The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032097	Arcobacter ellisii strain LMG 26155 chromosome, complete genome	2799949	1205002	1277157	2799949	integrase,transposase	Shigella_phage(20.0%)	63	1227178:1227194	1286612:1286628
AXX94915.1|1205002_1207087_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.6	9.9e-93
AXX94916.1|1207092_1207422_+	UPF0060 domain-containing membrane protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	53.1	3.3e-19
AXX94917.1|1207477_1207822_+	putative membrane protein	NA	NA	NA	NA	NA
AXX94918.1|1207862_1208411_-	resolvase	NA	A0A286S1P7	Klebsiella_phage	60.8	8.8e-57
AXX94919.1|1208420_1208756_-	toxin-antitoxin system, toxin component, MazF/PemK family	NA	NA	NA	NA	NA
AXX94920.1|1208742_1208991_-	hypothetical protein	NA	NA	NA	NA	NA
AXX94921.1|1209224_1209554_+	hypothetical protein	NA	NA	NA	NA	NA
AXX94922.1|1209730_1210558_-|transposase	IS3 family transposase orfB	transposase	U5P429	Shigella_phage	51.5	2.5e-71
AXX94923.1|1210614_1210899_-|transposase	IS3 family transposase orfA	transposase	U5P4I9	Shigella_phage	54.2	2.6e-12
AXX94924.1|1210991_1211693_+	short-chain dehydrogenase/reductase	NA	NA	NA	NA	NA
AXX94925.1|1211931_1212297_-	putative toxin-antitoxin system antitoxin component	NA	A0A0P0ZCT8	Stx2-converting_phage	48.7	1.5e-20
AXX94926.1|1212299_1212593_-	toxin-antitoxin system, toxin component, RelE/ParE family	NA	A0A0P0ZE17	Stx2-converting_phage	46.3	4.7e-17
AXX94927.1|1212641_1213925_-|integrase	site-specific tyrosine recombinase, phage integrase family (INT_P4_C, DUF4102 domains)	integrase	B7SYF8	Stenotrophomonas_phage	32.1	9.6e-46
AXX94928.1|1214247_1214526_-	DNA-binding protein HU	NA	A4JWM7	Burkholderia_virus	49.4	2.7e-14
AXX94929.1|1214647_1215226_-	putative aldolase	NA	NA	NA	NA	NA
AXX94930.1|1215287_1216190_+	16S rRNA m4C1402 methyltransferase	NA	NA	NA	NA	NA
AXX94931.1|1216182_1216488_+	hypothetical protein	NA	NA	NA	NA	NA
AXX94932.1|1216465_1219549_+	RND family efflux system, inner membrane transporter, AcrB family	NA	S5VTK5	Leptospira_phage	24.0	2.1e-51
AXX94933.1|1219576_1220851_-	NlpC/P60 family lipoprotein (SH3b1, SH3b2 type SH3 domains)	NA	NA	NA	NA	NA
AXX94934.1|1220968_1221367_+	hypothetical protein	NA	NA	NA	NA	NA
AXX94935.1|1221398_1221677_-	periplasmic monoheme cytochrome c553	NA	NA	NA	NA	NA
AXX94936.1|1221792_1223364_-	fatty acid CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.2	2.1e-18
AXX94937.1|1223376_1224561_-	GlmL/MutL family protein	NA	NA	NA	NA	NA
AXX94938.1|1224557_1225922_-	coenzyme B12-dependent glutamate mutase GlmES, E (epsilon) subunit	NA	NA	NA	NA	NA
AXX94939.1|1225918_1226326_-	coenzyme B12-dependent glutamate mutase GlmES, S (sigma) subunit	NA	NA	NA	NA	NA
AXX94940.1|1226418_1226709_-	copper chaperone	NA	NA	NA	NA	NA
AXX94941.1|1226721_1227669_-	malate dehydrogenase, NAD-dependent	NA	NA	NA	NA	NA
1227178:1227194	attL	ATAACCTATTTTTTCAA	NA	NA	NA	NA
AXX94942.1|1227768_1229961_-	isocitrate dehydrogenase, monomeric	NA	NA	NA	NA	NA
AXX94943.1|1230086_1231178_-	YceG-like protein	NA	NA	NA	NA	NA
AXX94944.1|1231128_1234074_+	AsmA family protein (DUF3971 domain)	NA	NA	NA	NA	NA
AXX94945.1|1234078_1235284_-	lipoprotein releasing system, transmembrane protein, LolC/E family	NA	NA	NA	NA	NA
AXX94946.1|1235285_1237904_-	preprotein translocase, SecA subunit	NA	NA	NA	NA	NA
AXX94947.1|1237960_1238488_+	periplasmic outer membrane-specific lipoprotein chaperone	NA	NA	NA	NA	NA
AXX94948.1|1238975_1239203_+	D-alanyl carrier protein	NA	NA	NA	NA	NA
AXX94949.1|1239202_1240321_+	D-alanyl carrier protein:peptidoglycan D-alanyltransferase	NA	NA	NA	NA	NA
AXX94950.1|1240471_1241608_+	peptidoglycan:teichoic acid D-alanyltransferase	NA	NA	NA	NA	NA
AXX94951.1|1241604_1243041_+	D-alanine--[D-alanyl carrier protein] ligase	NA	A0A2K9KZV5	Tupanvirus	30.5	1.4e-42
AXX94952.1|1243225_1243510_+|transposase	IS3 family transposase orfA	transposase	U5P4I9	Shigella_phage	54.2	2.6e-12
AXX94953.1|1243566_1244394_+|transposase	IS3 family transposase orfB	transposase	U5P429	Shigella_phage	51.5	2.5e-71
AXX94954.1|1244960_1245695_-	uroporphyrinogen-III (C7)-methyltransferase	NA	NA	NA	NA	NA
AXX94955.1|1245696_1246005_-	NADH-dependent nitrite reductase, small subunit	NA	NA	NA	NA	NA
AXX94956.1|1246007_1248470_-	NADH-dependent nitrite reductase, catalytic subunit	NA	NA	NA	NA	NA
AXX94957.1|1248714_1250106_+	MCP-domain signal transduction protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.5	4.5e-09
AXX94958.1|1250116_1251334_+	globin sensor-containing diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AXX94959.1|1251318_1253628_-	molybdopterin-dependent oxidoreductase, catalytic subunit	NA	NA	NA	NA	NA
AXX94960.1|1253624_1255211_-	molybdopterin-dependent oxidoreductase, iron-sulfur subunit	NA	NA	NA	NA	NA
AXX94961.1|1255340_1257329_-	nitrate reductase	NA	NA	NA	NA	NA
AXX94962.1|1257531_1259505_+	PAS sensor-containing diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AXX94963.1|1259496_1261128_-	protein serine/threonine phosphatase/kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	31.6	3.9e-12
AXX94964.1|1261140_1262421_-	nitrate/nitrite transporter NarK, major facilitator superfamily	NA	NA	NA	NA	NA
AXX94965.1|1262704_1264084_+	nitrate ABC transporter, substrate-binding protein	NA	NA	NA	NA	NA
AXX94966.1|1264176_1264986_+	nitrate ABC transporter, permease protein	NA	NA	NA	NA	NA
AXX94967.1|1264997_1265795_+	nitrate ABC transporter, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	6.6e-29
AXX94968.1|1265835_1267014_-	glutathionylspermidine amidase / glutathionylspermidine synthetase	NA	B2ZXR7	Ralstonia_phage	31.1	2.0e-34
AXX94969.1|1267016_1267694_-	putative lipoprotein	NA	NA	NA	NA	NA
AXX94970.1|1267791_1269699_-	PAS sensor-containing diguanylate cyclase (NMT1 domain)	NA	G3MA91	Bacillus_virus	36.1	1.4e-16
AXX94971.1|1269829_1270918_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AXX94972.1|1270959_1272801_+	7TMR-DISM-7TM/7TMR-DISMED2 domain-containing two-component system sensor histidine kinase	NA	NA	NA	NA	NA
AXX94973.1|1272793_1273483_+	two-component system response regulator	NA	NA	NA	NA	NA
AXX94974.1|1273552_1274314_+	hypothetical protein	NA	NA	NA	NA	NA
AXX94975.1|1274377_1275058_+	two-component system response regulator	NA	NA	NA	NA	NA
AXX94976.1|1275134_1275569_+	putative membrane protein	NA	NA	NA	NA	NA
AXX94977.1|1276050_1277157_+|integrase	site-specific tyrosine recombinase, phage integrase family (INT_Rci_Hp1_C domain)	integrase	A0A067ZJC0	Vibrio_phage	32.0	5.4e-37
1286612:1286628	attR	TTGAAAAAATAGGTTAT	NA	NA	NA	NA
>prophage 2
CP032097	Arcobacter ellisii strain LMG 26155 chromosome, complete genome	2799949	2005625	2058930	2799949	integrase,transposase,protease	Morganella_phage(16.67%)	49	2030615:2030635	2067863:2067883
AXX95689.1|2005625_2006981_+|integrase	site-specific tyrosine recombinase, phage integrase family	integrase	NA	NA	NA	NA
AXX95690.1|2006970_2007558_+	hypothetical protein	NA	NA	NA	NA	NA
AXX95691.1|2007558_2010456_+|integrase	site-specific tyrosine recombinase, phage integrase family	integrase	NA	NA	NA	NA
AXX95692.1|2010525_2011101_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AXX95693.1|2011105_2011576_-|protease	ubiquitin protease family protein (prokaryotic JAB domain)	protease	NA	NA	NA	NA
AXX95694.1|2011580_2013200_-	ubiquitin-activating E1 family protein	NA	NA	NA	NA	NA
AXX95695.1|2013237_2013660_-	DUF1508 domain-containing protein (tandem domains)	NA	NA	NA	NA	NA
AXX95696.1|2013905_2014796_+	transcriptional regulator (WYL domain)	NA	NA	NA	NA	NA
AXX95697.1|2014854_2015043_+	hypothetical protein	NA	NA	NA	NA	NA
AXX95698.1|2015073_2015460_+	hypothetical protein	NA	NA	NA	NA	NA
AXX95699.1|2015726_2016872_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	24.6	1.1e-11
AXX95700.1|2016897_2019570_-	putative metal-dependent phosphatase (AAA domain)	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	25.8	1.8e-25
AXX95701.1|2020774_2021155_+	putative membrane protein	NA	NA	NA	NA	NA
AXX95702.1|2021162_2021678_-	peptide deformylase	NA	NA	NA	NA	NA
AXX95703.1|2021689_2022274_-|protease	serine protease ClpP	protease	A0A223W000	Agrobacterium_phage	57.9	9.3e-57
AXX95704.1|2022288_2023590_-	trigger factor (peptidyl-prolyl cis /trans isomerase, chaperone)	NA	NA	NA	NA	NA
AXX95705.1|2023681_2025346_+	von Willebrand factor type A (vWA) domain-containing protein	NA	NA	NA	NA	NA
AXX95706.1|2025355_2026474_-	polyphosphate kinase 2	NA	NA	NA	NA	NA
AXX95707.1|2026473_2027415_-	polyphosphate kinase 2	NA	NA	NA	NA	NA
AXX95708.1|2027424_2028573_-	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
AXX95709.1|2028562_2028727_-	rubredoxin	NA	NA	NA	NA	NA
AXX95710.1|2028752_2029946_-	saccharopine dehydrogenase-like protein	NA	NA	NA	NA	NA
2030615:2030635	attL	AGGTTACTAATAGGTTACTAA	NA	NA	NA	NA
AXX95711.1|2030636_2031737_+|integrase	site-specific tyrosine recombinase, phage integrase family (INT_Rci_Hp1_C domain)	integrase	A0A059WLJ1	Vibrio_phage	33.1	8.8e-40
AXX95712.1|2033220_2034414_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95713.1|2034455_2035379_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95714.1|2035379_2037416_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95715.1|2037417_2037864_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95716.1|2037863_2038991_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95717.1|2038993_2040010_-	metal-dependent hydrolase, beta-lactamase superfamily	NA	NA	NA	NA	NA
AXX95718.1|2040160_2041042_-	transcriptional regulator (WYL domain)	NA	NA	NA	NA	NA
AXX95719.1|2041069_2042671_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95720.1|2042679_2043423_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95721.1|2043479_2043785_+	transcriptional regulator, XRE family	NA	NA	NA	NA	NA
AXX95722.1|2043781_2044375_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95723.1|2044549_2045140_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95724.1|2045507_2045669_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95725.1|2045668_2045974_-	DUF2958 domain-containing protein	NA	NA	NA	NA	NA
AXX95726.1|2045973_2046876_-	putative Rad52/22 family double-strand break repair protein	NA	F8TUV5	EBPR_podovirus	38.6	7.2e-16
AXX95727.1|2046893_2047520_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95728.1|2047530_2048358_-	DUF932 domain-containing protein	NA	A0A1L2CVW9	Pectobacterium_phage	27.5	3.5e-25
AXX95729.1|2048521_2048746_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95730.1|2048997_2049876_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95731.1|2049885_2052357_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95732.1|2052358_2052553_-	putative transcriptional regulator	NA	NA	NA	NA	NA
AXX95733.1|2052676_2053999_-	hypothetical protein	NA	NA	NA	NA	NA
AXX95734.1|2054279_2054693_+	hypothetical protein	NA	NA	NA	NA	NA
AXX95735.1|2054685_2055534_+	nucleotidyltransferase, AbiEii toxin family	NA	NA	NA	NA	NA
AXX95736.1|2055707_2057582_+	hypothetical protein	NA	NA	NA	NA	NA
AXX95737.1|2057565_2058930_-|transposase	transposase, IS4 family	transposase	NA	NA	NA	NA
2067863:2067883	attR	AGGTTACTAATAGGTTACTAA	NA	NA	NA	NA
>prophage 3
CP032097	Arcobacter ellisii strain LMG 26155 chromosome, complete genome	2799949	2227923	2239289	2799949		Tupanvirus(22.22%)	13	NA	NA
AXX95892.1|2227923_2228799_-	glycosyltransferase, family 2	NA	A0A1V0SAH6	Catovirus	34.3	1.2e-10
AXX95893.1|2228795_2229701_-	alpha-1,2-fucosyltransferase	NA	A0A0N9R2S4	Chrysochromulina_ericina_virus	28.6	5.6e-16
AXX95894.1|2229702_2230314_-	sugar O-acyltransferase	NA	NA	NA	NA	NA
AXX95895.1|2230300_2231401_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A2K9L0G1	Tupanvirus	33.3	2.5e-34
AXX95896.1|2231400_2231913_-	WxcM-like sugar acyltransferase	NA	NA	NA	NA	NA
AXX95897.1|2231902_2232307_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
AXX95898.1|2232303_2233347_-	dTDP-D-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.8	4.1e-79
AXX95899.1|2233339_2234215_-	glucose-1-phosphate thymidylyltransferase, short form	NA	K7QKA7	Escherichia_phage	66.9	3.9e-107
AXX95900.1|2234211_2235267_-	GDP-L-fucose synthetase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	51.3	2.8e-91
AXX95901.1|2235275_2236421_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	59.9	8.6e-123
AXX95902.1|2236422_2236884_-	GDP-mannose mannosylhydrolase	NA	NA	NA	NA	NA
AXX95903.1|2236887_2238261_-	bifunctional mannose-6-phosphate isomerase / mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	35.0	5.6e-60
AXX95904.1|2238257_2239289_-	UDP-glucose 4-epimerase	NA	A0A2K9L1R4	Tupanvirus	49.5	9.0e-87
>prophage 4
CP032097	Arcobacter ellisii strain LMG 26155 chromosome, complete genome	2799949	2480402	2487361	2799949	tRNA	Campylobacter_virus(33.33%)	9	NA	NA
AXX96138.1|2480402_2481083_+	7-cyano-7-deazaguanine synthase	NA	M1PKZ7	Cellulophaga_phage	37.0	6.9e-27
AXX96139.1|2481082_2481616_+	6-carboxy-5,6,7,8-tetrahydropterin synthase	NA	H6SU72	Campylobacter_virus	51.1	2.6e-45
AXX96140.1|2481608_2482373_+	7-carboxy-7-deazaguanine synthase	NA	D5GV09	Campylobacter_virus	43.7	1.0e-50
AXX96141.1|2482444_2483188_+	3-oxoacyl-[acp] reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	26.6	1.2e-11
AXX96142.1|2483281_2483512_+	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	66.0	5.4e-08
AXX96143.1|2483619_2484879_+	beta-ketoacyl-[acp] synthase II (KASII)	NA	NA	NA	NA	NA
AXX96144.1|2484945_2485884_+	acetyl-CoA carboxylase, carboxyltransferase, alpha subunit	NA	NA	NA	NA	NA
AXX96145.1|2485893_2486238_-	histidine triad nucleotide-binding protein, Hint/PKCI branch	NA	NA	NA	NA	NA
AXX96146.1|2486368_2487361_+|tRNA	phenylalanyl-tRNA synthetase, alpha subunit	tRNA	A0A2I2L4E3	Orpheovirus	34.9	1.2e-32
>prophage 5
CP032097	Arcobacter ellisii strain LMG 26155 chromosome, complete genome	2799949	2521117	2534012	2799949	tRNA	Bacillus_phage(37.5%)	12	NA	NA
AXX96181.1|2521117_2523172_-	UvrD/REP family helicase	NA	A7KV33	Bacillus_phage	37.4	4.1e-107
AXX96182.1|2523288_2524185_+	transcriptional regulator, LysR family	NA	NA	NA	NA	NA
AXX96183.1|2524210_2525173_-	radical SAM protein, TIGR01212 family	NA	A0A2H4PQV5	Staphylococcus_phage	31.7	3.6e-13
AXX96184.1|2525172_2526522_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.3	4.5e-54
AXX96185.1|2526534_2527308_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AXX96186.1|2527322_2528252_-	thioredoxin reductase	NA	G3MA85	Bacillus_virus	42.6	5.5e-59
AXX96187.1|2528464_2528782_-	thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	40.2	1.3e-12
AXX96188.1|2528966_2531522_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A1V0SK38	Klosneuvirus	35.4	3.3e-74
AXX96189.1|2531532_2532012_+	putative membrane protein	NA	NA	NA	NA	NA
AXX96190.1|2532018_2532585_-	hypothetical protein	NA	NA	NA	NA	NA
AXX96191.1|2532711_2533335_+	outer membrane lipoprotein, NlpC/P60 family	NA	S5MM68	Bacillus_phage	35.1	2.2e-11
AXX96192.1|2533358_2534012_+	outer membrane lipoprotein, NlpC/P60 family	NA	S5MM68	Bacillus_phage	43.0	3.1e-16
>prophage 6
CP032097	Arcobacter ellisii strain LMG 26155 chromosome, complete genome	2799949	2749148	2759132	2799949		Staphylococcus_phage(12.5%)	11	NA	NA
AXX96403.1|2749148_2750375_-	flavoprotein, HI0933 family	NA	A0A2H4PQX1	Staphylococcus_phage	33.7	1.1e-06
AXX96404.1|2750486_2751488_+	ATP-binding protein (AAA domain)	NA	H6WG28	Cyanophage	41.3	1.7e-58
AXX96405.1|2751491_2752622_+	putative metallopeptidase (DUF2201 domain)	NA	A0A2I7SAP6	Vibrio_phage	27.9	3.9e-27
AXX96406.1|2752618_2752933_-	Cupin domain-containing protein	NA	NA	NA	NA	NA
AXX96407.1|2753146_2754415_+	O-acetylhomoserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	27.1	1.1e-14
AXX96408.1|2754418_2754832_+	transcriptional regulator, IscR/Rrf2 family	NA	NA	NA	NA	NA
AXX96409.1|2754844_2755777_+	cysteine synthase	NA	A0A1X9I5K7	Streptococcus_phage	52.7	1.4e-78
AXX96410.1|2755808_2756039_+	DUF2061 domain-containing protein	NA	A0A1B0XTK5	Freshwater_phage	38.7	7.7e-07
AXX96411.1|2756048_2756750_+	phosphoadenosine phosphosulfate reductase	NA	M4W6M9	Bacillus_phage	34.1	1.6e-07
AXX96412.1|2756761_2757673_+	sulfate adenylyltransferase, subunit CysD	NA	NA	NA	NA	NA
AXX96413.1|2757674_2759132_+	sulfate adenylyltransferase, GTPase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.5	4.4e-31
