e-141
AXZ46161.1|106316_107075_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	98.4	8.7e-148
106273:106298	attR	TATTTATATATACGGAAGCAGGTTCT	NA	NA	NA	NA
AXZ46162.1|107120_107480_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.9e-45
AXZ46163.1|107479_108145_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	99.5	1.4e-117
AXZ46186.1|108299_109001_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	99.6	5.4e-136
AXZ46164.1|109033_109456_-	hypothetical protein	NA	J9Q6E9	Salmonella_phage	100.0	5.7e-72
AXZ46165.1|109641_109989_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	98.7	4.1e-36
AXZ46166.1|110057_110750_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	100.0	1.3e-129
AXZ46167.1|110762_111086_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	100.0	1.9e-51
AXZ46168.1|111178_111412_-	hypothetical protein	NA	J9Q714	Salmonella_phage	100.0	1.0e-38
AXZ46169.1|111423_112032_-	hypothetical protein	NA	J9Q7G0	Salmonella_phage	100.0	1.4e-103
AXZ46170.1|112031_112286_-	hypothetical protein	NA	J9Q7R5	Salmonella_phage	95.2	2.4e-41
AXZ46171.1|112374_112866_-|tail	putative receptor-recognizing phage tail fiber adhesin	tail	J9Q7Y6	Salmonella_phage	98.8	1.4e-85
AXZ46172.1|112865_116420_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	64.4	2.0e-250
AXZ46173.1|116507_120665_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	99.6	0.0e+00
AXZ46174.1|120682_121273_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	100.0	2.1e-109
