The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032178	Klebsiella pneumoniae strain AR_0135 chromosome, complete genome	5425436	30247	38626	5425436		Escherichia_phage(28.57%)	7	NA	NA
AXZ29951.1|30247_31252_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
AXZ29952.1|32199_33366_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AXZ29953.1|33545_34100_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
AXZ29954.1|34114_35005_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AXZ29955.1|35036_35906_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
AXZ29956.1|35932_36997_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
AXZ29957.1|37219_38626_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.8e-37
>prophage 2
CP032178	Klebsiella pneumoniae strain AR_0135 chromosome, complete genome	5425436	420449	494939	5425436	protease,terminase,transposase,holin,capsid,tRNA,tail,integrase	Salmonella_phage(40.82%)	81	426092:426109	493928:493945
AXZ30268.1|420449_422453_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
AXZ30269.1|422462_423338_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
AXZ30270.1|423457_424171_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
AXZ30271.1|424387_425422_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AXZ30272.1|425438_426317_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
426092:426109	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
AXZ30273.1|426404_427037_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
AXZ30274.1|427040_427511_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
AXZ30275.1|427572_428634_-	AI-2E family transporter	NA	NA	NA	NA	NA
AXZ30276.1|428856_430320_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AXZ30277.1|430329_430689_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AXZ30278.1|430817_431729_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
AXZ30279.1|431725_432427_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AXZ30280.1|432525_433812_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
AXZ30281.1|433907_434534_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AXZ30282.1|434751_436185_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AXZ30283.1|436194_437088_-	ROK family protein	NA	NA	NA	NA	NA
AXZ30284.1|437351_438389_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
AXZ30285.1|438385_439027_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
AXZ30286.1|439207_441268_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AXZ30287.1|441271_442804_+	exopolyphosphatase	NA	NA	NA	NA	NA
AXZ30288.1|442857_445086_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AXZ30289.1|445438_445630_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
AXZ30290.1|445726_446614_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ30291.1|446711_447944_+	MFS transporter	NA	NA	NA	NA	NA
AXZ30292.1|448237_449416_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AXZ30293.1|449399_451268_+	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
AXZ30294.1|451454_451955_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	90.0	1.1e-69
AXZ30295.1|451951_452581_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	78.4	1.5e-92
AXZ30296.1|452570_452876_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	4.6e-39
AXZ30297.1|452862_453267_-	hypothetical protein	NA	T1SA79	Salmonella_phage	82.6	2.1e-55
AXZ30298.1|453379_453655_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ30299.1|456323_456620_+	hypothetical protein	NA	T1SA06	Salmonella_phage	62.7	1.2e-23
AXZ30300.1|456833_457667_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ30301.1|458156_458846_+	anti-repressor protein	NA	A0A193GYJ9	Enterobacter_phage	58.5	9.9e-74
AXZ30302.1|458997_459186_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ30303.1|459187_459523_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ30304.1|459615_459768_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	5.6e-14
AXZ30305.1|459803_460418_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ30306.1|460427_463817_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	2.4e-120
AXZ30307.1|463816_466561_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.7	3.9e-97
AXZ30308.1|466573_467071_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	8.9e-24
AXZ30309.1|467063_467534_-	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	9.5e-44
AXZ30310.1|467535_470013_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.4	2.3e-266
AXZ30311.1|470012_470624_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
AXZ30312.1|470672_470951_-	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
AXZ30313.1|470943_471336_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
AXZ30314.1|471345_472353_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.8	2.1e-181
AXZ34910.1|472365_472764_-	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
AXZ30315.1|473045_473351_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
AXZ30316.1|473347_475027_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
AXZ30317.1|475030_475234_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ30318.1|475255_475444_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ30319.1|475780_475981_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ30320.1|476031_476403_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	93.5	6.8e-61
AXZ30321.1|476445_477921_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.4	2.4e-279
AXZ30322.1|477917_478502_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	9.9e-91
AXZ30323.1|478579_478837_-	lF-82	NA	NA	NA	NA	NA
AXZ30324.1|478911_479250_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	79.1	3.1e-44
AXZ30325.1|479249_479489_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	8.6e-09
AXZ34911.1|480182_480446_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	65.5	3.5e-27
AXZ30326.1|480445_480700_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34912.1|480696_480906_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34913.1|480977_481379_-	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	51.6	8.7e-22
AXZ30327.1|481571_481919_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	81.7	1.9e-49
AXZ30328.1|482038_482824_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AXZ30329.1|482820_483588_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
AXZ30330.1|483587_483797_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AXZ30331.1|483943_484177_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AXZ30332.1|484331_484913_+	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
AXZ30333.1|485279_485579_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AXZ30334.1|485575_486475_+	endonuclease	NA	Q858E0	Salmonella_phage	91.0	6.5e-158
AXZ30335.1|486484_487507_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	4.0e-180
AXZ30336.1|487557_487806_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
AXZ30337.1|487915_488209_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
AXZ30338.1|488201_488360_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.8	8.7e-18
AXZ30339.1|488356_488863_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ30340.1|488859_489462_+	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	92.4	4.0e-103
AXZ30341.1|489458_490121_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	75.5	4.7e-97
AXZ30342.1|490382_491636_-|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	83.6	3.5e-202
AXZ30343.1|491827_493405_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AXZ30344.1|493472_494939_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.5e-87
493928:493945	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
>prophage 3
CP032178	Klebsiella pneumoniae strain AR_0135 chromosome, complete genome	5425436	502935	517740	5425436	tail,integrase	Salmonella_phage(22.22%)	20	510079:510093	518566:518580
AXZ30357.1|502935_505734_-|tail	tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	32.4	7.7e-48
AXZ30358.1|505741_506068_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ30359.1|506362_506740_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	44.7	1.1e-21
AXZ30360.1|506769_507153_-	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	45.4	2.1e-17
AXZ30361.1|507159_507432_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AXZ30362.1|507445_507892_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AXZ30363.1|507888_508287_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ30364.1|508594_511045_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.0	1.1e-138
510079:510093	attL	CGTGCTGCTGGTGAT	NA	NA	NA	NA
AXZ30365.1|511037_511388_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	69.1	8.9e-39
AXZ30366.1|511397_512024_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.8e-26
AXZ30367.1|512020_512230_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ30368.1|512226_512730_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34915.1|512726_512906_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34914.1|512898_513093_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AXZ30369.1|513739_513919_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AXZ30370.1|513911_514721_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	54.5	3.5e-30
AXZ30371.1|514734_515166_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.9	3.1e-25
AXZ30372.1|515165_515384_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXZ30373.1|515510_516464_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34916.1|516471_517740_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.8	3.3e-147
518566:518580	attR	ATCACCAGCAGCACG	NA	NA	NA	NA
>prophage 4
CP032178	Klebsiella pneumoniae strain AR_0135 chromosome, complete genome	5425436	586317	680589	5425436	plate,portal,capsid,tRNA,holin,tail,lysis,integrase,head	Salmonella_phage(69.81%)	99	631046:631092	666338:666384
AXZ30433.1|586317_587055_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AXZ30434.1|587186_588518_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
AXZ30435.1|588563_588947_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AXZ30436.1|589259_589949_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AXZ30437.1|590007_591093_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AXZ30438.1|591296_591722_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AXZ30439.1|591791_592490_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AXZ30440.1|592524_595176_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AXZ30441.1|595296_596652_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXZ30442.1|596693_597017_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
AXZ30443.1|597020_598319_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.3	1.2e-43
AXZ30444.1|604318_606892_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	9.0e-128
AXZ30445.1|607021_607753_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AXZ30446.1|607749_608730_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AXZ30447.1|608861_609599_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AXZ30448.1|609869_610205_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AXZ34918.1|610311_610359_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ30449.1|610459_611620_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AXZ30450.1|611616_612489_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AXZ30451.1|612551_613673_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AXZ30452.1|613682_614753_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AXZ30453.1|615095_615605_+	YfiR family protein	NA	NA	NA	NA	NA
AXZ30454.1|615597_616821_+	diguanylate cyclase	NA	NA	NA	NA	NA
AXZ30455.1|616834_617317_+	OmpA family protein	NA	NA	NA	NA	NA
AXZ30456.1|617325_618696_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AXZ30457.1|618752_619211_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AXZ30458.1|619330_619678_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AXZ30459.1|619717_620485_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AXZ30460.1|620516_621065_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXZ30461.1|621083_621332_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXZ30462.1|621591_622956_-	signal recognition particle protein	NA	NA	NA	NA	NA
AXZ30463.1|623119_623911_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AXZ30464.1|623930_625217_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AXZ30465.1|625337_625928_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXZ30466.1|626052_626931_+	NAD(+) kinase	NA	NA	NA	NA	NA
AXZ30467.1|627017_628679_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AXZ30468.1|628826_629168_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXZ30469.1|629234_629525_-	RnfH family protein	NA	NA	NA	NA	NA
AXZ30470.1|629514_629991_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AXZ30471.1|630101_630584_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
631046:631092	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
AXZ30472.1|631198_631972_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AXZ30473.1|632375_632594_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AXZ30474.1|632684_633785_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	86.9	4.2e-175
AXZ30475.1|633781_634267_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
AXZ30476.1|634263_637341_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.3	0.0e+00
AXZ30477.1|637333_637453_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AXZ30478.1|637467_637770_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AXZ30479.1|637824_638340_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
AXZ30480.1|638349_639522_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	89.2	2.5e-202
AXZ30481.1|639664_640231_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	85.2	2.1e-85
AXZ34919.1|640894_641047_+	hypothetical protein	NA	U5P083	Shigella_phage	71.1	5.8e-11
AXZ30482.1|641027_641210_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ30483.1|641209_642931_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.9	1.7e-151
AXZ30484.1|642927_643533_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
AXZ30485.1|643525_644434_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
AXZ30486.1|644420_644780_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
AXZ30487.1|644776_645355_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
AXZ30488.1|645481_646993_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ30489.1|647080_647545_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	5.5e-60
AXZ30490.1|647537_647969_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
AXZ30491.1|647931_648135_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	79.1	4.7e-24
AXZ30492.1|648064_648493_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.5e-59
AXZ30493.1|648489_649005_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.8	4.0e-88
AXZ30494.1|648985_649201_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AXZ30495.1|649204_649408_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	5.2e-31
AXZ30496.1|649407_649872_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.1e-76
AXZ30497.1|649967_650618_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AXZ30498.1|650621_651680_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.9e-180
AXZ30499.1|651696_652530_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AXZ30500.1|652672_654439_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
AXZ30501.1|654438_655473_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.3	5.9e-171
AXZ30502.1|655524_656676_-	TIGR02391 family protein	NA	NA	NA	NA	NA
AXZ30503.1|656954_657632_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ30504.1|657746_658052_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AXZ34920.1|657990_658179_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AXZ30505.1|658332_660747_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.6	0.0e+00
AXZ30506.1|660743_661601_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	1.1e-159
AXZ30507.1|661597_661825_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	3.0e-35
AXZ30508.1|661824_662058_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	1.2e-31
AXZ30509.1|662125_662467_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	97.3	1.7e-55
AXZ30510.1|662430_662631_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
AXZ30511.1|662638_663148_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	94.7	3.9e-83
AXZ30512.1|663180_663423_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
AXZ30513.1|663539_664172_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	57.1	3.8e-64
AXZ30514.1|664175_665216_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
AXZ30515.1|665205_666252_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ30516.1|666548_667796_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	61.8	8.5e-140
666338:666384	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
AXZ30517.1|667797_668445_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ30518.1|668633_672437_+	DNA-binding protein	NA	NA	NA	NA	NA
AXZ30519.1|672918_673134_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AXZ30520.1|673169_675239_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	8.7e-73
AXZ30521.1|675557_675914_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXZ30522.1|676008_676293_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	4.6e-17
AXZ30523.1|676405_676927_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
AXZ30524.1|676923_677298_+	PTS sorbitol transporter	NA	NA	NA	NA	NA
AXZ30525.1|677294_678275_+	PTS sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
AXZ30526.1|678285_679299_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AXZ30527.1|679739_679946_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	55.3	7.4e-09
AXZ30528.1|680343_680589_+|holin	holin	holin	S4TNY4	Salmonella_phage	71.8	2.7e-26
>prophage 5
CP032178	Klebsiella pneumoniae strain AR_0135 chromosome, complete genome	5425436	3137280	3192566	5425436	protease,terminase,holin,tRNA,coat,tail,integrase,head	Cronobacter_phage(26.42%)	78	3149990:3150035	3195568:3195613
AXZ32776.1|3137280_3137907_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
AXZ32777.1|3137874_3138561_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
AXZ32778.1|3138557_3140972_+	ABC transporter permease	NA	NA	NA	NA	NA
AXZ32779.1|3141153_3142299_+	porin	NA	NA	NA	NA	NA
AXZ32780.1|3142406_3143483_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AXZ32781.1|3143594_3144662_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AXZ32782.1|3144658_3145168_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AXZ32783.1|3145100_3145268_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ32784.1|3145264_3145603_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ32785.1|3145710_3146433_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AXZ32786.1|3146436_3146931_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
AXZ32787.1|3147106_3148492_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AXZ32788.1|3148537_3148750_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AXZ32789.1|3148751_3149618_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AXZ32790.1|3149656_3149980_+	hypothetical protein	NA	NA	NA	NA	NA
3149990:3150035	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCAT	NA	NA	NA	NA
AXZ35016.1|3150049_3151093_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	85.9	2.2e-178
AXZ32791.1|3151089_3151425_-	DNA-binding protein	NA	NA	NA	NA	NA
AXZ32792.1|3151426_3151645_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
AXZ32793.1|3151641_3152346_-	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	34.3	1.0e-25
AXZ32794.1|3152342_3152615_-	hypothetical protein	NA	Q716F1	Shigella_phage	63.5	3.7e-24
AXZ32795.1|3152611_3152833_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ32796.1|3152829_3153966_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	73.1	7.4e-159
AXZ32797.1|3153962_3154619_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	2.7e-113
AXZ32798.1|3154615_3154921_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXZ32799.1|3154955_3155438_-	hypothetical protein	NA	G8C7S9	Escherichia_phage	92.5	3.1e-74
AXZ32800.1|3155434_3156349_-	DNA recombinase	NA	G8C7T0	Escherichia_phage	91.4	1.0e-158
AXZ32801.1|3156358_3156643_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	3.3e-39
AXZ32802.1|3156724_3156931_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
AXZ32803.1|3157642_3158470_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AXZ32804.1|3158466_3159216_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ32805.1|3159313_3160036_-	helix-turn-helix domain-containing protein	NA	E7C9R0	Salmonella_phage	62.8	6.1e-74
AXZ32806.1|3160104_3160332_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	5.6e-18
AXZ32807.1|3160372_3160594_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AXZ32808.1|3160818_3161718_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	55.6	8.4e-89
AXZ32809.1|3161707_3163138_+	helicase DnaB	NA	Q9MCT4	Escherichia_phage	66.3	4.9e-184
AXZ32810.1|3163137_3163431_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
AXZ35017.1|3163433_3163880_+	hypothetical protein	NA	K7P858	Enterobacteria_phage	42.8	4.1e-20
AXZ32811.1|3163876_3164122_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ32812.1|3164582_3164771_+	diguanylate phosphodiesterase	NA	A0A192Y8X2	Salmonella_phage	88.7	3.7e-23
AXZ35018.1|3165237_3165696_+	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	91.5	2.5e-28
AXZ32813.1|3165688_3165970_+	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	40.2	1.0e-05
AXZ32814.1|3166221_3166677_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.2	1.5e-54
AXZ32815.1|3166676_3166847_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
AXZ32816.1|3166839_3167478_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	65.1	2.8e-70
AXZ32817.1|3167474_3168116_+	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	40.7	8.4e-35
AXZ32818.1|3168112_3168253_+	YlcG family protein	NA	NA	NA	NA	NA
AXZ32819.1|3168249_3168939_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	1.0e-57
AXZ32820.1|3169376_3169916_+	HNH endonuclease	NA	A5PJ37	Escherichia_virus	46.1	2.1e-34
AXZ32821.1|3170135_3170405_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
AXZ35019.1|3170382_3170880_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	83.0	4.8e-78
AXZ32822.1|3170876_3171227_+	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	42.9	7.6e-14
AXZ32823.1|3171664_3172267_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	78.7	3.1e-79
AXZ32824.1|3172266_3173739_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	6.9e-250
AXZ32825.1|3173751_3175221_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	1.2e-148
AXZ32826.1|3175147_3176152_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.7	1.9e-113
AXZ32827.1|3176253_3176934_+	HNH endonuclease	NA	S5M802	Pseudoalteromonas_phage	38.3	9.6e-37
AXZ32828.1|3177000_3178386_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.0	7.6e-166
AXZ32829.1|3178389_3178821_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.1	1.4e-41
AXZ32830.1|3178832_3179930_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	73.6	4.2e-151
AXZ32831.1|3179939_3180242_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ32832.1|3180244_3180625_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
AXZ32833.1|3180624_3180798_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	2.4e-13
AXZ32834.1|3180797_3181160_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	48.3	1.6e-19
AXZ32835.1|3181162_3181531_+	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	82.8	2.9e-48
AXZ32836.1|3181527_3181911_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	48.0	3.5e-28
AXZ32837.1|3181913_3182135_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ32838.1|3183026_3183740_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	2.1e-63
AXZ32839.1|3183956_3184487_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	92.0	7.8e-87
AXZ35020.1|3184659_3184911_+	hypothetical protein	NA	H6WRV3	Salmonella_phage	62.7	2.8e-26
AXZ32840.1|3184922_3185255_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ32841.1|3185251_3185725_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ32842.1|3185769_3188187_+|tail	phage tail protein	tail	F1C5E9	Cronobacter_phage	62.7	8.3e-208
AXZ32843.1|3188227_3188407_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AXZ32844.1|3188386_3188650_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AXZ35021.1|3188820_3189240_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	5.3e-30
AXZ32845.1|3189239_3189710_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
AXZ32846.1|3189706_3190102_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	3.6e-36
AXZ32847.1|3190088_3192566_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	2.6e-196
3195568:3195613	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCAT	NA	NA	NA	NA
>prophage 6
CP032178	Klebsiella pneumoniae strain AR_0135 chromosome, complete genome	5425436	3668871	3678345	5425436	protease,tRNA	Dickeya_phage(16.67%)	9	NA	NA
AXZ33258.1|3668871_3669987_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AXZ33259.1|3669983_3671924_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AXZ33260.1|3671863_3672046_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ33261.1|3672000_3672222_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXZ33262.1|3672547_3672865_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXZ33263.1|3672895_3675175_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXZ33264.1|3675305_3675524_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXZ33265.1|3675877_3676579_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXZ33266.1|3676623_3678345_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 7
CP032178	Klebsiella pneumoniae strain AR_0135 chromosome, complete genome	5425436	4383153	4394040	5425436		Escherichia_phage(87.5%)	9	NA	NA
AXZ33902.1|4383153_4383774_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AXZ33903.1|4383766_4385032_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
AXZ33904.1|4385043_4385946_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AXZ33905.1|4386206_4386968_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXZ33906.1|4386988_4387849_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AXZ33907.1|4388146_4388407_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AXZ33908.1|4388493_4389582_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AXZ33909.1|4389612_4390878_-	MFS transporter	NA	NA	NA	NA	NA
AXZ33910.1|4390932_4394040_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 8
CP032178	Klebsiella pneumoniae strain AR_0135 chromosome, complete genome	5425436	4402011	4427384	5425436	transposase,integrase	Escherichia_phage(33.33%)	31	4401949:4402008	4423801:4424620
4401949:4402008	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AXZ33918.1|4402011_4402716_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ35080.1|4403888_4404014_+	mercury transporter	NA	NA	NA	NA	NA
AXZ35079.1|4404049_4404472_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AXZ33919.1|4404523_4406218_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AXZ33920.1|4406235_4406598_+	transcriptional regulator	NA	NA	NA	NA	NA
AXZ33921.1|4406594_4406831_+	mercury resistance protein	NA	NA	NA	NA	NA
AXZ33922.1|4406827_4407535_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXZ33923.1|4407573_4409289_+|transposase	transposase	transposase	NA	NA	NA	NA
AXZ33924.1|4409291_4410191_+|transposase	transposase	transposase	NA	NA	NA	NA
AXZ33925.1|4410247_4410748_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXZ33926.1|4410766_4410946_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ33927.1|4410875_4411715_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AXZ33928.1|4411708_4412056_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXZ33929.1|4412224_4412857_-	type B-2 chloramphenicol O-acetyltransferase CatB2	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	44.4	4.1e-26
AXZ33930.1|4412909_4413701_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AXZ33931.1|4413817_4414612_-	aminoglycoside O-phosphotransferase APH(3')-XV	NA	Q75ZG1	Hepacivirus	39.4	1.3e-40
AXZ33932.1|4414682_4415237_-	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
AXZ33933.1|4415344_4416145_-	subclass B1 metallo-beta-lactamase VIM-1	NA	NA	NA	NA	NA
AXZ33934.1|4416311_4417325_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ33935.1|4417738_4418275_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ33936.1|4418286_4418682_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXZ33937.1|4418678_4418930_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXZ33938.1|4419111_4419651_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	57.3	1.3e-44
AXZ33939.1|4420428_4421757_+	methyl-accepting chemotaxis protein	NA	A0A1B0VAH3	Salmonella_phage	100.0	1.6e-51
AXZ33940.1|4422084_4422846_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXZ33941.1|4422866_4423727_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AXZ33942.1|4423690_4423873_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ33943.1|4423863_4424568_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ33944.1|4424805_4425879_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
4423801:4424620	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
AXZ33945.1|4425878_4426676_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	1.8e-10
AXZ33946.1|4426685_4427384_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	2.1e-15
>prophage 9
CP032178	Klebsiella pneumoniae strain AR_0135 chromosome, complete genome	5425436	5219881	5324037	5425436	terminase,plate,portal,protease,transposase,capsid,tRNA,holin,tail,integrase,head	Enterobacteria_phage(24.1%)	122	5225660:5225676	5330057:5330073
AXZ34680.1|5219881_5221669_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
AXZ34681.1|5221936_5222503_+	hydrolase	NA	NA	NA	NA	NA
AXZ34682.1|5222499_5223318_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
AXZ34683.1|5223370_5223766_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ34684.1|5223805_5224549_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
AXZ34685.1|5224545_5225550_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AXZ34686.1|5225631_5226375_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
5225660:5225676	attL	TTCATCTCCGCCACCGC	NA	NA	NA	NA
AXZ34687.1|5226451_5227021_-	VOC family protein	NA	NA	NA	NA	NA
AXZ34688.1|5227256_5228990_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
AXZ34689.1|5229051_5230191_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
AXZ34690.1|5230195_5231779_-	MFS transporter	NA	NA	NA	NA	NA
AXZ34691.1|5232132_5232561_+	universal stress protein UspC	NA	NA	NA	NA	NA
AXZ34692.1|5232584_5234009_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AXZ34693.1|5233983_5234772_-	trehalose-phosphatase	NA	NA	NA	NA	NA
AXZ34694.1|5234933_5235914_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AXZ34695.1|5235928_5237443_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	4.1e-11
AXZ34696.1|5237505_5238486_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXZ34697.1|5239083_5239287_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34698.1|5239380_5239890_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
AXZ34699.1|5239960_5240119_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AXZ34700.1|5240133_5241696_+	MFS transporter	NA	NA	NA	NA	NA
AXZ34701.1|5241733_5241985_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AXZ35117.1|5243848_5244028_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ34702.1|5244085_5244583_+	non-heme ferritin	NA	NA	NA	NA	NA
AXZ34703.1|5244618_5244858_-	DUF2492 family protein	NA	NA	NA	NA	NA
AXZ34704.1|5245049_5246261_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
AXZ34705.1|5246285_5246954_-	YecA family protein	NA	NA	NA	NA	NA
AXZ34706.1|5247052_5247934_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AXZ34707.1|5248320_5248569_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34708.1|5248613_5249768_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.7	4.2e-178
AXZ34709.1|5249921_5251103_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	1.2e-156
AXZ34710.1|5251102_5251618_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
AXZ34711.1|5251672_5251972_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	73.7	3.1e-32
AXZ34712.1|5251968_5252145_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	69.8	1.5e-10
AXZ34713.1|5252125_5255065_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	44.2	2.6e-208
AXZ34714.1|5255076_5255565_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	65.0	1.6e-49
AXZ34715.1|5255692_5256850_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.8	2.5e-45
AXZ34716.1|5258069_5260229_-	hypothetical protein	NA	H6X4Y8	Enterobacteria_phage	37.0	1.6e-16
AXZ34717.1|5260233_5260830_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	46.3	1.5e-41
AXZ34718.1|5260822_5261722_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.9	6.2e-92
AXZ34719.1|5261708_5262077_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.3	2.3e-29
AXZ34720.1|5262073_5262652_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	62.6	5.1e-63
AXZ34721.1|5262651_5263293_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.3	1.5e-44
AXZ34722.1|5263289_5263748_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.1	6.2e-32
AXZ34723.1|5263892_5264288_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AXZ34724.1|5264284_5264836_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	9.2e-30
AXZ34725.1|5264832_5265114_-	hypothetical protein	NA	B9A7B8	Serratia_phage	57.1	1.1e-18
AXZ34726.1|5265104_5265305_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	64.6	6.7e-15
AXZ34727.1|5265304_5265802_-|capsid	capsid assembly protein	capsid	B9A7B7	Serratia_phage	71.5	1.2e-60
AXZ34728.1|5265904_5266804_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	77.0	3.5e-87
AXZ34729.1|5266851_5267901_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.0	5.7e-105
AXZ34730.1|5267925_5268759_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	1.1e-95
AXZ34731.1|5268919_5270641_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	66.2	6.2e-226
AXZ34732.1|5270640_5271687_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.1	5.8e-142
AXZ34733.1|5272422_5273424_-|protease	serine protease	protease	NA	NA	NA	NA
AXZ34734.1|5273620_5276215_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.4	1.2e-196
AXZ34735.1|5276207_5277224_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	55.1	1.9e-97
AXZ34736.1|5277538_5278492_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	56.3	3.6e-82
AXZ34737.1|5278484_5278679_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34738.1|5278675_5278903_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	49.0	5.5e-05
AXZ34739.1|5278911_5279490_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	41.1	3.2e-33
AXZ34740.1|5279486_5279711_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34741.1|5279779_5280052_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34742.1|5280061_5280460_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ35118.1|5280476_5280674_-	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
AXZ34743.1|5280896_5281100_-	DNA-binding protein	NA	P79674	Haemophilus_phage	37.1	6.4e-05
AXZ34744.1|5281128_5281332_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34745.1|5281372_5281801_+	XRE family transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	38.5	1.0e-07
AXZ34746.1|5281810_5282440_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ34747.1|5282456_5283323_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
AXZ34748.1|5283319_5284327_+|integrase	site-specific integrase	integrase	Q1I119	Pasteurella_virus	56.5	1.3e-103
AXZ34749.1|5284900_5285449_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AXZ34750.1|5285889_5286594_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ34751.1|5286848_5288558_+	hypothetical protein	NA	H6X4Y8	Enterobacteria_phage	37.0	1.2e-16
AXZ34752.1|5288612_5288903_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ34753.1|5291400_5294484_-	kinase	NA	A0A286S259	Klebsiella_phage	71.9	0.0e+00
AXZ34754.1|5294480_5294861_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
AXZ34755.1|5294870_5295356_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
AXZ34756.1|5295342_5295816_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.8	4.6e-54
AXZ34757.1|5295836_5299223_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.9	2.5e-303
AXZ34758.1|5299283_5299517_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
AXZ34759.1|5299590_5299896_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.6	1.4e-27
AXZ34760.1|5299898_5300303_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	3.2e-32
AXZ34761.1|5300333_5301038_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.9	2.5e-80
AXZ34762.1|5301094_5301442_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
AXZ34763.1|5301438_5301888_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
AXZ34764.1|5301884_5302223_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
AXZ34765.1|5302231_5302552_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
AXZ34766.1|5302548_5302764_-	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	1.9e-07
AXZ34767.1|5302790_5303999_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.5	9.9e-194
AXZ34768.1|5304013_5304667_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
AXZ34769.1|5304653_5305883_-|portal	phage portal protein	portal	U5P411	Shigella_phage	81.5	1.7e-201
AXZ34770.1|5305882_5306068_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	63.9	5.2e-14
AXZ34771.1|5306077_5307808_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.4	9.2e-302
AXZ34772.1|5307804_5308299_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
AXZ35119.1|5308430_5308781_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	4.6e-51
AXZ34773.1|5308845_5309256_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34774.1|5309292_5309538_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.6e-34
AXZ34775.1|5309666_5309909_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34776.1|5309895_5310090_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.3	4.6e-21
AXZ34777.1|5310040_5310316_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	70.3	3.9e-05
AXZ34778.1|5310312_5310660_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	2.1e-40
AXZ34779.1|5310656_5311196_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	2.0e-101
AXZ34780.1|5311192_5311504_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	84.5	3.8e-41
AXZ34781.1|5311662_5311902_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ34782.1|5312053_5312632_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	1.7e-50
AXZ34783.1|5312645_5313626_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	8.4e-135
AXZ34784.1|5313638_5314016_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	3.3e-47
AXZ34785.1|5314025_5314850_-	DNA methylase	NA	A0A1C9II58	Salmonella_phage	69.5	2.6e-113
AXZ34786.1|5315055_5316024_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	1.0e-84
AXZ34787.1|5316013_5316193_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
AXZ34788.1|5316430_5316892_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AXZ34789.1|5316917_5317115_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
AXZ35120.1|5317219_5317867_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
AXZ34790.1|5318313_5319231_+	hypothetical protein	NA	A0A1W6JP69	Morganella_phage	36.9	3.1e-46
AXZ34791.1|5319318_5319618_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	3.8e-14
AXZ34792.1|5319617_5320403_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	1.4e-60
AXZ34793.1|5320530_5321607_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.1	2.1e-147
AXZ34794.1|5321599_5322508_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.6	9.8e-45
AXZ34795.1|5322504_5322783_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	44.9	6.7e-13
AXZ34796.1|5322815_5323043_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	3.8e-30
AXZ34797.1|5323044_5324037_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
5330057:5330073	attR	TTCATCTCCGCCACCGC	NA	NA	NA	NA
>prophage 1
CP032176	Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence	90682	0	49981	90682	transposase,integrase	Escherichia_phage(38.46%)	55	35269:35286	54710:54727
AXZ29816.1|1489_1681_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AXZ29817.1|1689_2076_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ29818.1|2621_2882_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ29819.1|2827_3532_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ29820.1|3916_4858_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ29821.1|5438_6125_+	NYN domain-containing protein	NA	NA	NA	NA	NA
AXZ29822.1|6262_7000_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ29823.1|8941_9646_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ29824.1|9636_9840_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ29825.1|9798_10812_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ29826.1|10967_11441_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AXZ29827.1|11661_11928_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AXZ29828.1|12070_12835_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXZ29829.1|12876_13089_+	resolvase	NA	NA	NA	NA	NA
AXZ29830.1|13101_14310_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AXZ29831.1|14343_15777_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AXZ29832.1|16158_16365_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ29833.1|16369_16882_-	restriction endonuclease	NA	NA	NA	NA	NA
AXZ29834.1|16906_17611_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ29835.1|17708_18828_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
AXZ29836.1|18875_19514_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	65.5	8.3e-75
AXZ29837.1|19925_20801_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AXZ29910.1|21433_22060_+	cobyrinic acid ac-diamide synthase	NA	E5FFJ3	Burkholderia_phage	30.1	3.8e-16
AXZ29838.1|22179_22359_+	Par-like protein	NA	NA	NA	NA	NA
AXZ29839.1|22711_22900_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ29840.1|23483_23921_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ29841.1|24214_25738_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AXZ29842.1|26279_27356_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXZ29843.1|28068_28773_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ29844.1|29262_30372_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AXZ29845.1|30466_31651_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AXZ29846.1|31746_32355_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXZ29847.1|32401_33106_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ29848.1|33216_33453_-	mercury resistance protein	NA	NA	NA	NA	NA
AXZ29849.1|33449_33815_-	transcriptional regulator	NA	NA	NA	NA	NA
AXZ29850.1|33832_35518_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
35269:35286	attL	CGCGCATCTTGTCGAGCA	NA	NA	NA	NA
AXZ29851.1|35556_35982_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AXZ29852.1|36009_36285_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AXZ29853.1|36300_36666_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AXZ29854.1|36737_37193_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AXZ29855.1|37452_37980_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
AXZ29856.1|38012_38444_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ29857.1|38923_39889_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
AXZ29858.1|40096_40366_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ29859.1|40358_41843_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AXZ29860.1|41842_42094_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ29861.1|42251_42683_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AXZ29862.1|42682_43954_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AXZ29863.1|44035_45013_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AXZ29864.1|45009_46215_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AXZ29865.1|46629_46899_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ29866.1|46931_47129_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ29867.1|47255_48122_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AXZ29868.1|48889_49147_+	hypothetical protein	NA	NA	NA	NA	NA
AXZ29869.1|49204_49981_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
54710:54727	attR	TGCTCGACAAGATGCGCG	NA	NA	NA	NA
>prophage 2
CP032176	Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence	90682	54477	56172	90682		Erysipelothrix_phage(100.0%)	1	NA	NA
AXZ29875.1|54477_56172_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
>prophage 3
CP032176	Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence	90682	60828	62809	90682		Pandoravirus(50.0%)	2	NA	NA
AXZ29882.1|60828_61668_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXZ29883.1|62176_62809_-	type B-2 chloramphenicol O-acetyltransferase CatB2	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	44.4	4.1e-26
>prophage 4
CP032176	Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence	90682	66257	77980	90682	integrase,transposase	Escherichia_phage(42.86%)	11	62003:62062	80652:80767
62003:62062	attL	TTTCATGATATATCTCCCAATTTGTGTAGGGCTTATTATGCACGCTTAAAAATAATAAAA	NA	NA	NA	NA
AXZ29886.1|66257_67271_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXZ29887.1|67684_68221_-|transposase	transposase	transposase	NA	NA	NA	NA
AXZ29888.1|68232_68628_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXZ29889.1|68624_68876_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXZ29890.1|69057_69597_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	57.3	1.3e-44
AXZ29891.1|70374_71703_+	methyl-accepting chemotaxis protein	NA	A0A1B0VAH3	Salmonella_phage	100.0	1.6e-51
AXZ29892.1|72030_72792_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXZ29893.1|72812_73673_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AXZ29894.1|73636_73819_-	hypothetical protein	NA	NA	NA	NA	NA
AXZ29895.1|73809_74514_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXZ29896.1|77422_77980_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
80652:80767	attR	TTTTATTATTTTTAAGCGTGCATAATAAGCCCTACACAAATTGGGAGATATATCATGAAAAGAGTTTGATGCTCAGGGTGTAGCGGTTCGGTTTATTGACGACGGGATCAGTACCG	NA	NA	NA	NA
>prophage 5
CP032176	Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence	90682	81209	82070	90682		Enterobacteria_phage(100.0%)	1	NA	NA
AXZ29899.1|81209_82070_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
>prophage 6
CP032176	Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence	90682	85306	86011	90682	transposase	Escherichia_phage(100.0%)	1	NA	NA
AXZ29902.1|85306_86011_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
