The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021130	Meiothermus taiwanensis WR-220 chromosome, complete genome	2802273	1014318	1023335	2802273	head	Faecalibacterium_phage(33.33%)	14	NA	NA
AWR86238.1|1014318_1015728_-	hypothetical protein	NA	H7BVM2	unidentified_phage	28.2	1.8e-29
AWR86239.1|1015724_1015925_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86240.1|1015914_1016427_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86241.1|1016419_1016902_-	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	43.4	4.3e-15
AWR86242.1|1016901_1017345_-	hypothetical protein	NA	A0A1B0T6J3	Pelagibaca_phage	25.5	3.3e-06
AWR86243.1|1017360_1018266_-|head	major head subunit protein	head	A0A2K9VH18	Faecalibacterium_phage	44.7	2.4e-67
AWR86244.1|1018278_1018683_-	bacteriophage protein	NA	A0A0M4TU84	Ralstonia_phage	49.6	2.6e-26
AWR86245.1|1018682_1019666_-	Mu-like prophage I protein-like protein	NA	A0A2P9JZJ0	Alteromonadaceae_phage	26.8	6.0e-16
AWR86246.1|1019886_1020429_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86247.1|1020416_1020929_+	hypothetical protein	NA	A0A2K9VH22	Faecalibacterium_phage	37.0	9.8e-18
AWR86248.1|1020925_1021198_+	DNA-binding protein	NA	A4JWM7	Burkholderia_virus	47.2	1.3e-13
AWR86249.1|1021199_1021700_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86250.1|1021710_1021911_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86251.1|1021907_1023335_+	hypothetical protein	NA	A0A2K9VH53	Faecalibacterium_phage	25.7	2.5e-18
>prophage 2
CP021130	Meiothermus taiwanensis WR-220 chromosome, complete genome	2802273	1150844	1205531	2802273	transposase,tRNA,protease	Virus_Rctr71(16.67%)	51	NA	NA
AWR86373.1|1150844_1151915_-|transposase	transposase, IS605 OrfB family	transposase	A0A1P8DJG9	Virus_Rctr71	48.6	6.9e-82
AWR86374.1|1152187_1152937_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86375.1|1152933_1153617_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86376.1|1153641_1154328_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86377.1|1154329_1154743_-	cytidine deaminase	NA	NA	NA	NA	NA
AWR86378.1|1154761_1156138_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86379.1|1156244_1156649_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AWR86380.1|1156652_1157078_-|protease	metalloprotease ybeY	protease	NA	NA	NA	NA
AWR86381.1|1157080_1158052_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.3	8.5e-47
AWR86382.1|1158555_1159545_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86383.1|1159716_1160991_-|protease	protease/transporter	protease	NA	NA	NA	NA
AWR86384.1|1161161_1161926_+	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
AWR86385.1|1161922_1162519_+	hypothetical protein	NA	A0A1X9I5T8	Streptococcus_phage	35.7	2.4e-20
AWR86386.1|1162538_1164269_-	beta-lactamase	NA	NA	NA	NA	NA
AWR86387.1|1164347_1166492_-	3' exoribonuclease	NA	NA	NA	NA	NA
AWR86388.1|1166877_1167147_-	ribosomal protein S15	NA	NA	NA	NA	NA
AWR86389.1|1167215_1168373_-	major facilitator superfamily MFS_1	NA	NA	NA	NA	NA
AWR86390.1|1168455_1170138_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
AWR86391.1|1170150_1170633_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AWR86392.1|1170924_1172886_+	transketolase	NA	NA	NA	NA	NA
AWR86393.1|1172886_1173078_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86394.1|1173118_1174036_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86395.1|1174021_1177705_-	alpha amylase catalytic region	NA	NA	NA	NA	NA
AWR86396.1|1177804_1178242_+	cyclase/dehydrase	NA	NA	NA	NA	NA
AWR86397.1|1178384_1179830_+|tRNA	cysteinyl-tRNA synthetase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.6	7.0e-45
AWR86398.1|1179875_1180550_-	peptidase membrane zinc metallopeptidase putative	NA	NA	NA	NA	NA
AWR86399.1|1180686_1180959_-	Stage V sporulation protein S	NA	NA	NA	NA	NA
AWR86400.1|1181329_1185826_+	glutamate synthase (ferredoxin)	NA	NA	NA	NA	NA
AWR86401.1|1185877_1186429_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86402.1|1186465_1187017_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86403.1|1187036_1187816_+	HAD-superfamily hydrolase, subfamily IA, variant 1	NA	NA	NA	NA	NA
AWR86404.1|1187818_1188400_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
AWR86405.1|1188409_1189177_-	enoyl-CoA hydratase/isomerase	NA	NA	NA	NA	NA
AWR86406.1|1189186_1189957_-	enoyl-CoA hydratase/isomerase	NA	NA	NA	NA	NA
AWR86407.1|1189966_1190299_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86408.1|1190370_1191366_-|transposase	transposase IS4 family protein	transposase	NA	NA	NA	NA
AWR86409.1|1191704_1192427_+	ABC transporter related protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	6.8e-17
AWR86410.1|1192439_1193639_+	sodium ABC transporter permease protein	NA	NA	NA	NA	NA
AWR86411.1|1193725_1194904_+	sodium ABC transporter permease protein	NA	NA	NA	NA	NA
AWR86412.1|1194900_1196034_-	hypothetical protein	NA	S4VUH2	Pandoravirus	28.5	1.9e-13
AWR86413.1|1196142_1196361_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86414.1|1196410_1197043_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AWR86415.1|1197063_1198077_-|protease	membrane-associated zinc metalloprotease	protease	NA	NA	NA	NA
AWR86416.1|1198099_1199227_-	1-deoxy-D-xylulose 5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AWR86417.1|1199270_1200131_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AWR86418.1|1200231_1200789_-	ribosome recycling factor	NA	NA	NA	NA	NA
AWR86419.1|1200937_1201642_-	uridylate kinase	NA	NA	NA	NA	NA
AWR86420.1|1201733_1202324_-	translation elongation factor Ts	NA	NA	NA	NA	NA
AWR86421.1|1202352_1203084_-	ribosomal protein S2	NA	NA	NA	NA	NA
AWR86422.1|1203394_1204498_+	FAD dependent oxidoreductase	NA	NA	NA	NA	NA
AWR86423.1|1204535_1205531_-|transposase	transposase IS4 family protein	transposase	NA	NA	NA	NA
>prophage 3
CP021130	Meiothermus taiwanensis WR-220 chromosome, complete genome	2802273	1597108	1610569	2802273		Thermus_virus(93.33%)	28	NA	NA
AWR86778.1|1597108_1597579_-	hypothetical protein	NA	C8CHM5	Thermus_virus	50.9	1.7e-37
AWR86779.1|1597557_1597752_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86780.1|1597860_1598283_-	hypothetical protein	NA	C8CHM2	Thermus_virus	65.7	8.8e-41
AWR86781.1|1598795_1599074_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86782.1|1599063_1599255_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86783.1|1599254_1599905_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86784.1|1599891_1600233_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86785.1|1600234_1600573_-	hypothetical protein	NA	C8CHL6	Thermus_virus	47.3	8.2e-05
AWR86786.1|1600587_1601463_-	hypothetical protein	NA	Q859S7	Thermus_virus	71.5	2.1e-116
AWR86787.1|1601475_1601985_-	hypothetical protein	NA	C8CHL4	Thermus_virus	69.2	2.4e-64
AWR86788.1|1602000_1602417_-	hypothetical protein	NA	C8CHL3	Thermus_virus	78.7	2.4e-54
AWR86789.1|1602565_1603240_-	hypothetical protein	NA	Q859T0	Thermus_virus	75.9	1.7e-94
AWR86790.1|1603229_1603652_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86791.1|1603635_1603845_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86792.1|1603859_1604054_-	hypothetical protein	NA	B3XVS9	Thermus_virus	86.5	3.9e-12
AWR86793.1|1604050_1604620_-	N-acetylmuramoyl-L-alanine amidase CwlD	NA	C8CHK8	Thermus_virus	73.7	4.3e-67
AWR86794.1|1604567_1604900_-	hypothetical protein	NA	C8CHK6	Thermus_virus	71.8	7.0e-33
AWR86795.1|1605018_1605414_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86796.1|1605469_1605982_-	hypothetical protein	NA	Q859T5	Thermus_virus	62.3	1.3e-38
AWR86797.1|1606087_1606381_-	hypothetical protein	NA	C8CHK5	Thermus_virus	67.0	1.0e-32
AWR86798.1|1606385_1606763_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86799.1|1606788_1607124_-	hypothetical protein	NA	C8CHK1	Thermus_virus	44.9	7.6e-11
AWR86800.1|1607127_1608360_-	hypothetical protein	NA	C8CHK0	Thermus_virus	56.0	5.1e-105
AWR86801.1|1608373_1608607_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86802.1|1608584_1608911_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86803.1|1609131_1609377_-	N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase	NA	NA	NA	NA	NA
AWR86804.1|1609410_1609629_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86805.1|1610143_1610569_+	putative phage repressor	NA	A0A0M3LPF9	Mannheimia_phage	34.2	1.4e-06
>prophage 4
CP021130	Meiothermus taiwanensis WR-220 chromosome, complete genome	2802273	1669730	1728553	2802273	tRNA,transposase,protease	Staphylococcus_phage(41.67%)	58	NA	NA
AWR86864.1|1669730_1671617_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SEZ7	Hokovirus	34.2	3.6e-94
AWR86865.1|1671801_1672494_-	ribose 5-phosphate isomerase	NA	NA	NA	NA	NA
AWR86866.1|1672521_1673016_-	peroxiredoxin	NA	NA	NA	NA	NA
AWR86867.1|1673107_1673596_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86868.1|1673599_1674190_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86869.1|1674214_1674997_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.5	1.1e-23
AWR86870.1|1675073_1675607_+|protease	peptidase M22 glycoprotease	protease	NA	NA	NA	NA
AWR86871.1|1675603_1676695_+	methyltransferase small	NA	NA	NA	NA	NA
AWR86872.1|1676992_1678513_+	RNA polymerase, sigma 70 subunit, RpoD subfamily	NA	A0A2I7SAT0	Vibrio_phage	35.9	7.1e-32
AWR86873.1|1678818_1679496_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86874.1|1679535_1679799_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86875.1|1679858_1680296_+	Fe-S metabolism associated SufE	NA	NA	NA	NA	NA
AWR86876.1|1680301_1682434_-	ABC transporter related protein	NA	A0A2K9L3Z8	Tupanvirus	25.7	3.3e-35
AWR86877.1|1682599_1683175_+	GCN5-related N-acetyltransferase	NA	NA	NA	NA	NA
AWR86878.1|1683171_1683660_-	transcriptional regulator, MarR family	NA	NA	NA	NA	NA
AWR86879.1|1683783_1684725_+	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
AWR86880.1|1684735_1685530_+	4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase, HpaG2 subunit	NA	NA	NA	NA	NA
AWR86881.1|1685565_1686009_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86882.1|1686149_1687766_+	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWR86883.1|1687777_1689235_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase subunit	NA	NA	NA	NA	NA
AWR86884.1|1689248_1689722_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86885.1|1689734_1690706_+	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
AWR86886.1|1690841_1692419_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWR86887.1|1692415_1693609_+	Extracellular ligand-binding receptor	NA	NA	NA	NA	NA
AWR86888.1|1693667_1694699_+	inner-membrane translocator	NA	NA	NA	NA	NA
AWR86889.1|1694698_1696471_+	ABC transporter related protein	NA	A0A285PWH2	Cedratvirus	29.5	4.3e-12
AWR86890.1|1696467_1697199_+	ABC transporter related protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	3.3e-11
AWR86891.1|1697201_1697573_+	phenylacetic acid degradation protein PaaD	NA	NA	NA	NA	NA
AWR86892.1|1697625_1698834_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AWR86893.1|1698830_1699580_+	short-chain dehydrogenase/reductase SDR	NA	A0A0M4JSW6	Mollivirus	39.8	1.1e-06
AWR86894.1|1699669_1701016_+	Phenylacetate--CoA ligase	NA	NA	NA	NA	NA
AWR86895.1|1701012_1701447_+	thioesterase	NA	NA	NA	NA	NA
AWR86896.1|1701492_1702101_+	putative peptidase	NA	NA	NA	NA	NA
AWR86897.1|1702102_1703059_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86898.1|1703091_1703601_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86899.1|1703638_1703938_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AWR86900.1|1703922_1704918_-|transposase	transposase IS4 family protein	transposase	NA	NA	NA	NA
AWR86901.1|1705134_1705782_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR86902.1|1705751_1706354_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86903.1|1706350_1707358_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86904.1|1707370_1708423_-	putative ATPase	NA	NA	NA	NA	NA
AWR86905.1|1708463_1708967_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86906.1|1709070_1709913_-	6-phosphogluconate dehydrogenase NAD-binding protein	NA	NA	NA	NA	NA
AWR86907.1|1710212_1710584_-	holo-acyl-carrier-protein synthase	NA	NA	NA	NA	NA
AWR86908.1|1710604_1711978_+	RNA methylase, NOL1/NOP2/sun family	NA	NA	NA	NA	NA
AWR86909.1|1712039_1712285_-	hypothetical protein	NA	NA	NA	NA	NA
AWR86910.1|1712444_1713728_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AWR86911.1|1713789_1714941_+	peptide chain release factor 2	NA	A0A1C9EHI2	Mycobacterium_phage	42.6	9.6e-05
AWR86912.1|1715033_1716980_-	acetate/CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.8	1.8e-96
AWR86913.1|1717203_1719312_+	IclR family transcriptional regulator	NA	A0A2H4PQU7	Staphylococcus_phage	31.4	2.1e-34
AWR86914.1|1719304_1720111_-|transposase	transposase	transposase	NA	NA	NA	NA
AWR86915.1|1720227_1720713_+	IclR family transcriptional regulator	NA	A0A2H4PQU7	Staphylococcus_phage	39.4	1.4e-21
AWR86916.1|1720868_1722752_+	AMP-dependent synthetase and ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.6	6.0e-89
AWR86917.1|1723139_1723394_+	membrane protein	NA	NA	NA	NA	NA
AWR86918.1|1723404_1725132_+	SSS sodium solute transporter superfamily	NA	NA	NA	NA	NA
AWR86919.1|1725195_1725636_+	hypothetical protein	NA	NA	NA	NA	NA
AWR86920.1|1725610_1727446_+	putative nucleotidyltransferase	NA	NA	NA	NA	NA
AWR86921.1|1727746_1728553_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
CP021130	Meiothermus taiwanensis WR-220 chromosome, complete genome	2802273	1888308	1897091	2802273		Bacillus_phage(33.33%)	7	NA	NA
AWR87070.1|1888308_1889487_-	Integrase family protein	NA	A0A2H4JCB7	uncultured_Caudovirales_phage	33.2	1.3e-41
AWR87071.1|1889744_1890461_+	ribonuclease PH	NA	NA	NA	NA	NA
AWR87072.1|1890551_1891163_+	non-canonical purine NTP pyrophosphatase, rdgB/HAM1 family	NA	D2KCJ6	Cassava_brown_streak_virus	30.5	1.1e-10
AWR87073.1|1891260_1893513_+	MutS2 family protein	NA	A0A2P0VN50	Tetraselmis_virus	28.6	1.3e-16
AWR87074.1|1894026_1894710_+	two component transcriptional regulator, winged helix family	NA	W8CYM9	Bacillus_phage	36.1	2.1e-36
AWR87075.1|1894834_1896256_+	histidine kinase	NA	W8CYF6	Bacillus_phage	35.3	3.1e-29
AWR87076.1|1896311_1897091_-	stationary-phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	41.6	2.8e-40
>prophage 1
CP021131	Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence	271068	147669	192803	271068	transposase	Bacillus_virus(50.0%)	36	NA	NA
AWR88083.1|147669_148707_-|transposase	transposase IS4 family protein	transposase	NA	NA	NA	NA
AWR88084.1|149009_149543_+	2-phosphoglycerate kinase	NA	NA	NA	NA	NA
AWR88085.1|149539_151555_+	binding-protein-dependent transport systems inner membrane component	NA	NA	NA	NA	NA
AWR88086.1|151569_152874_+	ABC transporter related protein	NA	G3M9Y6	Bacillus_virus	36.3	4.0e-31
AWR88087.1|152888_153527_-|transposase	transposase	transposase	NA	NA	NA	NA
AWR88088.1|153583_153952_-	hypothetical protein	NA	NA	NA	NA	NA
AWR88089.1|154020_154674_-	hypothetical protein	NA	NA	NA	NA	NA
AWR88090.1|154914_155481_+|transposase	transposase IS4 family protein	transposase	NA	NA	NA	NA
AWR88091.1|155589_156831_-	hypothetical protein	NA	NA	NA	NA	NA
AWR88092.1|156849_157995_-	hypothetical protein	NA	NA	NA	NA	NA
AWR88093.1|157991_163415_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	23.4	8.1e-62
AWR88094.1|163637_164264_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88095.1|164332_164701_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88096.1|167143_167314_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88097.1|167451_168480_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWR88098.1|168596_169430_+	ABC transporter permease	NA	NA	NA	NA	NA
AWR88099.1|169426_170212_+	spermidine/putrescine ABC transporter permease II	NA	NA	NA	NA	NA
AWR88100.1|170237_171248_+	ABC transporter-like protein	NA	G3M9Y6	Bacillus_virus	37.7	2.6e-30
AWR88101.1|171360_172137_+	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AWR88102.1|172463_173381_-	hypothetical protein	NA	NA	NA	NA	NA
AWR88103.1|173575_176692_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88104.1|176896_177133_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88105.1|177129_179418_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88106.1|179432_180089_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88107.1|180270_180858_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR88108.1|181267_182182_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88109.1|182204_183077_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88110.1|183113_183305_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88111.1|183274_185002_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88112.1|184953_185496_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88113.1|185505_186798_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88114.1|186683_187235_-	serine/threonine protein kinase	NA	A0A140IPJ0	Avian_leukosis_and_sarcoma_virus	32.0	2.3e-12
AWR88115.1|189725_190373_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR88116.1|191433_191724_-	hypothetical protein	NA	NA	NA	NA	NA
AWR88117.1|191740_191944_-	heavy metal transport/detoxification protein	NA	NA	NA	NA	NA
AWR88118.1|191996_192803_-|transposase	transposase IS4 family protein	transposase	NA	NA	NA	NA
>prophage 2
CP021131	Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence	271068	238752	269617	271068	integrase,transposase	uncultured_virus(14.29%)	36	247495:247515	264577:264597
AWR88167.1|238752_239400_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR88168.1|240161_240362_+	heavy metal transport/detoxification protein	NA	NA	NA	NA	NA
AWR88169.1|240387_240678_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88170.1|240757_243271_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.1	2.4e-93
AWR88171.1|243426_243852_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88172.1|243759_244350_-	hypothetical protein	NA	NA	NA	NA	NA
AWR88173.1|244430_245045_+	heavy metal translocating P-type ATPase	NA	NA	NA	NA	NA
AWR88174.1|245159_245759_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88175.1|245770_246709_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88176.1|246986_247991_-|integrase	integrase/recombinase	integrase	A0A1I9SC88	Mycobacterium_phage	26.2	1.5e-06
247495:247515	attL	CGCAGCCCGGTGCCGTAGAGG	NA	NA	NA	NA
AWR88177.1|248677_249781_-	erythromycin esterase	NA	NA	NA	NA	NA
AWR88178.1|250255_251185_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88179.1|251195_252242_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88180.1|252248_252551_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88181.1|252729_252990_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88182.1|252986_253409_+	plasmid stability protein stbB	NA	NA	NA	NA	NA
AWR88183.1|253510_253777_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88184.1|253874_254282_-	hypothetical protein	NA	NA	NA	NA	NA
AWR88185.1|255027_255243_-	hypothetical protein	NA	NA	NA	NA	NA
AWR88186.1|255408_255618_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88187.1|255661_256081_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88188.1|256077_256308_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88189.1|256398_258831_+	type III restriction protein res subunit	NA	A0A2I7RRV1	Vibrio_phage	22.3	8.8e-08
AWR88190.1|258861_260103_-|transposase	transposase, IS605 OrfB	transposase	A0A1P8DJA0	Virus_Rctr71	34.4	8.1e-34
AWR88191.1|260225_261263_+	hypothetical protein	NA	Q9JMP5	Wolbachia_phage	51.2	7.1e-100
AWR88192.1|261243_262512_+	type I restriction enzyme, S subunit	NA	NA	NA	NA	NA
AWR88193.1|262511_264041_+	type I restriction enzyme, M subunit	NA	J7I0U9	Acinetobacter_phage	31.0	2.1e-23
AWR88194.1|264008_264542_-|integrase	integrase/recombinase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	36.7	5.4e-11
AWR88195.1|264606_264816_-	hypothetical protein	NA	NA	NA	NA	NA
264577:264597	attR	CGCAGCCCGGTGCCGTAGAGG	NA	NA	NA	NA
AWR88196.1|265049_265898_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88197.1|266170_266587_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88198.1|266818_267109_+	hypothetical protein	NA	NA	NA	NA	NA
AWR88199.1|267158_267809_+|transposase	transposase IS4 family protein	transposase	NA	NA	NA	NA
AWR88200.1|268003_268462_+	AAA ATPase	NA	NA	NA	NA	NA
AWR88201.1|268743_269106_-	hypothetical protein	NA	NA	NA	NA	NA
AWR88202.1|269098_269617_-|transposase	transposase IS4 family protein	transposase	NA	NA	NA	NA
