The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032093	Vibrio alfacsensis strain CAIM 1831 chromosome I, complete sequence	3136974	444435	450411	3136974	integrase	Vibrio_phage(50.0%)	8	444227:444283	457896:457952
444227:444283	attL	TTCAAAATCCGTTGCCTTCGGGCGTGGCGGTTCAAGTCCGCCTACCGGTACCATATT	NA	NA	NA	NA
AXY00245.1|444435_445461_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	33.6	2.5e-20
AXY00246.1|445453_445990_+	hypothetical protein	NA	NA	NA	NA	NA
AXY02296.1|446360_446606_+	hypothetical protein	NA	NA	NA	NA	NA
AXY00247.1|446602_447091_+	helix-turn-helix domain-containing protein	NA	R9TPU9	Vibrio_phage	39.2	1.7e-19
AXY00248.1|447069_447513_+	hypothetical protein	NA	W8EA44	Vibrio_phage	40.4	1.7e-10
AXY00249.1|447487_447946_+	hypothetical protein	NA	A0A2I7S3R6	Vibrio_phage	31.7	1.5e-06
AXY00250.1|447947_448592_+	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	25.5	1.8e-08
AXY00251.1|448797_450411_+	DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	27.4	1.6e-50
457896:457952	attR	TTCAAAATCCGTTGCCTTCGGGCGTGGCGGTTCAAGTCCGCCTACCGGTACCATATT	NA	NA	NA	NA
>prophage 2
CP032093	Vibrio alfacsensis strain CAIM 1831 chromosome I, complete sequence	3136974	541861	553180	3136974	tRNA	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
AXY00320.1|541861_542638_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.9e-65
AXY00321.1|542637_543264_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.3	1.4e-37
AXY00322.1|543278_544202_+	LysM peptidoglycan-binding domain-containing protein	NA	D7RWE0	Brochothrix_phage	35.2	1.5e-05
AXY00323.1|544282_545269_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	6.9e-36
AXY00324.1|545379_547941_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.4	2.2e-33
AXY00325.1|548025_548508_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	4.4e-28
AXY00326.1|548708_549752_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.0	3.7e-112
AXY00327.1|549972_550440_+	recombination regulator RecX	NA	NA	NA	NA	NA
AXY00328.1|550582_553180_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.3	3.6e-76
>prophage 3
CP032093	Vibrio alfacsensis strain CAIM 1831 chromosome I, complete sequence	3136974	2417922	2424611	3136974		Staphylococcus_phage(66.67%)	7	NA	NA
AXY01727.1|2417922_2418393_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.3	1.3e-32
AXY01728.1|2418562_2419672_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	39.0	4.4e-63
AXY01729.1|2419830_2420484_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	1.9e-34
AXY01730.1|2420495_2421623_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	7.1e-45
AXY01731.1|2421627_2422077_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AXY01732.1|2422203_2423454_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	7.3e-99
AXY01733.1|2423471_2424611_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.7	2.9e-62
>prophage 1
CP032094	Vibrio alfacsensis strain CAIM 1831 chromosome II, complete sequence	1596877	379065	386697	1596877	transposase	Escherichia_phage(83.33%)	7	NA	NA
AXY02710.1|379065_380421_+	hypothetical protein	NA	O64347	Escherichia_phage	26.1	1.0e-13
AXY02711.1|380411_380651_+	hypothetical protein	NA	NA	NA	NA	NA
AXY02712.1|380738_382241_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	41.0	2.3e-75
AXY02713.1|382801_383572_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	49.6	1.6e-56
AXY02714.1|383847_384756_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	68.7	2.3e-102
AXY02715.1|384781_386038_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	56.7	2.5e-131
AXY03616.1|386064_386697_+	aldolase	NA	A0A077SK32	Escherichia_phage	61.7	1.7e-67
>prophage 2
CP032094	Vibrio alfacsensis strain CAIM 1831 chromosome II, complete sequence	1596877	1335430	1346576	1596877	tRNA	Escherichia_phage(71.43%)	9	NA	NA
AXY03405.1|1335430_1337800_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.5	1.1e-172
AXY03406.1|1338011_1338791_+	hypothetical protein	NA	NA	NA	NA	NA
AXY03407.1|1338973_1339819_-	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	32.0	1.7e-19
AXY03408.1|1339820_1340435_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	62.0	3.7e-80
AXY03409.1|1340444_1342892_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	47.6	7.5e-217
AXY03410.1|1343197_1343782_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	36.2	7.2e-25
AXY03411.1|1343781_1344318_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SLP0	Escherichia_phage	27.7	2.8e-07
AXY03412.1|1344415_1345237_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AXY03413.1|1345319_1346576_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	41.3	7.1e-86
