The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
CP025821	Brucella melitensis strain CIT31 chromosome 1, complete sequence	2125815	874623	886535	2125815	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
AXX11830.1|874623_875475_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
AXX11831.1|875467_876193_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
AXX11832.1|876338_876557_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
AXX11833.1|876667_877234_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AXX11834.1|877230_878055_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
AXX13010.1|878131_879415_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
AXX11835.1|879563_880331_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
AXX11836.1|880327_880996_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
AXX11837.1|881140_881326_+	hypothetical protein	NA	NA	NA	NA	NA
AXX11838.1|881374_882673_+	LysM peptidoglycan-binding domain-containing protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
AXX11839.1|882721_883588_-	DUF815 domain-containing protein	NA	NA	NA	NA	NA
AXX11840.1|883747_884089_+	immunogenic membrane protein YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
AXX11841.1|884207_886535_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
>prophage 3
CP025821	Brucella melitensis strain CIT31 chromosome 1, complete sequence	2125815	955560	965581	2125815	integrase,transposase	Brucella_phage(37.5%)	16	955443:955483	970556:970596
955443:955483	attL	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
AXX11902.1|955560_956586_-|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
AXX11903.1|956572_956776_-	hypothetical protein	NA	NA	NA	NA	NA
AXX11904.1|956778_956994_-	hypothetical protein	NA	NA	NA	NA	NA
AXX11905.1|956990_957194_-	hypothetical protein	NA	NA	NA	NA	NA
AXX11906.1|957243_957948_+	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
AXX11907.1|957944_958175_+	hypothetical protein	NA	NA	NA	NA	NA
AXX11908.1|958171_958447_+	hypothetical protein	NA	NA	NA	NA	NA
AXX11909.1|958469_958946_+	hypothetical protein	NA	NA	NA	NA	NA
AXX13016.1|959291_960002_+	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
AXX11910.1|960349_960520_-	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
AXX11911.1|960518_960752_+	hypothetical protein	NA	NA	NA	NA	NA
AXX11912.1|960867_961182_-	hypothetical protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
AXX11913.1|961181_961427_-	hypothetical protein	NA	NA	NA	NA	NA
AXX11914.1|962267_963024_+|transposase	IS5-like element IS711 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
AXX11915.1|963025_963718_+	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
AXX11916.1|964129_965581_+	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
970556:970596	attR	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
