The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
CP025819	Brucella melitensis strain CIT21 chromosome 1, complete sequence	2125703	874532	886444	2125703	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
AXX05558.1|874532_875384_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
AXX05559.1|875376_876102_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
AXX05560.1|876247_876466_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
AXX05561.1|876576_877143_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AXX05562.1|877139_877964_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
AXX06728.1|878040_879324_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
AXX05563.1|879472_880240_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
AXX05564.1|880236_880905_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
AXX05565.1|881049_881235_+	hypothetical protein	NA	NA	NA	NA	NA
AXX05566.1|881283_882582_+	LysM peptidoglycan-binding domain-containing protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
AXX05567.1|882630_883497_-	DUF815 domain-containing protein	NA	NA	NA	NA	NA
AXX05568.1|883656_883998_+	immunogenic membrane protein YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
AXX05569.1|884116_886444_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
>prophage 3
CP025819	Brucella melitensis strain CIT21 chromosome 1, complete sequence	2125703	955470	965491	2125703	integrase,transposase	Brucella_phage(37.5%)	16	955353:955393	970466:970506
955353:955393	attL	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
AXX05628.1|955470_956496_-|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
AXX05629.1|956482_956686_-	hypothetical protein	NA	NA	NA	NA	NA
AXX05630.1|956688_956904_-	hypothetical protein	NA	NA	NA	NA	NA
AXX05631.1|956900_957104_-	hypothetical protein	NA	NA	NA	NA	NA
AXX05632.1|957153_957858_+	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
AXX05633.1|957854_958085_+	hypothetical protein	NA	NA	NA	NA	NA
AXX05634.1|958081_958357_+	hypothetical protein	NA	NA	NA	NA	NA
AXX05635.1|958379_958856_+	hypothetical protein	NA	NA	NA	NA	NA
AXX06734.1|959201_959912_+	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
AXX05636.1|960259_960430_-	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
AXX05637.1|960428_960662_+	hypothetical protein	NA	NA	NA	NA	NA
AXX05638.1|960777_961092_-	hypothetical protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
AXX05639.1|961091_961337_-	hypothetical protein	NA	NA	NA	NA	NA
AXX05640.1|962177_962934_+|transposase	IS5-like element IS711 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
AXX05641.1|962935_963628_+	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
AXX05642.1|964039_965491_+	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
970466:970506	attR	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
