The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP016990	Aeromonas hydrophila strain ZYAH75 chromosome, complete genome	4955171	1028214	1035724	4955171		Staphylococcus_phage(50.0%)	8	NA	NA
AXV33274.1|1028214_1029468_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.5	2.3e-100
AXV36568.1|1029596_1030031_+	hypothetical protein	NA	NA	NA	NA	NA
AXV33275.1|1030165_1030615_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AXV33276.1|1030711_1031821_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.2	4.7e-49
AXV33277.1|1031875_1032529_+	riboflavin synthase subunit alpha	NA	A0A2I2L4R9	Orpheovirus	36.4	2.7e-20
AXV33278.1|1032670_1033780_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	39.2	4.7e-65
AXV33279.1|1033843_1035055_-	GlyGly-CTERM sorting domain-containing protein	NA	V5LS29	Emiliania_huxleyi_virus	27.2	2.3e-09
AXV33280.1|1035253_1035724_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	3.5e-30
>prophage 2
CP016990	Aeromonas hydrophila strain ZYAH75 chromosome, complete genome	4955171	1890895	1935580	4955171	terminase,bacteriocin,capsid,portal	Aeromonas_phage(88.24%)	57	NA	NA
AXV33977.1|1890895_1892131_-	hypothetical protein	NA	A0A1I9KF78	Aeromonas_phage	58.9	2.7e-138
AXV33978.1|1892318_1892723_-	hypothetical protein	NA	A0A1I9KG69	Aeromonas_phage	77.2	6.5e-49
AXV33979.1|1892783_1893533_-	hypothetical protein	NA	A0A2H5BFW5	Vibrio_phage	69.6	6.5e-103
AXV33980.1|1893639_1894254_-	hypothetical protein	NA	NA	NA	NA	NA
AXV33981.1|1894250_1894556_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1I9KFD3	Aeromonas_phage	94.8	1.3e-46
AXV33982.1|1894600_1894948_-	hypothetical protein	NA	NA	NA	NA	NA
AXV33983.1|1894977_1895196_-	hypothetical protein	NA	A0A1I9KF77	Aeromonas_phage	94.4	4.6e-33
AXV33984.1|1895159_1896305_-	hypothetical protein	NA	A0A1I9KFE6	Aeromonas_phage	43.3	3.4e-18
AXV33985.1|1896301_1896709_-	hypothetical protein	NA	A0A1I9KF82	Aeromonas_phage	75.0	3.5e-18
AXV33986.1|1896705_1897050_-	hypothetical protein	NA	NA	NA	NA	NA
AXV33987.1|1897046_1897958_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	53.0	3.7e-84
AXV33988.1|1898213_1898816_-	hypothetical protein	NA	H9C0R1	Aeromonas_phage	56.9	6.2e-64
AXV33989.1|1898952_1900170_-	hypothetical protein	NA	A0A1I9KG78	Aeromonas_phage	88.6	4.1e-171
AXV33990.1|1900219_1901308_-	hypothetical protein	NA	A0A1I9KFA0	Aeromonas_phage	89.9	4.0e-93
AXV33991.1|1901356_1902391_-	hypothetical protein	NA	A0A2I7RQF1	Vibrio_phage	56.5	6.3e-64
AXV33992.1|1902387_1903233_-	exodeoxyribonuclease VIII	NA	A0A1I9KFF5	Aeromonas_phage	96.1	3.3e-164
AXV33993.1|1903229_1903595_-	hypothetical protein	NA	A0A1I9KFC9	Aeromonas_phage	71.9	5.5e-39
AXV33994.1|1903597_1903789_-	hypothetical protein	NA	A0A1I9KG01	Aeromonas_phage	85.5	2.3e-20
AXV33995.1|1904848_1905094_-	hypothetical protein	NA	A0A1I9KF98	Aeromonas_phage	92.6	3.3e-32
AXV33996.1|1905563_1906145_-	hypothetical protein	NA	NA	NA	NA	NA
AXV33997.1|1906316_1906523_+	hypothetical protein	NA	NA	NA	NA	NA
AXV33998.1|1906556_1907258_+	DNA-binding protein	NA	A0A1I9KFA9	Aeromonas_phage	99.1	7.9e-127
AXV33999.1|1907299_1907689_+	hypothetical protein	NA	A0A1I9KF96	Aeromonas_phage	97.5	4.3e-58
AXV34000.1|1907693_1907912_+	hypothetical protein	NA	A0A1I9KFG0	Aeromonas_phage	95.8	3.6e-30
AXV34001.1|1908187_1909105_+	hypothetical protein	NA	A0A1I9KG10	Aeromonas_phage	61.2	1.4e-99
AXV34002.1|1909104_1909776_+	hypothetical protein	NA	A0A1I9KFB0	Aeromonas_phage	99.1	1.2e-119
AXV34003.1|1909762_1910065_+	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	94.0	7.7e-47
AXV34004.1|1910141_1910435_+	hypothetical protein	NA	A0A1I9KG94	Aeromonas_phage	89.7	4.1e-45
AXV34005.1|1910607_1911021_+	NinB protein	NA	A0A0P0ZCW6	Stx2-converting_phage	57.8	1.4e-35
AXV34006.1|1911001_1911568_+	hypothetical protein	NA	A0A2D1GLP6	Escherichia_phage	55.8	8.2e-50
AXV34007.1|1911554_1911866_+	hypothetical protein	NA	A0A1I9KFA7	Aeromonas_phage	92.2	1.2e-50
AXV34008.1|1911862_1912285_+	hypothetical protein	NA	A0A1I9KG18	Aeromonas_phage	87.1	1.1e-67
AXV34009.1|1912281_1912983_+	hypothetical protein	NA	A0A1I9KFB9	Aeromonas_phage	87.6	4.5e-106
AXV34010.1|1913151_1913466_+	hypothetical protein	NA	A0A1I9KFB8	Aeromonas_phage	99.0	8.8e-54
AXV34011.1|1913465_1913948_+	TIGR02594 family protein	NA	A0A1I9KGA3	Aeromonas_phage	99.4	1.7e-88
AXV34012.1|1914001_1914226_+	hypothetical protein	NA	A0A1I9KFG6	Aeromonas_phage	100.0	1.7e-30
AXV34013.1|1914227_1914458_+	hypothetical protein	NA	A0A1I9KFC5	Aeromonas_phage	96.1	3.7e-33
AXV36584.1|1914505_1914691_+	hypothetical protein	NA	A0A1I9KFC1	Aeromonas_phage	96.7	7.8e-26
AXV34014.1|1914691_1915564_+|terminase	terminase	terminase	A0A1I9KFG9	Aeromonas_phage	89.3	1.6e-129
AXV34015.1|1915560_1917261_+|terminase	terminase	terminase	A0A1I9KFB6	Aeromonas_phage	98.1	0.0e+00
AXV34016.1|1917260_1919387_+|portal	portal protein	portal	A0A1I9KFF7	Aeromonas_phage	95.9	0.0e+00
AXV34017.1|1919857_1920796_+	hypothetical protein	NA	A0A1I9KFD1	Aeromonas_phage	87.1	6.4e-140
AXV34018.1|1920867_1922085_+|capsid	major capsid protein	capsid	A0A1I9KFC6	Aeromonas_phage	93.6	3.5e-223
AXV34019.1|1922148_1922538_+	hypothetical protein	NA	A0A1I9KGB3	Aeromonas_phage	76.0	2.9e-46
AXV34020.1|1922604_1923045_+	hypothetical protein	NA	A0A1I9KFH0	Aeromonas_phage	81.6	6.4e-50
AXV34021.1|1923047_1923629_+	hypothetical protein	NA	A0A1I9KFD5	Aeromonas_phage	85.5	1.5e-91
AXV34022.1|1923640_1924318_+	hypothetical protein	NA	A0A1I9KFD0	Aeromonas_phage	96.0	1.5e-122
AXV34023.1|1924327_1926043_+	hypothetical protein	NA	A0A1I9KFH7	Aeromonas_phage	73.6	3.4e-54
AXV34024.1|1926039_1926270_+	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	60.6	8.5e-22
AXV34025.1|1926262_1926562_+	hypothetical protein	NA	NA	NA	NA	NA
AXV36585.1|1926663_1928271_+	hypothetical protein	NA	A0A1I9KFD2	Aeromonas_phage	87.5	2.7e-287
AXV34026.1|1928270_1932437_+	hypothetical protein	NA	A0A1I9KGC4	Aeromonas_phage	76.0	7.2e-236
AXV34027.1|1932415_1932796_+	hypothetical protein	NA	A0A1I9KFI0	Aeromonas_phage	73.9	6.1e-49
AXV34028.1|1932805_1933438_+	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	84.9	9.0e-90
AXV34029.1|1933448_1933829_+	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	82.3	1.1e-47
AXV34030.1|1933828_1934068_+|bacteriocin	bacteriocin	bacteriocin	A0A1I9KFI4	Aeromonas_phage	63.5	1.7e-17
AXV34031.1|1934077_1935580_+	hypothetical protein	NA	A0A1I9KFD9	Aeromonas_phage	30.4	7.8e-39
>prophage 3
CP016990	Aeromonas hydrophila strain ZYAH75 chromosome, complete genome	4955171	3501911	3551263	4955171	holin,integrase,transposase	Vibrio_phage(27.27%)	45	3498773:3498788	3519070:3519085
3498773:3498788	attL	CGGCGCAGCACAAGGC	NA	NA	NA	NA
AXV35279.1|3501911_3505298_+|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
AXV35280.1|3505411_3506359_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
AXV35281.1|3506371_3506824_+	microcompartment protein	NA	NA	NA	NA	NA
AXV35282.1|3506820_3507441_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
AXV35283.1|3507452_3508145_+	hypothetical protein	NA	NA	NA	NA	NA
AXV35284.1|3508164_3508578_+	transporter	NA	NA	NA	NA	NA
AXV35285.1|3508595_3508925_+	multidrug transporter	NA	NA	NA	NA	NA
AXV35286.1|3509248_3510457_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	37.9	1.3e-60
AXV36638.1|3511080_3512151_-	histone-like nucleoid structuring protein	NA	NA	NA	NA	NA
AXV35287.1|3513250_3513454_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AXV35288.1|3514061_3514805_+	hypothetical protein	NA	NA	NA	NA	NA
AXV35289.1|3514940_3515285_-	transcriptional regulator	NA	NA	NA	NA	NA
AXV35290.1|3515554_3515920_+	hypothetical protein	NA	NA	NA	NA	NA
AXV35291.1|3516077_3516620_+	hypothetical protein	NA	NA	NA	NA	NA
AXV35292.1|3516699_3517263_+	hypothetical protein	NA	NA	NA	NA	NA
AXV36639.1|3517298_3517724_+	hypothetical protein	NA	NA	NA	NA	NA
AXV35293.1|3517734_3518163_+	hypothetical protein	NA	NA	NA	NA	NA
AXV35294.1|3518137_3518440_+	hypothetical protein	NA	NA	NA	NA	NA
AXV35295.1|3518530_3519034_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AXV35296.1|3519254_3519761_+	hypothetical protein	NA	NA	NA	NA	NA
3519070:3519085	attR	GCCTTGTGCTGCGCCG	NA	NA	NA	NA
AXV35297.1|3519806_3520169_+	hypothetical protein	NA	NA	NA	NA	NA
AXV36640.1|3520195_3520459_+	hypothetical protein	NA	NA	NA	NA	NA
AXV35298.1|3520531_3521074_+	hypothetical protein	NA	NA	NA	NA	NA
AXV35299.1|3521075_3521432_+	hypothetical protein	NA	NA	NA	NA	NA
AXV36641.1|3521624_3522623_+	hypothetical protein	NA	NA	NA	NA	NA
AXV35300.1|3522662_3523640_+	subtype I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	36.3	4.7e-45
AXV35301.1|3523636_3526924_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	29.1	6.4e-62
AXV35302.1|3527311_3528505_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
AXV36642.1|3528501_3529476_+	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
AXV35303.1|3529490_3530525_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YYX4	Vibrio_phage	40.3	1.5e-49
AXV35304.1|3530534_3531086_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
AXV35305.1|3534532_3535297_-|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXV35306.1|3535408_3535678_+	transcriptional regulator	NA	NA	NA	NA	NA
AXV35307.1|3535678_3536755_+	replication protein A	NA	NA	NA	NA	NA
AXV35308.1|3536813_3537332_+	glycosidase	NA	NA	NA	NA	NA
AXV36643.1|3537908_3538745_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXV35309.1|3538744_3539362_-	APH(3'') family aminoglycoside O-phosphotransferase	NA	Q75ZG1	Hepacivirus	36.2	4.0e-18
AXV35310.1|3539343_3539526_-	strA	NA	NA	NA	NA	NA
AXV35311.1|3539613_3540228_-	transposon DNA-invertase	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
AXV35312.1|3540353_3543239_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
AXV35313.1|3545339_3546554_+	chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
AXV35314.1|3546581_3547565_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXV36644.1|3549692_3550148_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AXV35315.1|3550144_3550348_-	hypothetical protein	NA	NA	NA	NA	NA
AXV35316.1|3550498_3551263_-|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 4
CP016990	Aeromonas hydrophila strain ZYAH75 chromosome, complete genome	4955171	4053460	4063396	4955171	tRNA	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
AXV35749.1|4053460_4055317_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
AXV35750.1|4055539_4057327_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	5.2e-74
AXV35751.1|4057415_4057859_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	48.6	1.7e-26
AXV35752.1|4058269_4059283_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	9.1e-108
AXV35753.1|4059367_4060351_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	1.7e-34
AXV35754.1|4060398_4061439_-	peptidoglycan-binding protein	NA	A0A0A7NU10	Lactobacillus_phage	35.6	6.6e-13
AXV35755.1|4061449_4062031_-	hypothetical protein	NA	NA	NA	NA	NA
AXV35756.1|4062027_4062645_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	4.0e-34
AXV35757.1|4062649_4063396_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.1	7.2e-70
>prophage 5
CP016990	Aeromonas hydrophila strain ZYAH75 chromosome, complete genome	4955171	4896264	4932599	4955171	transposase,integrase,tRNA	Escherichia_phage(30.0%)	39	4911560:4911589	4936250:4936279
AXV36490.1|4896264_4898154_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AXV36491.1|4898663_4899113_-	sulfite reductase	NA	NA	NA	NA	NA
AXV36492.1|4899496_4901605_+	ligand-gated channel	NA	NA	NA	NA	NA
AXV36493.1|4901684_4903343_+	multidrug ABC transporter permease/ATP-binding protein	NA	NA	NA	NA	NA
AXV36494.1|4903365_4904130_+	iron-hydroxamate transporter ATP-binding subunit	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	4.5e-11
AXV36495.1|4904148_4905075_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXV36496.1|4905071_4907054_+	Fe3+-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AXV36497.1|4907474_4908794_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXV36498.1|4908793_4909048_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXV36499.1|4909217_4909646_-	hypothetical protein	NA	NA	NA	NA	NA
AXV36500.1|4909638_4910088_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AXV36501.1|4910534_4911158_+	resolvase	NA	NA	NA	NA	NA
4911560:4911589	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
AXV36502.1|4911584_4912019_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AXV36503.1|4912090_4912441_+	mercuric transport protein	NA	NA	NA	NA	NA
AXV36504.1|4912454_4912730_+	mercuric transport protein periplasmic component	NA	NA	NA	NA	NA
AXV36680.1|4912765_4913188_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AXV36505.1|4913239_4914934_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AXV36506.1|4914951_4915314_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AXV36507.1|4915310_4915547_+	mercury resistance protein	NA	NA	NA	NA	NA
AXV36508.1|4915543_4916251_+	EAL domain protein	NA	NA	NA	NA	NA
AXV36509.1|4916289_4917594_+|integrase	integrase	integrase	NA	NA	NA	NA
AXV36510.1|4917640_4918345_+|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AXV36511.1|4918534_4919350_-	APH(3') family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AXV36512.1|4919500_4920205_+|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AXV36513.1|4920326_4921232_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXV36514.1|4921228_4922467_+	MFS transporter	NA	NA	NA	NA	NA
AXV36515.1|4922466_4923051_+	macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXV36681.1|4923164_4923353_+	hypothetical protein	NA	NA	NA	NA	NA
AXV36516.1|4923543_4924308_-|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXV36682.1|4924450_4924717_-	mobilization protein	NA	NA	NA	NA	NA
AXV36517.1|4924937_4925411_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	33.8	5.3e-18
AXV36683.1|4925445_4926237_-	ANT(3'') family aminoglycoside nucleotidyltransferase	NA	NA	NA	NA	NA
AXV36518.1|4926253_4927054_-	class D beta-lactamase	NA	NA	NA	NA	NA
AXV36684.1|4927318_4928578_-	chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
AXV36519.1|4928792_4929347_-	AacA4 family aminoglycoside N(6')-acetyltransferase	NA	NA	NA	NA	NA
AXV36520.1|4929435_4929768_-	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	34.3	3.5e-08
AXV36521.1|4930024_4930681_-	QnrVC family quinolone resistance pentapeptide repeat protein	NA	NA	NA	NA	NA
AXV36522.1|4931032_4932046_+|integrase	integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXV36685.1|4932320_4932599_+|transposase	transposase	transposase	NA	NA	NA	NA
4936250:4936279	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
