The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030281	Escherichia coli strain E308 chromosome, complete genome	4786360	45507	52017	4786360		Enterobacteria_phage(100.0%)	9	NA	NA
AXT78875.1|45507_47841_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
AXT78876.1|47855_48176_-	hypothetical protein	NA	NA	NA	NA	NA
AXT78877.1|48311_48767_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
AXT78878.1|48759_49047_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
AXT78879.1|49039_49639_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
AXT78880.1|49635_49902_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AXT78881.1|50453_51188_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.4	6.1e-130
AXT78882.1|51184_51430_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
AXT78883.1|51444_52017_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	98.9	5.3e-97
>prophage 2
CP030281	Escherichia coli strain E308 chromosome, complete genome	4786360	1023009	1036144	4786360		Escherichia_phage(50.0%)	12	NA	NA
AXT79765.1|1023009_1023771_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AXT79766.1|1023764_1024391_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AXT79767.1|1024530_1025622_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AXT79768.1|1025684_1026677_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AXT79769.1|1026770_1028135_-	permease	NA	NA	NA	NA	NA
AXT79770.1|1028223_1029000_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AXT79771.1|1029004_1029643_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AXT79772.1|1029639_1030902_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AXT79773.1|1030898_1031807_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AXT79774.1|1032002_1032770_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AXT79775.1|1032820_1033477_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
AXT79776.1|1033582_1036144_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
>prophage 3
CP030281	Escherichia coli strain E308 chromosome, complete genome	4786360	1071225	1160455	4786360	tRNA,tail,plate,portal,capsid,head,lysis,integrase	Salmonella_phage(70.91%)	97	1114696:1114744	1149180:1149228
AXT79810.1|1071225_1073856_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AXT79811.1|1074090_1074276_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AXT79812.1|1075733_1076300_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AXT79813.1|1076296_1076725_+	DedA family protein	NA	NA	NA	NA	NA
AXT79814.1|1076797_1078354_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AXT79815.1|1078503_1079019_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AXT79816.1|1079082_1080621_-	multidrug effux MFS transporter subunit EmrB	NA	NA	NA	NA	NA
AXT79817.1|1080637_1081810_-	multidrug export protein EmrA	NA	NA	NA	NA	NA
AXT79818.1|1081936_1082467_-	transcriptional regulator	NA	NA	NA	NA	NA
AXT79819.1|1082557_1082893_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
AXT79820.1|1082882_1083620_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXT79821.1|1083743_1084928_-	MFS transporter	NA	NA	NA	NA	NA
AXT79822.1|1084993_1085188_+	hypothetical protein	NA	NA	NA	NA	NA
AXT79823.1|1085219_1086212_-	proline/glycine betaine ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
AXT79824.1|1086269_1087334_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AXT79825.1|1087326_1088529_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
AXT79826.1|1089655_1090618_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	2.7e-133
AXT79827.1|1090627_1092772_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
AXT79828.1|1092744_1093155_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AXT79829.1|1093151_1093397_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
AXT79830.1|1093644_1093974_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
AXT79831.1|1094125_1094470_+	DUF2002 family protein	NA	NA	NA	NA	NA
AXT79832.1|1094506_1094956_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
AXT79833.1|1095624_1096029_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
AXT79834.1|1096075_1096600_-	rhodanese-like domain-containing protein YgaP	NA	NA	NA	NA	NA
AXT79835.1|1096609_1096909_-	transcriptional regulator	NA	NA	NA	NA	NA
AXT79836.1|1097091_1097250_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AXT79837.1|1097333_1097783_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
AXT79838.1|1097783_1098446_-	transcriptional regulator	NA	NA	NA	NA	NA
AXT79839.1|1098466_1099867_-	GABA permease	NA	NA	NA	NA	NA
AXT79840.1|1100104_1101385_-	4-aminobutyrate aminotransferase GabT	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
AXT79841.1|1101398_1102847_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXT79842.1|1102869_1104138_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
AXT79843.1|1104157_1105135_-	protein CsiD	NA	NA	NA	NA	NA
AXT79844.1|1109108_1109591_+	hypothetical protein	NA	NA	NA	NA	NA
AXT79845.1|1109690_1110482_+	hypothetical protein	NA	NA	NA	NA	NA
AXT79846.1|1110836_1111013_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	70.0	3.3e-10
AXT79847.1|1113303_1114533_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	86.6	4.6e-207
1114696:1114744	attL	TATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AXT79848.1|1114876_1116397_-	hypothetical protein	NA	NA	NA	NA	NA
AXT79849.1|1116409_1117423_-|integrase	integrase	integrase	E5G6L0	Salmonella_phage	95.5	7.7e-192
AXT79850.1|1117424_1118057_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	91.0	8.1e-107
AXT79851.1|1118176_1118425_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	71.6	1.5e-24
AXT79852.1|1118457_1118967_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	96.4	3.5e-84
AXT83190.1|1118974_1119175_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
AXT79853.1|1119138_1119480_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AXT79854.1|1119547_1119781_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
AXT79855.1|1119780_1120008_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AXT79856.1|1120004_1120862_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	7.1e-162
AXT79857.1|1120858_1123273_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.3	0.0e+00
AXT79858.1|1123425_1123614_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AXT79859.1|1123552_1123858_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
AXT79860.1|1124017_1124443_-	hypothetical protein	NA	NA	NA	NA	NA
AXT79861.1|1124871_1126524_+	NTPase	NA	X2KLG0	Campylobacter_phage	23.1	1.3e-15
AXT79862.1|1126560_1127589_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.6	2.1e-168
AXT79863.1|1127588_1129355_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
AXT79864.1|1129497_1130331_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.8	1.4e-122
AXT79865.1|1130347_1131406_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AXT79866.1|1131409_1132060_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.8	9.6e-111
AXT79867.1|1132155_1132620_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
AXT79868.1|1132619_1132823_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AXT79869.1|1132826_1133042_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	4.1e-26
AXT79870.1|1133061_1133535_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AXT79871.1|1133536_1133914_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	38.4	1.1e-15
AXT79872.1|1133910_1134339_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	1.3e-47
AXT79873.1|1134268_1134472_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.9	6.8e-23
AXT79874.1|1134434_1134866_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	7.6e-72
AXT79875.1|1134858_1135305_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.1e-62
AXT79876.1|1135373_1135952_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	9.4e-94
AXT79877.1|1135948_1136308_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
AXT79878.1|1136294_1137203_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.7e-143
AXT79879.1|1137195_1137801_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
AXT79880.1|1139352_1139955_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	2.0e-99
AXT79881.1|1139926_1140355_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	50.7	8.1e-26
AXT79882.1|1140717_1141284_+	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	84.2	3.8e-87
AXT79883.1|1141426_1142599_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.8	1.6e-204
AXT79884.1|1142608_1143124_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AXT79885.1|1143178_1143481_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AXT79886.1|1143495_1143615_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AXT79887.1|1143607_1146685_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AXT79888.1|1146681_1147167_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.4e-66
AXT79889.1|1147163_1148264_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	2.2e-176
AXT79890.1|1148332_1148551_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
AXT79891.1|1148577_1149060_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	3.5e-17
AXT79892.1|1149760_1150243_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1149180:1149228	attR	TATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AXT79893.1|1150374_1150851_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AXT79894.1|1150840_1151131_+	RnfH family protein	NA	NA	NA	NA	NA
AXT79895.1|1151192_1151534_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXT79896.1|1151682_1153344_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AXT79897.1|1153429_1154308_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXT83191.1|1154239_1154434_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AXT79898.1|1154430_1155024_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXT83192.1|1155078_1156320_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AXT83193.1|1156385_1157177_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AXT79899.1|1157343_1158705_+	signal recognition particle protein	NA	NA	NA	NA	NA
AXT79900.1|1158841_1159090_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXT83194.1|1159108_1159657_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXT79901.1|1159687_1160455_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 4
CP030281	Escherichia coli strain E308 chromosome, complete genome	4786360	1422033	1466366	4786360	terminase,integrase,head,protease,lysis,holin,tail	Salmonella_phage(43.28%)	71	1421945:1421960	1465283:1465298
1421945:1421960	attL	ATGGTGTCCCCTGCAG	NA	NA	NA	NA
AXT80128.1|1422033_1422234_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AXT80129.1|1422291_1422459_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.1e-26
AXT80130.1|1422547_1422829_-	hypothetical protein	NA	NA	NA	NA	NA
AXT80131.1|1422943_1423636_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	48.6	1.3e-60
AXT80132.1|1423638_1423830_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
AXT80133.1|1423831_1424356_-	hypothetical protein	NA	A0A0S1S155	Klebsiella_phage	59.0	1.3e-17
AXT80134.1|1424352_1424835_-	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	59.7	7.5e-44
AXT83201.1|1424831_1424996_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	5.5e-23
AXT80135.1|1425006_1425303_-	RecBCD nuclease inhibitor	NA	G9L665	Escherichia_phage	84.7	8.1e-41
AXT80136.1|1425326_1425914_-	DUF669 domain-containing protein	NA	G9L666	Escherichia_phage	99.0	3.2e-105
AXT80137.1|1425910_1426591_-	ATP-binding protein	NA	K7PMI2	Enterobacteria_phage	100.0	5.8e-127
AXT80138.1|1426599_1426788_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
AXT80139.1|1426784_1426988_-	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	100.0	1.5e-30
AXT80140.1|1426890_1427037_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A2D1GLZ1	Escherichia_phage	100.0	3.8e-20
AXT83202.1|1427060_1428029_-	cell envelope biogenesis protein TolA	NA	G5DA88	Enterobacteria_phage	100.0	7.7e-56
AXT83203.1|1428202_1428826_-	hypothetical protein	NA	A4KWT2	Enterobacteria_phage	99.0	1.7e-109
AXT83204.1|1428891_1429116_-	hypothetical protein	NA	K7PJZ1	Enterobacterial_phage	98.6	2.3e-32
AXT80141.1|1429119_1429392_-	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
AXT83205.1|1429863_1430859_-	SppA protein	NA	NA	NA	NA	NA
AXT80142.1|1431034_1431739_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	1.9e-133
AXT80143.1|1431852_1432086_+	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	98.7	2.3e-35
AXT80144.1|1432223_1432523_+	hypothetical protein	NA	A0A2H4FNE8	Salmonella_phage	94.9	5.8e-47
AXT80145.1|1432545_1432818_+	hypothetical protein	NA	G9L679	Escherichia_phage	96.7	7.4e-41
AXT80146.1|1432880_1433768_+	replication protein	NA	A5VW95	Enterobacteria_phage	99.0	1.2e-143
AXT80147.1|1433764_1435141_+	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.3	1.1e-252
AXT80148.1|1435427_1435874_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	93.2	2.9e-74
AXT80149.1|1435870_1436404_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	97.1	1.6e-95
AXT80150.1|1436397_1437270_+	hypothetical protein	NA	I6R0S6	Salmonella_phage	99.0	1.0e-176
AXT80151.1|1437266_1437440_+	protein ninD	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
AXT80152.1|1437406_1437589_+	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
AXT80153.1|1437585_1437765_+	protein ninF	NA	Q716C4	Shigella_phage	86.0	3.9e-14
AXT80154.1|1437727_1438234_+	HNH endonuclease	NA	A0A248SKL5	Klebsiella_phage	48.5	6.4e-38
AXT80155.1|1438124_1438295_+	ninF	NA	NA	NA	NA	NA
AXT80156.1|1438287_1438899_+	recombination protein NinG	NA	Q716C3	Shigella_phage	100.0	2.7e-99
AXT80157.1|1438942_1439461_+	DUF1133 family protein	NA	G8C7N2	Escherichia_phage	98.8	4.5e-95
AXT80158.1|1439970_1440294_+|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	100.0	2.2e-52
AXT80159.1|1440277_1440754_+	lysozyme	NA	K7P7Y6	Enterobacteria_phage	100.0	7.5e-89
AXT80160.1|1440737_1441199_+|lysis	lysis protein	lysis	K7P6Y5	Enterobacteria_phage	100.0	2.2e-77
AXT80161.1|1441402_1441924_+	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	99.4	7.2e-101
AXT80162.1|1442212_1442593_+	hypothetical protein	NA	Q716B1	Shigella_phage	98.4	1.6e-65
AXT80163.1|1442696_1443194_+	HNH endonuclease	NA	T1SAR3	Salmonella_phage	39.6	4.7e-25
AXT80164.1|1443195_1443750_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.4	4.0e-65
AXT80165.1|1443752_1445375_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.7	0.0e+00
AXT80166.1|1445374_1446841_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	93.9	1.6e-267
AXT80167.1|1446728_1447466_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	95.5	1.3e-108
AXT80168.1|1447480_1448701_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	90.5	7.8e-207
AXT80169.1|1448704_1449211_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
AXT80170.1|1449222_1450164_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	6.3e-156
AXT80171.1|1450205_1450427_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
AXT80172.1|1450392_1450800_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	1.5e-69
AXT80173.1|1450796_1451351_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	85.9	7.9e-82
AXT80174.1|1451337_1451727_+|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	95.3	4.3e-66
AXT80175.1|1451701_1452265_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
AXT80176.1|1452268_1453414_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	1.8e-160
AXT80177.1|1453424_1453865_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
AXT80178.1|1453868_1454321_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.0	2.2e-58
AXT80179.1|1454332_1454509_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	70.0	1.6e-12
AXT80180.1|1454498_1456484_+	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	53.7	6.8e-176
AXT80181.1|1456483_1457071_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
AXT80182.1|1457070_1457373_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	5.3e-48
AXT80183.1|1457375_1458446_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.4	9.1e-159
AXT80184.1|1458442_1458799_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	86.5	1.0e-29
AXT80185.1|1459124_1459697_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
AXT80186.1|1459754_1460507_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	65.9	1.6e-88
AXT80187.1|1460506_1460860_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
AXT80188.1|1460859_1462059_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	7.5e-186
AXT80189.1|1462055_1462736_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.3	1.7e-102
AXT80190.1|1462735_1463440_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	45.7	1.9e-27
AXT80191.1|1463442_1463877_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	50.7	5.9e-24
AXT80192.1|1463964_1465122_-|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	99.7	1.3e-222
AXT80193.1|1465433_1466366_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.0	5.1e-166
1465283:1465298	attR	ATGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 5
CP030281	Escherichia coli strain E308 chromosome, complete genome	4786360	1709904	1719321	4786360	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AXT80408.1|1709904_1710831_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AXT80409.1|1710835_1711567_+	ABC transporter permease	NA	NA	NA	NA	NA
AXT80410.1|1711547_1711655_-	hypothetical protein	NA	NA	NA	NA	NA
AXT80411.1|1711714_1712446_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AXT80412.1|1712667_1714353_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AXT80413.1|1714349_1715069_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXT80414.1|1715115_1715586_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AXT80415.1|1715627_1716089_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AXT80416.1|1717287_1719321_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 6
CP030281	Escherichia coli strain E308 chromosome, complete genome	4786360	1838879	1850232	4786360	transposase	Enterobacteria_phage(25.0%)	16	NA	NA
AXT80519.1|1838879_1840058_+	DUF4102 domain-containing protein	NA	K7P7J2	Enterobacteria_phage	99.5	3.4e-231
AXT80520.1|1840038_1840230_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
AXT80521.1|1840260_1840428_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.8e-26
AXT83220.1|1840360_1840606_+	hypothetical protein	NA	NA	NA	NA	NA
AXT80522.1|1840646_1840799_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	73.7	5.1e-07
AXT80523.1|1840776_1841061_-	hypothetical protein	NA	NA	NA	NA	NA
AXT80524.1|1841145_1841562_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	74.4	7.4e-32
AXT80525.1|1841715_1841994_+	hypothetical protein	NA	Q716D5	Shigella_phage	98.9	1.1e-42
AXT80526.1|1842176_1842974_+	replication of DNA	NA	K7PJZ3	Enterobacterial_phage	99.2	5.4e-148
AXT80527.1|1843000_1843579_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.0	5.3e-105
AXT80528.1|1844021_1845623_-	hypothetical protein	NA	NA	NA	NA	NA
AXT80529.1|1845615_1846539_-	glycosyltransferase	NA	U5P087	Shigella_phage	91.1	3.9e-158
AXT80530.1|1846535_1846898_-	GtrA family protein	NA	U5P0S6	Shigella_phage	83.3	5.8e-49
AXT80531.1|1847055_1848276_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXT80532.1|1848335_1848722_+	LexA family transcriptional regulator	NA	O64339	Escherichia_phage	82.8	1.2e-57
AXT80533.1|1849065_1850232_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	5.5e-226
>prophage 7
CP030281	Escherichia coli strain E308 chromosome, complete genome	4786360	2281911	2328449	4786360	tail,terminase,transposase,holin,integrase	Enterobacteria_phage(35.71%)	56	2275866:2275881	2316831:2316846
2275866:2275881	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AXT80938.1|2281911_2283240_+|integrase	integrase	integrase	NA	NA	NA	NA
AXT80939.1|2283596_2284094_+	hypothetical protein	NA	NA	NA	NA	NA
AXT80940.1|2284534_2285626_+	AP2 domain-containing protein	NA	NA	NA	NA	NA
AXT80941.1|2285625_2285838_+	hypothetical protein	NA	NA	NA	NA	NA
AXT80942.1|2285953_2286463_+	hypothetical protein	NA	NA	NA	NA	NA
AXT80943.1|2286549_2287539_+	hypothetical protein	NA	NA	NA	NA	NA
AXT80944.1|2288001_2289480_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	6.8e-120
AXT80945.1|2289678_2289984_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AXT83247.1|2290091_2290802_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AXT80946.1|2290804_2291365_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AXT80947.1|2291399_2291741_-	DUF1283 family protein	NA	NA	NA	NA	NA
AXT80948.1|2291875_2292202_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AXT80949.1|2292238_2292427_+	hypothetical protein	NA	NA	NA	NA	NA
AXT80950.1|2292407_2293622_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AXT80951.1|2295486_2295615_+	transporter	NA	NA	NA	NA	NA
AXT83248.1|2295616_2296411_-|integrase	site-specific integrase	integrase	Q859D2	Escherichia_coli_phage	63.3	1.8e-98
AXT80952.1|2296449_2297670_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXT80953.1|2298255_2298507_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	48.7	6.4e-15
AXT80954.1|2298579_2301051_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
AXT80955.1|2301143_2301335_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXT80956.1|2301331_2301520_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AXT80957.1|2302006_2302624_-	hypothetical protein	NA	NA	NA	NA	NA
AXT83249.1|2302583_2302739_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	3.4e-06
AXT80958.1|2303036_2303456_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
AXT80959.1|2303535_2303790_+	DNA-binding protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
AXT80960.1|2303786_2304212_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AXT80961.1|2304283_2305354_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	1.9e-63
AXT80962.1|2305394_2305817_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.1	2.4e-62
AXT80963.1|2306079_2306994_-	hypothetical protein	NA	NA	NA	NA	NA
AXT80964.1|2308337_2309207_-	hypothetical protein	NA	NA	NA	NA	NA
AXT83250.1|2309463_2309607_+	hypothetical protein	NA	NA	NA	NA	NA
AXT80965.1|2309765_2309978_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
AXT80966.1|2310436_2310715_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
AXT80967.1|2310716_2311766_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
AXT80968.1|2311783_2312161_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.7	6.9e-53
AXT80969.1|2312316_2312841_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
AXT80970.1|2313033_2313993_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AXT80971.1|2313997_2314186_+	hypothetical protein	NA	NA	NA	NA	NA
AXT80972.1|2314390_2315113_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXT80973.1|2315303_2315519_+|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	8.5e-32
AXT80974.1|2315523_2315835_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
AXT80975.1|2315831_2316365_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
AXT80976.1|2316361_2316859_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2316831:2316846	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AXT80977.1|2317222_2317435_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AXT80978.1|2317445_2317634_+	cold-shock protein	NA	NA	NA	NA	NA
AXT80979.1|2317664_2317937_+	hypothetical protein	NA	NA	NA	NA	NA
AXT80980.1|2318109_2318283_+	protein GnsB	NA	NA	NA	NA	NA
AXT80981.1|2318578_2318785_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
AXT80982.1|2319335_2319875_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	1.8e-94
AXT80983.1|2319883_2321434_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.0	2.6e-300
AXT80984.1|2321610_2323017_+|tail	phage tail tape measure protein	tail	K7PKI9	Enterobacteria_phage	75.8	9.7e-68
AXT80985.1|2323016_2323592_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	8.5e-103
AXT80986.1|2323689_2324280_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AXT80987.1|2324597_2324831_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AXT80988.1|2325616_2326900_+	MFS transporter	NA	NA	NA	NA	NA
AXT80989.1|2326988_2328449_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.5	7.3e-42
>prophage 8
CP030281	Escherichia coli strain E308 chromosome, complete genome	4786360	2469814	2523278	4786360	transposase,coat,lysis,protease,tail	Enterobacteria_phage(43.75%)	43	NA	NA
AXT81099.1|2469814_2471776_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.3	2.7e-23
AXT81100.1|2471848_2472385_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXT81101.1|2472437_2473652_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
AXT81102.1|2473691_2474900_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.0	4.6e-207
AXT81103.1|2475430_2476099_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
AXT81104.1|2476401_2476995_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
AXT81105.1|2476991_2477984_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
AXT81106.1|2478107_2479088_+	hypothetical protein	NA	NA	NA	NA	NA
AXT81107.1|2479079_2479619_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
AXT81108.1|2479681_2479906_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AXT81109.1|2479921_2480125_+	hypothetical protein	NA	NA	NA	NA	NA
AXT81110.1|2480045_2481701_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AXT81111.1|2483484_2484408_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXT81112.1|2484445_2486086_-	methyl-accepting chemotaxis protein III	NA	NA	NA	NA	NA
AXT81113.1|2486484_2486634_+	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
AXT81114.1|2486705_2486879_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AXT81115.1|2487123_2487654_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
AXT81116.1|2487842_2488844_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AXT81117.1|2490519_2491320_-	DUF218 domain-containing protein	NA	NA	NA	NA	NA
AXT81118.1|2491591_2495494_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
AXT81119.1|2495694_2496300_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AXT83257.1|2496350_2497643_-	hypothetical protein	NA	NA	NA	NA	NA
AXT81120.1|2497656_2499414_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AXT81121.1|2501446_2501773_-	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
AXT81122.1|2501780_2501966_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
AXT81123.1|2501962_2504602_-	YdbH family protein	NA	NA	NA	NA	NA
AXT81124.1|2504809_2505799_+	lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
AXT81125.1|2505909_2506332_+	heat-shock protein HslJ	NA	NA	NA	NA	NA
AXT81126.1|2506328_2506595_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AXT81127.1|2506868_2510393_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AXT81128.1|2510303_2510555_-	hypothetical protein	NA	NA	NA	NA	NA
AXT81129.1|2510759_2511893_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
AXT81130.1|2512033_2512468_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AXT81131.1|2513439_2513673_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AXT81132.1|2513989_2514580_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AXT81133.1|2514677_2515253_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
AXT81134.1|2515252_2518531_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.5e-06
AXT81135.1|2518817_2519957_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.7	1.7e-158
AXT81136.1|2520289_2520571_-	hypothetical protein	NA	NA	NA	NA	NA
AXT81137.1|2520509_2521967_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AXT81138.1|2522163_2522349_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
AXT81139.1|2522565_2523063_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
AXT81140.1|2523062_2523278_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
>prophage 9
CP030281	Escherichia coli strain E308 chromosome, complete genome	4786360	2533105	2551407	4786360	integrase,holin,tRNA	Escherichia_phage(55.56%)	24	2534442:2534455	2548830:2548843
AXT81151.1|2533105_2535109_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.4e-21
2534442:2534455	attL	GCATTCACCTGCAA	NA	NA	NA	NA
AXT81152.1|2535443_2535866_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
AXT81153.1|2535906_2536977_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
AXT81154.1|2537048_2537474_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AXT81155.1|2537457_2537739_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
AXT81156.1|2537839_2538259_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AXT81157.1|2538468_2538648_+	hypothetical protein	NA	NA	NA	NA	NA
AXT81158.1|2538658_2538814_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AXT81159.1|2538810_2539299_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
AXT81160.1|2539333_2539612_-	hypothetical protein	NA	NA	NA	NA	NA
AXT81161.1|2539740_2539962_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AXT83259.1|2539961_2540132_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AXT81162.1|2540206_2540482_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AXT81163.1|2540583_2543184_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	5.7e-247
AXT81164.1|2543176_2543986_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	2.6e-105
AXT81165.1|2544042_2544237_+	restriction endonuclease	NA	A0A0U2QQP4	Escherichia_phage	95.3	2.2e-31
AXT81166.1|2544229_2544439_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AXT81167.1|2544517_2544733_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AXT81168.1|2544734_2545970_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AXT81169.1|2546021_2546957_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AXT81170.1|2547085_2548459_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	2.5e-52
AXT81171.1|2548488_2548662_-	hypothetical protein	NA	NA	NA	NA	NA
AXT81172.1|2548936_2549920_-	zinc transporter ZntB	NA	NA	NA	NA	NA
2548830:2548843	attR	GCATTCACCTGCAA	NA	NA	NA	NA
AXT83260.1|2550174_2551407_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 10
CP030281	Escherichia coli strain E308 chromosome, complete genome	4786360	2914794	3041701	4786360	tRNA,plate,terminase,capsid,portal,integrase,lysis,protease,head,holin,tail	Escherichia_phage(42.11%)	109	2926733:2926753	3027864:3027884
AXT81524.1|2914794_2916555_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AXT83283.1|2916623_2917142_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AXT81525.1|2917211_2917379_-	ribosome modulation factor	NA	NA	NA	NA	NA
AXT81526.1|2917634_2918198_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AXT81527.1|2918194_2919835_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
AXT81528.1|2919839_2921093_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AXT81529.1|2921222_2923130_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
AXT81530.1|2923141_2925250_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AXT81531.1|2925493_2926603_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AXT81532.1|2926599_2927142_-	cell division protein ZapC	NA	NA	NA	NA	NA
2926733:2926753	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
AXT81533.1|2927315_2928326_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AXT81534.1|2928436_2929147_-	pili assembly chaperone	NA	NA	NA	NA	NA
AXT81535.1|2929139_2929655_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AXT81536.1|2929662_2930205_-	fimbrial protein	NA	NA	NA	NA	NA
AXT81537.1|2933900_2934602_-	fimbrial chaperone protein ElfD	NA	NA	NA	NA	NA
AXT81538.1|2934684_2935224_-	fimbrial subunit ElfA	NA	NA	NA	NA	NA
AXT81539.1|2935579_2936155_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AXT81540.1|2936147_2937107_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXT81541.1|2937103_2938249_+	alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
AXT81542.1|2938259_2939051_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
AXT81543.1|2939047_2939815_+	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
AXT81544.1|2939857_2942470_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
AXT81545.1|2942735_2943938_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AXT81546.1|2944105_2945506_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AXT81547.1|2946108_2947197_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
AXT81548.1|2947212_2947395_-	hypothetical protein	NA	NA	NA	NA	NA
AXT81549.1|2947381_2948572_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AXT81550.1|2948793_2949441_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXT83284.1|2949467_2950016_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AXT81551.1|2950196_2952044_-	transpeptidase	NA	NA	NA	NA	NA
AXT81552.1|2952304_2956765_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
AXT81553.1|2956764_2957469_-	condensin subunit E	NA	NA	NA	NA	NA
AXT81554.1|2957449_2958772_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AXT81555.1|2958768_2959554_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AXT81556.1|2959689_2960469_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AXT81557.1|2960445_2961339_-	hypothetical protein	NA	NA	NA	NA	NA
AXT81558.1|2961492_2962239_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AXT81559.1|2962235_2962418_-	protein YcaR	NA	NA	NA	NA	NA
AXT81560.1|2962469_2963702_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXT81561.1|2963738_2964725_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AXT81562.1|2964721_2966470_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AXT81563.1|2966506_2968771_-	ComEC family protein	NA	NA	NA	NA	NA
AXT81564.1|2968978_2969263_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AXT81565.1|2969422_2971096_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AXT81566.1|2971206_2971890_-	cytidylate kinase	NA	NA	NA	NA	NA
AXT81567.1|2972062_2972827_-|protease	metalloprotease	protease	NA	NA	NA	NA
AXT81568.1|2972995_2974279_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AXT81569.1|2974349_2975438_-	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AXT81570.1|2975636_2976329_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AXT81571.1|2976458_2978219_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AXT81572.1|2978624_2979482_+	formate transporter FocA	NA	NA	NA	NA	NA
AXT81573.1|2979536_2981819_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AXT81574.1|2982137_2982392_-	DNA-binding transcriptional regulator	NA	M1SNR2	Escherichia_phage	100.0	1.3e-44
AXT81575.1|2982437_2983601_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.2	1.2e-204
AXT81576.1|2983600_2984080_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	4.3e-84
AXT81577.1|2984094_2986542_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.9	0.0e+00
AXT81578.1|2986534_2986654_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AXT81579.1|2986686_2986962_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AXT81580.1|2987017_2987536_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AXT81581.1|2987548_2988739_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
AXT81582.1|2988798_2989392_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	97.0	1.0e-103
AXT81583.1|2990493_2990922_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	50.7	1.1e-25
AXT81584.1|2990923_2992045_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	81.7	1.1e-143
AXT81585.1|2992041_2992653_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
AXT81586.1|2992645_2993554_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	5.7e-162
AXT81587.1|2993558_2993906_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AXT81588.1|2994603_2995056_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	1.2e-75
AXT81589.1|2995048_2995516_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
AXT81590.1|2995478_2995652_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AXT81591.1|2995623_2996049_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	95.7	2.7e-66
AXT81592.1|2996036_2996462_-	protein lysA	NA	A0A0F7LDU9	Escherichia_phage	97.9	1.0e-60
AXT81593.1|2996476_2996974_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AXT81594.1|2996973_2997255_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AXT81595.1|2997258_2997462_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AXT81596.1|2997461_2997971_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	3.3e-90
AXT81597.1|2998070_2998808_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	98.8	8.8e-129
AXT81598.1|2998811_2999885_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	98.6	1.1e-199
AXT81599.1|2999943_3000798_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
AXT81600.1|3000971_3002744_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
AXT81601.1|3002743_3003778_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	9.3e-201
AXT81602.1|3004103_3005105_-	hypothetical protein	NA	Q2P9X7	Enterobacteria_phage	99.4	1.0e-188
AXT81603.1|3005106_3006774_-	hypothetical protein	NA	Q2P9X8	Enterobacteria_phage	99.3	3.3e-309
AXT81604.1|3007013_3009284_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.3	0.0e+00
AXT81605.1|3009273_3009549_-	hypothetical protein	NA	S4TP00	Salmonella_phage	98.9	8.6e-45
AXT81606.1|3009545_3009770_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
AXT81607.1|3009769_3010072_-	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	94.0	5.5e-45
AXT81608.1|3010071_3010296_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
AXT83286.1|3010359_3010860_-	replication protein B	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
AXT81609.1|3010856_3011054_-	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	100.0	2.8e-29
AXT83285.1|3011037_3011394_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
AXT83287.1|3011502_3011802_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
AXT81610.1|3011895_3012891_+|integrase	site-specific integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	1.6e-189
AXT81611.1|3012922_3013720_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AXT81612.1|3013801_3014392_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
AXT81613.1|3014491_3015400_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXT81614.1|3015400_3016831_-	inner membrane transporter YcaM	NA	NA	NA	NA	NA
AXT81615.1|3017040_3018189_-	MFS transporter	NA	NA	NA	NA	NA
AXT81616.1|3018502_3019129_+	hydrolase	NA	NA	NA	NA	NA
AXT81617.1|3019163_3020027_-	dimethyl sulfoxide reductase subunit C	NA	NA	NA	NA	NA
AXT81618.1|3020028_3020646_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AXT81619.1|3026067_3026679_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXT81620.1|3030992_3031487_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
3027864:3027884	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
AXT81621.1|3032031_3032997_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
AXT81622.1|3033119_3034886_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AXT81623.1|3034886_3036608_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
AXT81624.1|3036649_3037354_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXT81625.1|3037638_3037857_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXT81626.1|3039073_3041350_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
AXT81627.1|3041380_3041701_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 11
CP030281	Escherichia coli strain E308 chromosome, complete genome	4786360	3073859	3085163	4786360	plate	Salmonella_phage(70.0%)	13	NA	NA
AXT81658.1|3073859_3074117_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AXT81659.1|3074146_3074524_-	hypothetical protein	NA	NA	NA	NA	NA
AXT81660.1|3074793_3076479_+	transporter	NA	NA	NA	NA	NA
AXT81661.1|3076714_3076933_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AXT81662.1|3077023_3077875_-	hypothetical protein	NA	A0A1S6KZY6	Salmonella_phage	88.6	3.1e-77
AXT81663.1|3077861_3078221_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
AXT81664.1|3078896_3079274_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
AXT83289.1|3079275_3079749_-	lysozyme	NA	E5G6N1	Salmonella_phage	90.4	1.1e-79
AXT81665.1|3079768_3079984_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AXT81666.1|3080092_3081766_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AXT81667.1|3082552_3082774_-	regulator	NA	NA	NA	NA	NA
AXT81668.1|3082869_3083466_+	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	42.4	1.1e-39
AXT81669.1|3083486_3085163_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	5.7e-83
>prophage 12
CP030281	Escherichia coli strain E308 chromosome, complete genome	4786360	3673334	3678131	4786360	tail	Shigella_phage(62.5%)	8	NA	NA
AXT82184.1|3673334_3673934_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.0	3.3e-110
AXT82185.1|3674003_3674396_-	hypothetical protein	NA	A5LH42	Enterobacteria_phage	92.3	3.0e-35
AXT82186.1|3674293_3675037_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.7e-148
AXT82187.1|3675556_3675919_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AXT82188.1|3675984_3676809_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AXT82189.1|3676936_3677473_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
AXT82190.1|3677463_3677826_+	hypothetical protein	NA	U5P092	Shigella_phage	99.2	2.8e-67
AXT82191.1|3677825_3678131_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
>prophage 13
CP030281	Escherichia coli strain E308 chromosome, complete genome	4786360	4477274	4566928	4786360	tRNA,plate,terminase,capsid,portal,integrase,lysis,head,holin,tail	Escherichia_phage(40.43%)	95	4486974:4487010	4575904:4575940
AXT82873.1|4477274_4478375_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AXT82874.1|4478414_4478774_-	YijD family membrane protein	NA	NA	NA	NA	NA
AXT83341.1|4478773_4479421_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXT82875.1|4479527_4479647_-	transcriptional regulator	NA	NA	NA	NA	NA
AXT82876.1|4479754_4481155_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AXT82877.1|4481137_4482055_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
AXT82878.1|4482321_4483695_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AXT82879.1|4483755_4484532_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AXT82880.1|4484539_4485544_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AXT82881.1|4485697_4486849_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AXT82882.1|4486836_4487229_+	hypothetical protein	NA	NA	NA	NA	NA
4486974:4487010	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGCA	NA	NA	NA	NA
AXT82883.1|4487446_4490098_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AXT82884.1|4490279_4492013_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
AXT82885.1|4492227_4493079_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXT82886.1|4493065_4493407_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
AXT82887.1|4493408_4494287_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
AXT82888.1|4494252_4496550_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
AXT82889.1|4496600_4496921_-	fructose-like phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AXT82890.1|4496935_4498015_-	fructose-like permease IIC component 2	NA	NA	NA	NA	NA
AXT82891.1|4498323_4500825_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
AXT82892.1|4500836_4501499_+	fructose-6-phosphate aldolase 2	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
AXT82893.1|4501509_4502613_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AXT82894.1|4502887_4503505_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
AXT82895.1|4503531_4504437_-	EamA family transporter	NA	NA	NA	NA	NA
AXT82896.1|4504529_4506710_-	catalase-peroxidase	NA	NA	NA	NA	NA
AXT82897.1|4507038_4507929_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AXT82898.1|4508277_4510710_-	bifunctional aspartokinase II/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AXT82899.1|4510712_4511873_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AXT82900.1|4512149_4512467_+	met repressor	NA	NA	NA	NA	NA
AXT82901.1|4512650_4513259_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
AXT82902.1|4513319_4513532_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AXT82903.1|4513734_4515933_+	primosomal protein N'	NA	NA	NA	NA	NA
AXT82904.1|4516088_4517114_+	transcriptional regulator	NA	NA	NA	NA	NA
AXT82905.1|4517205_4518165_+	cell division protein FtsN	NA	NA	NA	NA	NA
AXT82906.1|4518257_4518788_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AXT82907.1|4518797_4520129_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AXT82908.1|4520195_4521122_+	prenyltransferase	NA	NA	NA	NA	NA
AXT82909.1|4521214_4521700_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AXT82910.1|4521784_4522030_-	cell division protein ZapB	NA	NA	NA	NA	NA
AXT82911.1|4522454_4523300_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
AXT82912.1|4523322_4524831_+	glycerol kinase	NA	NA	NA	NA	NA
AXT82913.1|4524965_4525976_+	fructose 1,6-bisphosphatase	NA	NA	NA	NA	NA
AXT82914.1|4526072_4526819_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AXT82915.1|4526823_4527252_-	universal stress protein D	NA	NA	NA	NA	NA
AXT82916.1|4527278_4527578_-	DUF406 family protein	NA	NA	NA	NA	NA
AXT82917.1|4527789_4528230_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AXT82918.1|4528330_4528930_+	DUF1454 family protein	NA	NA	NA	NA	NA
AXT82919.1|4529037_4529805_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AXT82920.1|4529859_4530615_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
AXT82921.1|4530721_4531711_-	sulfate-binding protein	NA	NA	NA	NA	NA
AXT82922.1|4532030_4532993_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AXT82923.1|4533173_4534076_-	cation-efflux pump FieF	NA	NA	NA	NA	NA
AXT82924.1|4534312_4534567_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AXT82925.1|4534612_4535776_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.5	2.4e-205
AXT82926.1|4535775_4536255_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	4.3e-84
AXT82927.1|4536269_4538717_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.9	0.0e+00
AXT82928.1|4538709_4538829_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AXT82929.1|4538861_4539137_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AXT82930.1|4539192_4539711_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AXT82931.1|4539723_4540914_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
AXT82932.1|4540973_4541567_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	97.0	1.0e-103
AXT82933.1|4541930_4542359_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	51.4	3.7e-26
AXT82934.1|4542330_4542924_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	63.4	7.7e-59
AXT82935.1|4542923_4544207_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	64.9	1.9e-158
AXT82936.1|4544203_4544815_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.0	7.1e-116
AXT82937.1|4544807_4545716_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	7.5e-162
AXT82938.1|4545720_4546068_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AXT82939.1|4546064_4546700_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	2.7e-110
AXT82940.1|4546766_4547219_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
AXT82941.1|4547211_4547679_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	6.7e-82
AXT82942.1|4547641_4547815_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AXT82943.1|4547768_4548212_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	1.4e-65
AXT82944.1|4548199_4548625_-	protein lysA	NA	U5N096	Enterobacteria_phage	95.0	2.8e-58
AXT82945.1|4548639_4549137_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AXT82946.1|4549136_4549418_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AXT82947.1|4549421_4549625_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AXT82948.1|4549624_4550134_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	3.3e-90
AXT82949.1|4550233_4550971_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	98.8	8.8e-129
AXT82950.1|4550974_4552048_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	98.6	1.1e-199
AXT82951.1|4552106_4552961_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
AXT82952.1|4553134_4554907_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
AXT82953.1|4554906_4555941_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
AXT82954.1|4556290_4558129_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	85.9	4.4e-310
AXT82955.1|4558240_4560526_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.9	0.0e+00
AXT82956.1|4560515_4560791_-	hypothetical protein	NA	S4TP00	Salmonella_phage	98.9	8.6e-45
AXT82957.1|4560787_4561012_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
AXT82958.1|4561011_4561314_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
AXT82959.1|4561313_4561538_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	6.8e-32
AXT82960.1|4561601_4562102_-	replication protein B	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
AXT82961.1|4562271_4562544_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AXT82962.1|4562680_4562974_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
AXT82963.1|4563043_4564024_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	99.7	1.0e-185
AXT83342.1|4564209_4564710_-	periplasmic protein CpxP	NA	NA	NA	NA	NA
AXT82964.1|4564859_4565558_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AXT82965.1|4565554_4566928_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
4575904:4575940	attR	TGCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
>prophage 1
CP030283	Escherichia coli strain E308 plasmid pLKSZ02, complete sequence	113645	30335	85362	113645	protease,transposase,integrase	Escherichia_phage(50.0%)	57	51801:51814	64133:64146
AXT83503.1|30335_31040_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXT83504.1|31461_32337_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
AXT83505.1|32383_32860_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AXT83506.1|33911_34616_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT83507.1|35001_35418_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
AXT83508.1|35422_35941_-	hypothetical protein	NA	NA	NA	NA	NA
AXT83509.1|35940_36729_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
AXT83510.1|37228_37933_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT83511.1|38252_39428_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA2	NA	NA	NA	NA	NA
AXT83512.1|39451_42604_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
AXT83513.1|42673_43153_-	transcriptional regulator	NA	NA	NA	NA	NA
AXT83514.1|43241_43946_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXT83515.1|44252_45047_-	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
AXT83516.1|46625_46814_+	hypothetical protein	NA	NA	NA	NA	NA
AXT83517.1|46823_48021_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXT83590.1|48091_48280_+	hypothetical protein	NA	A0A077SL39	Escherichia_phage	96.7	8.8e-09
AXT83518.1|48518_48800_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
AXT83519.1|48789_49041_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AXT83520.1|50106_50337_-	hypothetical protein	NA	NA	NA	NA	NA
AXT83521.1|51134_51977_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
51801:51814	attL	AAGAAAGAAATAGG	NA	NA	NA	NA
AXT83522.1|51980_52427_+	hypothetical protein	NA	NA	NA	NA	NA
AXT83591.1|52563_52917_+	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AXT83592.1|53141_53333_-	hypothetical protein	NA	NA	NA	NA	NA
AXT83523.1|53402_54602_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXT83524.1|54611_54800_-	hypothetical protein	NA	NA	NA	NA	NA
AXT83525.1|55262_55520_+	hypothetical protein	NA	NA	NA	NA	NA
AXT83526.1|55577_56354_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AXT83527.1|56350_57094_-	hypothetical protein	NA	NA	NA	NA	NA
AXT83528.1|57144_57495_-	hypothetical protein	NA	NA	NA	NA	NA
AXT83529.1|58174_59170_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AXT83530.1|59173_60106_+	hypothetical protein	NA	NA	NA	NA	NA
AXT83531.1|60403_61492_+	transcriptional regulator	NA	NA	NA	NA	NA
AXT83532.1|61493_62363_+	hypothetical protein	NA	NA	NA	NA	NA
AXT83533.1|62419_63985_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AXT83593.1|64177_64315_+	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
64133:64146	attR	AAGAAAGAAATAGG	NA	NA	NA	NA
AXT83534.1|64292_64523_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXT83535.1|64705_65410_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT83536.1|67306_68311_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AXT83537.1|68492_68669_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AXT83538.1|68998_69814_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AXT83539.1|69874_70678_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AXT83540.1|70677_71514_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXT83541.1|71819_72065_+	relaxase	NA	NA	NA	NA	NA
AXT83542.1|72093_72771_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXT83543.1|72849_74049_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AXT83544.1|74315_74621_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXT83545.1|74648_75863_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AXT83546.1|76079_76964_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AXT83547.1|76994_78488_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXT83548.1|78698_78923_-	hypothetical protein	NA	NA	NA	NA	NA
AXT83549.1|78919_79657_-	resolvase	NA	NA	NA	NA	NA
AXT83550.1|79763_80255_+	hypothetical protein	NA	NA	NA	NA	NA
AXT83551.1|80288_80993_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT83552.1|82009_82714_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT83553.1|83923_84028_-	hypothetical protein	NA	NA	NA	NA	NA
AXT83554.1|84024_84489_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AXT83555.1|84708_85362_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
CP030285	Escherichia coli strain E308 plasmid pLKSZ04, complete sequence	92978	1136	10028	92978		Escherichia_phage(54.55%)	13	NA	NA
AXT83659.1|1136_1391_+	hypothetical protein	NA	A0A1B0VAJ0	Salmonella_phage	89.3	1.5e-22
AXT83660.1|2800_2989_-	hypothetical protein	NA	NA	NA	NA	NA
AXT83661.1|3234_3609_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	91.1	6.8e-61
AXT83742.1|3605_4340_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	70.7	2.6e-112
AXT83743.1|4460_4676_+	hypothetical protein	NA	NA	NA	NA	NA
AXT83662.1|5468_5750_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	91.6	5.7e-36
AXT83663.1|6476_6866_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
AXT83664.1|6938_7160_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AXT83665.1|7159_7540_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	2.8e-62
AXT83666.1|7544_7724_+	PdcA protein	NA	Q71TH5	Escherichia_phage	96.6	1.0e-22
AXT83667.1|8795_9647_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	98.9	6.8e-157
AXT83668.1|9757_9967_-	c1 repressor inactivator	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
AXT83669.1|9932_10028_-	peptidase	NA	Q38402	Escherichia_phage	100.0	8.0e-11
>prophage 2
CP030285	Escherichia coli strain E308 plasmid pLKSZ04, complete sequence	92978	16738	72139	92978	plate,transposase,integrase	Escherichia_phage(48.57%)	54	51453:51478	53052:53077
AXT83674.1|16738_17443_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT83675.1|17564_18470_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXT83676.1|18466_19705_+	MFS transporter	NA	NA	NA	NA	NA
AXT83677.1|19704_20289_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXT83678.1|20234_20591_+	hypothetical protein	NA	NA	NA	NA	NA
AXT83745.1|20781_21546_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXT83679.1|21574_21757_+	resolvase	NA	NA	NA	NA	NA
AXT83680.1|21772_22078_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXT83681.1|22088_23294_-	chromate transporter	NA	NA	NA	NA	NA
AXT83682.1|23449_23653_-	hypothetical protein	NA	NA	NA	NA	NA
AXT83683.1|23671_23851_+	hypothetical protein	NA	NA	NA	NA	NA
AXT83684.1|23780_24620_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXT83685.1|24613_24961_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXT83686.1|25124_25916_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AXT83687.1|25921_26212_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AXT83688.1|26323_26821_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AXT83689.1|27771_28476_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT83690.1|30471_30693_+	creatininase	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
AXT83691.1|30700_31732_+	recombinase	NA	Q71TG5	Escherichia_phage	99.4	8.4e-194
AXT83692.1|31883_32093_+	lysogeny establishment protein	NA	Q5XLQ4	Enterobacteria_phage	91.3	8.0e-27
AXT83693.1|32340_32901_+	recombinase	NA	Q71TG3	Escherichia_phage	99.5	2.0e-101
AXT83694.1|33089_33734_+	maturation control protein	NA	A0A1B0VAG4	Salmonella_phage	86.3	1.7e-96
AXT83695.1|33787_34477_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AXT83696.1|35460_35709_-	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AXT83697.1|35705_36146_-	peptide-binding protein	NA	Q71TR9	Escherichia_phage	99.3	3.8e-79
AXT83698.1|38264_39125_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXT83699.1|39307_39865_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AXT83700.1|45300_45432_-	replication protein RepA4	NA	NA	NA	NA	NA
AXT83701.1|45684_45936_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AXT83702.1|45932_46220_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	5.8e-20
AXT83703.1|46509_46710_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
51453:51478	attL	TGGGGATGCGGACGATTTCCTGGACT	NA	NA	NA	NA
AXT83704.1|51484_51961_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.2	2.0e-28
AXT83705.1|51961_52093_-|integrase	integrase	integrase	NA	NA	NA	NA
AXT83706.1|52061_53036_-	hypothetical protein	NA	A0A0C5AJ29	Paenibacillus_phage	27.5	2.8e-05
AXT83707.1|54008_55160_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
53052:53077	attR	AGTCCAGGAAATCGTCCGCATCCCCA	NA	NA	NA	NA
AXT83708.1|55542_56109_-	recombination-associated protein RdgC	NA	Q71TA1	Escherichia_phage	98.9	6.6e-92
AXT83709.1|56101_56386_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
AXT83710.1|56370_56583_-	hypothetical protein	NA	NA	NA	NA	NA
AXT83746.1|56729_57083_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	95.7	6.9e-39
AXT83711.1|57122_57545_+	ppfA	NA	A0A1B0VCB0	Salmonella_phage	86.4	1.4e-46
AXT83712.1|57720_58113_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
AXT83713.1|58448_59333_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
AXT83714.1|59623_60433_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.4	9.3e-156
AXT83715.1|60601_61798_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AXT83716.1|61814_62816_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AXT83717.1|63041_64748_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
AXT83718.1|64807_66397_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	98.1	2.2e-302
AXT83719.1|66406_67222_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.5	5.4e-111
AXT83720.1|67257_67839_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	96.4	8.9e-100
AXT83721.1|67850_68360_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	6.6e-91
AXT83722.1|68519_69632_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AXT83723.1|69825_69981_-	type I toxin-antitoxin system hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
AXT83724.1|70378_70717_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
AXT83725.1|70925_72139_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 3
CP030285	Escherichia coli strain E308 plasmid pLKSZ04, complete sequence	92978	88303	92698	92978		Escherichia_phage(50.0%)	6	NA	NA
AXT83736.1|88303_88654_-	hypothetical protein	NA	Q716C1	Shigella_phage	97.7	5.2e-39
AXT83737.1|89179_89857_+	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	96.4	5.1e-131
AXT83738.1|89853_90555_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	99.1	1.3e-142
AXT83739.1|90636_90855_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AXT83740.1|90856_92119_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	100.0	5.4e-235
AXT83741.1|92191_92698_+	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.4e-93
