The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029687	Escherichia coli strain E706 chromosome, complete genome	4696142	441759	527560	4696142	tRNA,integrase,protease,terminase,capsid,tail,portal,head,transposase	uncultured_Caudovirales_phage(40.91%)	86	454454:454469	499125:499140
AXT74712.1|441759_442707_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
AXT74713.1|442721_443231_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
AXT74714.1|443360_444485_+	protein smf	NA	NA	NA	NA	NA
AXT74715.1|444456_444930_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AXT74716.1|444958_445501_+	hypothetical protein	NA	NA	NA	NA	NA
AXT74717.1|445505_446078_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AXT74718.1|446082_446901_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AXT74719.1|446897_447155_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AXT74720.1|447130_447901_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AXT74721.1|453725_454484_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
454454:454469	attL	CGTTAGCAGGTTGCAG	NA	NA	NA	NA
AXT74722.1|454491_455595_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXT74723.1|455604_456786_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXT74724.1|456853_457879_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
AXT74725.1|457907_458084_-	hypothetical protein	NA	NA	NA	NA	NA
AXT74726.1|458309_458531_-	hypothetical protein	NA	NA	NA	NA	NA
AXT74727.1|458783_461888_-	hydrophobe/amphiphile efflux-1 family RND transporter	NA	NA	NA	NA	NA
AXT74728.1|461899_463057_-	MexX family efflux pump subunit	NA	NA	NA	NA	NA
AXT74729.1|463045_463279_+	hypothetical protein	NA	NA	NA	NA	NA
AXT74730.1|463455_464118_+	acrEF/envCD operon repressor	NA	NA	NA	NA	NA
AXT74731.1|464120_464300_-	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
AXT74732.1|464383_465268_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
AXT74733.1|465538_466759_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	63.0	3.5e-154
AXT74734.1|468756_469041_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXT74735.1|470419_470611_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AXT74736.1|470603_470798_+	hypothetical protein	NA	NA	NA	NA	NA
AXT74737.1|470794_471010_+	hypothetical protein	NA	NA	NA	NA	NA
AXT74738.1|470996_471188_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AXT74739.1|471171_472923_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	51.8	4.2e-129
AXT74740.1|473220_473481_+	hypothetical protein	NA	NA	NA	NA	NA
AXT74741.1|473519_474041_-	hypothetical protein	NA	NA	NA	NA	NA
AXT74742.1|474042_475077_-	hypothetical protein	NA	NA	NA	NA	NA
AXT74743.1|475371_476538_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.0	1.4e-213
AXT74744.1|476589_477150_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	97.8	2.9e-100
AXT78528.1|477160_478393_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.3	8.7e-230
AXT74745.1|478389_478725_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	56.9	4.9e-26
AXT74746.1|478721_479021_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AXT74747.1|479020_479464_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	93.9	2.3e-79
AXT74748.1|479590_479782_+|terminase	terminase	terminase	NA	NA	NA	NA
AXT74749.1|479739_480096_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AXT74750.1|480079_481741_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.6	0.0e+00
AXT74751.1|481891_482200_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
AXT74752.1|482357_482654_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXT74753.1|482679_483645_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AXT74754.1|483973_484855_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AXT74755.1|484866_486318_-	sodium:pantothenate symporter	NA	NA	NA	NA	NA
AXT74756.1|486307_486550_-	DUF997 domain-containing protein	NA	NA	NA	NA	NA
AXT74757.1|486658_488008_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AXT74758.1|488018_488489_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
AXT78529.1|488461_488650_-	acetyl-CoA carboxylase	NA	NA	NA	NA	NA
AXT74759.1|489466_490441_-	acrylyl-CoA reductase AcuI	NA	NA	NA	NA	NA
AXT74760.1|490592_492533_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AXT74761.1|492541_492730_-	hypothetical protein	NA	NA	NA	NA	NA
AXT74762.1|492677_492860_-	hypothetical protein	NA	NA	NA	NA	NA
AXT74763.1|492837_493881_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AXT74764.1|493946_495050_+	cell shape-determining protein MreC	NA	NA	NA	NA	NA
AXT74765.1|495049_495538_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AXT74766.1|495546_496140_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AXT74767.1|496129_497599_+	ribonuclease E/G	NA	NA	NA	NA	NA
AXT74768.1|497666_501467_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
499125:499140	attR	CTGCAACCTGCTAACG	NA	NA	NA	NA
AXT74769.1|501896_503342_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AXT74770.1|503475_504405_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AXT74771.1|504587_504791_+	protein AaeX	NA	NA	NA	NA	NA
AXT74772.1|504798_505731_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AXT74773.1|505736_507704_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AXT74774.1|507795_508068_+	hypothetical protein	NA	NA	NA	NA	NA
AXT78530.1|508123_508387_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXT74775.1|508751_509222_-	arginine repressor	NA	NA	NA	NA	NA
AXT74776.1|509656_510595_+	malate dehydrogenase	NA	NA	NA	NA	NA
AXT74777.1|510657_511725_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
AXT74778.1|511814_513182_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	6.0e-22
AXT74779.1|513335_513734_-	DUF1043 domain-containing protein	NA	NA	NA	NA	NA
AXT74780.1|513927_515055_+	cell division protein ZapE	NA	NA	NA	NA	NA
AXT74781.1|515273_515702_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AXT74782.1|515717_516110_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AXT78531.1|516353_516563_-	hypothetical protein	NA	NA	NA	NA	NA
AXT74783.1|516504_517143_+	stringent starvation protein A	NA	NA	NA	NA	NA
AXT74784.1|517148_517646_+	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
AXT74785.1|517687_519055_-	C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
AXT74786.1|519434_520226_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
AXT74787.1|520347_521241_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AXT74788.1|521350_522841_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
AXT74789.1|522888_523578_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AXT74790.1|523574_524450_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
AXT74791.1|524446_524911_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AXT74792.1|524970_525720_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	3.1e-73
AXT74793.1|526862_527560_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	98.3	4.7e-132
>prophage 2
CP029687	Escherichia coli strain E706 chromosome, complete genome	4696142	983139	997099	4696142		Escherichia_phage(50.0%)	12	NA	NA
AXT75192.1|983139_983901_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AXT75193.1|983894_984521_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AXT75194.1|984660_985800_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AXT75195.1|985862_986855_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AXT75196.1|986948_988313_-	permease	NA	NA	NA	NA	NA
AXT75197.1|988401_989178_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AXT75198.1|989182_989821_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AXT75199.1|989817_991080_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AXT75200.1|991076_991985_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AXT75201.1|992180_992948_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AXT75202.1|993775_994432_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
AXT75203.1|994537_997099_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 3
CP029687	Escherichia coli strain E706 chromosome, complete genome	4696142	1068488	1123168	4696142	tRNA,integrase,plate,capsid,tail,lysis,portal,head,transposase	Salmonella_phage(82.22%)	66	1077565:1077610	1111896:1111941
AXT75271.1|1068488_1069650_+|transposase	IS3-like element IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	2.6e-50
AXT75272.1|1070545_1071028_+	hypothetical protein	NA	NA	NA	NA	NA
AXT75273.1|1071127_1071919_+	hypothetical protein	NA	NA	NA	NA	NA
AXT78552.1|1072149_1072347_-	hypothetical protein	NA	NA	NA	NA	NA
AXT75274.1|1072282_1072492_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	68.1	1.3e-08
AXT75275.1|1072546_1072705_+	glyoxalase	NA	NA	NA	NA	NA
AXT78551.1|1072830_1077405_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
1077565:1077610	attL	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AXT75276.1|1077726_1078758_-	hypothetical protein	NA	NA	NA	NA	NA
AXT75277.1|1078760_1079780_-|integrase	integrase	integrase	E5G6L0	Salmonella_phage	93.7	1.9e-185
AXT75278.1|1079783_1080413_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	55.0	6.1e-62
AXT75279.1|1080536_1080779_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
AXT75280.1|1080811_1081321_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	95.3	3.0e-83
AXT78553.1|1081328_1081529_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
AXT75281.1|1081492_1081834_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AXT75282.1|1081901_1082135_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	1.2e-31
AXT75283.1|1082134_1082362_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	5.1e-35
AXT75284.1|1083034_1084307_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	8.0e-170
AXT75285.1|1084548_1086963_+	endonuclease	NA	E5G6L9	Salmonella_phage	98.3	0.0e+00
AXT75286.1|1087115_1087304_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AXT75287.1|1087242_1087548_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AXT75288.1|1087759_1088632_+	hypothetical protein	NA	NA	NA	NA	NA
AXT75289.1|1088984_1090025_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.1	7.7e-171
AXT75290.1|1090024_1091791_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AXT75291.1|1091933_1092767_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
AXT75292.1|1092783_1093842_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
AXT75293.1|1093845_1094496_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AXT75294.1|1094591_1095056_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
AXT75295.1|1095055_1095259_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
AXT75296.1|1095262_1095478_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AXT78554.1|1095497_1095971_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AXT75297.1|1095972_1096350_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	1.1e-15
AXT75298.1|1096346_1096775_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	6.4e-47
AXT75299.1|1096704_1096908_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	74.6	2.0e-22
AXT75300.1|1096870_1097302_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
AXT75301.1|1097294_1097741_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AXT75302.1|1097809_1098388_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
AXT75303.1|1098384_1098744_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
AXT75304.1|1098730_1099639_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
AXT75305.1|1099631_1100237_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
AXT75306.1|1100233_1101757_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.1	8.6e-195
AXT75307.1|1101756_1102350_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	62.4	2.5e-57
AXT75308.1|1102321_1102756_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.4	6.5e-23
AXT75309.1|1102758_1103400_-	hypothetical protein	NA	NA	NA	NA	NA
AXT75310.1|1104139_1105312_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	3.5e-204
AXT75311.1|1105321_1105837_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AXT75312.1|1105891_1106194_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	4.1e-40
AXT75313.1|1106208_1106328_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AXT75314.1|1106320_1109398_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.2	0.0e+00
AXT75315.1|1109394_1109880_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
AXT75316.1|1109876_1110977_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
AXT75317.1|1111045_1111264_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
AXT75318.1|1111290_1111773_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
AXT75319.1|1112473_1112956_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1111896:1111941	attR	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AXT75320.1|1113087_1113564_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AXT75321.1|1113553_1113844_+	RnfH family protein	NA	NA	NA	NA	NA
AXT75322.1|1113905_1114247_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXT75323.1|1114395_1116057_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AXT75324.1|1116142_1117021_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXT78555.1|1116952_1117147_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AXT75325.1|1117143_1117737_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXT78556.1|1117791_1119033_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AXT78557.1|1119098_1119890_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AXT75326.1|1120056_1121418_+	signal recognition particle protein	NA	NA	NA	NA	NA
AXT75327.1|1121554_1121803_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXT78558.1|1121821_1122370_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXT75328.1|1122400_1123168_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 4
CP029687	Escherichia coli strain E706 chromosome, complete genome	4696142	1385275	1401250	4696142	transposase	Enterobacteria_phage(67.65%)	34	NA	NA
AXT75550.1|1385275_1386548_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	8.0e-170
AXT75551.1|1387247_1387448_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AXT75552.1|1387505_1387673_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
AXT75553.1|1387753_1387945_-	hypothetical protein	NA	G8C7S2	Escherichia_phage	67.2	1.1e-17
AXT75554.1|1388056_1388407_-	ASCH domain-containing protein	NA	Q9XJG9	Enterobacteria_phage	96.2	1.7e-53
AXT75555.1|1388330_1388897_-	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	81.7	2.9e-95
AXT75556.1|1388893_1389376_-	hypothetical protein	NA	K7P799	Enterobacteria_phage	94.4	7.2e-79
AXT75557.1|1389372_1389537_-	DUF2737 domain-containing protein	NA	K7P716	Enterobacteria_phage	100.0	6.5e-24
AXT75558.1|1389533_1389824_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.9	1.8e-45
AXT75559.1|1389834_1390131_-	DUF2856 domain-containing protein	NA	A0A220NRR0	Escherichia_phage	100.0	2.3e-51
AXT75560.1|1390144_1390660_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	100.0	6.9e-80
AXT75561.1|1390660_1391368_-	recombinase	NA	K7PKU3	Enterobacteria_phage	98.3	5.5e-136
AXT75562.1|1391622_1391775_-	host cell division inhibitory peptide Kil	NA	K7P837	Enterobacteria_phage	98.0	1.4e-20
AXT75563.1|1391759_1391894_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
AXT75564.1|1392079_1392280_-	hypothetical protein	NA	A0A088CQ77	Enterobacteria_phage	100.0	2.8e-29
AXT75565.1|1392279_1392576_-	hypothetical protein	NA	A0A2D1GLR6	Escherichia_phage	94.9	1.2e-47
AXT75566.1|1392615_1392816_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
AXT75567.1|1392894_1393275_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	3.1e-53
AXT75568.1|1393556_1394252_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
AXT75569.1|1394327_1394543_+	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	98.6	8.2e-35
AXT75570.1|1394662_1394956_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	99.0	1.4e-45
AXT75571.1|1394988_1395135_+	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
AXT75572.1|1395127_1395988_+	replication protein	NA	K7PL20	Enterobacteria_phage	99.7	4.3e-159
AXT75573.1|1396095_1397976_+	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	99.8	0.0e+00
AXT75574.1|1398052_1398259_+	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	95.6	1.5e-30
AXT75575.1|1398276_1398633_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
AXT75576.1|1398604_1399015_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
AXT75577.1|1399011_1399188_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
AXT75578.1|1399148_1399532_+	protein ninX	NA	Q76H72	Enterobacteria_phage	98.3	2.6e-63
AXT75579.1|1399524_1399701_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
AXT75580.1|1399693_1400416_+	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	99.2	2.1e-130
AXT75581.1|1400415_1400706_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	1.1e-50
AXT75582.1|1400702_1401065_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
AXT75583.1|1401061_1401250_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
>prophage 5
CP029687	Escherichia coli strain E706 chromosome, complete genome	4696142	1789493	1833329	4696142	protease,terminase,lysis,tail,head,holin	Salmonella_phage(34.92%)	68	NA	NA
AXT75902.1|1789493_1790672_+	DUF4102 domain-containing protein	NA	A0A088CQ72	Enterobacteria_phage	100.0	1.4e-232
AXT75903.1|1790652_1790844_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
AXT75904.1|1790925_1791237_-	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	96.1	1.9e-53
AXT75905.1|1791318_1791600_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	98.9	1.5e-49
AXT75906.1|1791592_1791877_-	DUF4752 domain-containing protein	NA	G9L657	Escherichia_phage	97.9	1.0e-48
AXT75907.1|1791876_1792518_-	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	45.0	7.8e-57
AXT75908.1|1792519_1793059_-	hypothetical protein	NA	S5M7T0	Escherichia_phage	72.8	3.1e-62
AXT78580.1|1793055_1793223_-	DUF2737 domain-containing protein	NA	K7PJY9	Enterobacterial_phage	96.4	1.5e-23
AXT75909.1|1793233_1793530_-	DUF2856 domain-containing protein	NA	A0A220NRR0	Escherichia_phage	99.0	3.9e-51
AXT75910.1|1793543_1794059_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	90.1	1.4e-67
AXT75911.1|1794059_1794767_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.6	3.8e-137
AXT75912.1|1795021_1795174_-	host cell division inhibitory peptide Kil	NA	G5DA87	Enterobacteria_phage	100.0	4.7e-21
AXT75913.1|1795158_1795290_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
AXT75914.1|1795314_1796283_-	cell envelope biogenesis protein TolA	NA	A0A088CQ16	Enterobacteria_phage	100.0	1.3e-55
AXT75915.1|1796572_1796842_-	hypothetical protein	NA	A0A2D1GLR6	Escherichia_phage	50.0	3.7e-16
AXT75916.1|1798573_1798846_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	98.9	7.4e-41
AXT75917.1|1799160_1799811_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
AXT75918.1|1799891_1800077_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
AXT75919.1|1800192_1800489_+	hypothetical protein	NA	K7PKU6	Enterobacteria_phage	100.0	2.3e-48
AXT75920.1|1800669_1801491_+	replication of DNA	NA	K7PJZ3	Enterobacterial_phage	99.6	2.0e-153
AXT75921.1|1801487_1802864_+	replicative DNA helicase	NA	Q9MCP7	Enterobacteria_phage	99.1	1.4e-252
AXT75922.1|1803259_1803460_+	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
AXT75923.1|1803471_1803744_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	62.9	1.8e-26
AXT75924.1|1803746_1804193_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	96.6	5.1e-79
AXT75925.1|1804189_1804717_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AXT75926.1|1804713_1804896_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
AXT75927.1|1804892_1805063_+	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
AXT75928.1|1805055_1805778_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	95.4	1.4e-123
AXT75929.1|1805777_1806068_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	99.0	1.0e-51
AXT75930.1|1806064_1806427_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
AXT75931.1|1806423_1806612_+	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	9.4e-27
AXT75932.1|1806608_1807097_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	99.4	3.5e-89
AXT75933.1|1807586_1807910_+|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
AXT75934.1|1807893_1808370_+	lysozyme	NA	K7P7P0	Enterobacteria_phage	99.4	2.2e-88
AXT75935.1|1808366_1808804_+|lysis	lysis protein	lysis	K7P869	Enterobacteria_phage	97.9	5.0e-71
AXT78581.1|1809003_1809522_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	5.5e-93
AXT75936.1|1809943_1810180_-	hypothetical protein	NA	NA	NA	NA	NA
AXT75937.1|1810204_1810756_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.2	9.4e-67
AXT75938.1|1810758_1812381_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.9	0.0e+00
AXT75939.1|1812380_1813847_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	93.9	1.6e-267
AXT75940.1|1813734_1814472_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	95.0	5.0e-108
AXT75941.1|1814486_1815707_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	87.8	1.1e-197
AXT75942.1|1815710_1816217_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	81.1	3.4e-71
AXT75943.1|1816228_1817170_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	3.7e-156
AXT75944.1|1817211_1817433_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	1.7e-11
AXT75945.1|1817398_1817806_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.0	3.5e-71
AXT75946.1|1817802_1818357_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	85.3	7.9e-82
AXT75947.1|1818343_1818733_+|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
AXT75948.1|1818707_1819271_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
AXT75949.1|1819274_1820420_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	1.4e-160
AXT75950.1|1820430_1820871_+	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
AXT75951.1|1820874_1821327_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	74.7	1.9e-57
AXT75952.1|1821338_1821515_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	70.0	1.6e-12
AXT75953.1|1821504_1823493_+	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.9	3.0e-272
AXT75954.1|1823492_1824080_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	5.3e-84
AXT75955.1|1824079_1824382_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	89.0	4.5e-47
AXT75956.1|1824384_1825452_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.9	2.5e-156
AXT75957.1|1825448_1825796_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	71.1	1.5e-22
AXT75958.1|1825964_1826537_+	hypothetical protein	NA	NA	NA	NA	NA
AXT75959.1|1826538_1826955_+	toxin YafO, type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
AXT75960.1|1826997_1827753_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	84.5	1.4e-108
AXT75961.1|1827752_1828106_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	2.0e-54
AXT75962.1|1828105_1829305_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.6	6.4e-185
AXT75963.1|1829301_1829982_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	80.5	2.3e-107
AXT75964.1|1831018_1831453_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	44.8	7.7e-24
AXT75965.1|1831573_1831768_+	hypothetical protein	NA	NA	NA	NA	NA
AXT75966.1|1831707_1831839_+	umuD domain protein	NA	NA	NA	NA	NA
AXT75967.1|1832162_1833329_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	5.5e-226
>prophage 6
CP029687	Escherichia coli strain E706 chromosome, complete genome	4696142	2271879	2377772	4696142	integrase,protease,terminase,tail,lysis,transposase	Enterobacteria_phage(39.58%)	101	2366374:2366404	2377768:2377798
AXT76357.1|2271879_2272701_-|protease	serine protease	protease	NA	NA	NA	NA
AXT76358.1|2272800_2272884_-	hypothetical protein	NA	NA	NA	NA	NA
AXT76359.1|2272976_2273312_-	acid shock protein	NA	NA	NA	NA	NA
AXT76360.1|2273708_2274962_-	MFS transporter	NA	NA	NA	NA	NA
AXT76361.1|2275068_2275962_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXT76362.1|2276096_2277317_+	protein mlc	NA	NA	NA	NA	NA
AXT76363.1|2277441_2278137_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AXT78602.1|2278089_2279382_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AXT76364.1|2279541_2280156_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AXT76365.1|2280198_2281053_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AXT76366.1|2281054_2281672_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AXT78603.1|2281682_2284106_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AXT76367.1|2284166_2286593_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
AXT76368.1|2286791_2287097_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AXT78604.1|2287204_2287915_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AXT76369.1|2287917_2288478_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AXT76370.1|2288512_2288854_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AXT76371.1|2288988_2289315_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AXT76372.1|2289351_2289540_+	hypothetical protein	NA	NA	NA	NA	NA
AXT76373.1|2289520_2290735_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AXT76374.1|2290746_2291658_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	28.6	2.1e-15
AXT76375.1|2292516_2293678_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AXT76376.1|2294299_2294515_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AXT76377.1|2294519_2294831_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.6	1.0e-25
AXT76378.1|2295357_2295855_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AXT76379.1|2296218_2296431_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AXT76380.1|2296441_2296630_+	cold-shock protein	NA	NA	NA	NA	NA
AXT76381.1|2296660_2296933_+	hypothetical protein	NA	NA	NA	NA	NA
AXT76382.1|2297104_2297278_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AXT76383.1|2297429_2297840_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
AXT76384.1|2297785_2297986_-	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	70.0	4.5e-11
AXT76385.1|2298140_2298347_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
AXT76386.1|2298900_2299395_+	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
AXT76387.1|2299394_2301458_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	98.7	0.0e+00
AXT76388.1|2301494_2301707_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AXT76389.1|2303063_2305187_+	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.7	0.0e+00
AXT76390.1|2305228_2305597_+	DUF2190 domain-containing protein	NA	A5LH31	Enterobacteria_phage	100.0	9.7e-52
AXT76391.1|2305589_2305865_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
AXT76392.1|2305876_2306455_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
AXT76393.1|2306451_2306853_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	4.1e-72
AXT76394.1|2306863_2307607_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
AXT78605.1|2307667_2308054_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
AXT76395.1|2308062_2308392_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AXT76396.1|2308363_2311429_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.3	0.0e+00
AXT76397.1|2311428_2311758_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AXT76398.1|2311767_2312466_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
AXT76399.1|2312614_2313214_+	endopeptidase	NA	A0A291AWX4	Escherichia_phage	98.5	2.1e-120
AXT76400.1|2313111_2313759_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	3.0e-112
AXT76401.1|2317301_2317901_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	1.5e-110
AXT78606.1|2317965_2320929_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	92.3	4.4e-54
AXT76402.1|2320928_2321504_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.9e-102
AXT76403.1|2321601_2322192_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AXT76404.1|2322508_2322742_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AXT76405.1|2326392_2326596_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AXT76406.1|2326772_2327459_-	transcriptional regulator	NA	NA	NA	NA	NA
AXT76407.1|2327547_2328294_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXT78607.1|2328430_2330476_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AXT76408.1|2330519_2331038_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
AXT76409.1|2331315_2331708_+	TIGR00156 family protein	NA	NA	NA	NA	NA
AXT76410.1|2331962_2332853_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
AXT76411.1|2333071_2333167_-	hypothetical protein	NA	NA	NA	NA	NA
AXT76412.1|2333293_2334481_-	transporter	NA	NA	NA	NA	NA
AXT76413.1|2334675_2335575_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
AXT76414.1|2335605_2335824_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
AXT76415.1|2335855_2336239_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
AXT76416.1|2336259_2336694_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
AXT76417.1|2336913_2337234_+	hypothetical protein	NA	Q6UAT3	Klebsiella_phage	41.3	2.1e-18
AXT76418.1|2337223_2337508_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXT76419.1|2337628_2338294_+	stress protection protein MarC	NA	NA	NA	NA	NA
AXT76420.1|2338317_2339508_-	sugar efflux transporter	NA	NA	NA	NA	NA
AXT76421.1|2339657_2340773_-	putative protein YneK	NA	NA	NA	NA	NA
AXT76422.1|2340850_2341732_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXT76423.1|2341832_2343221_+	succinate semialdehyde dehydrogenase [NAD(P)+] Sad	NA	NA	NA	NA	NA
AXT76424.1|2343284_2344211_+	glutaminase 2	NA	NA	NA	NA	NA
AXT76425.1|2344210_2344570_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
AXT78608.1|2345179_2346127_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.3e-18
AXT76426.1|2346077_2346209_+	diguanylate cyclase	NA	NA	NA	NA	NA
AXT76427.1|2346353_2347805_+	altronate oxidoreductase	NA	NA	NA	NA	NA
AXT76428.1|2347861_2348062_-	hypothetical protein	NA	NA	NA	NA	NA
AXT76429.1|2348011_2348926_+	hypothetical protein	NA	NA	NA	NA	NA
AXT76430.1|2348929_2349688_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AXT76431.1|2349744_2350035_-	autoinducer 2-degrading protein LsrG	NA	NA	NA	NA	NA
AXT76432.1|2350058_2350934_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase LsrF	NA	NA	NA	NA	NA
AXT76433.1|2350960_2351983_-	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXT76434.1|2351994_2352987_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
AXT76435.1|2352986_2354015_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
AXT76436.1|2354008_2355544_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.4e-21
AXT76437.1|2355792_2356746_+	LsrR family transcriptional regulator	NA	NA	NA	NA	NA
AXT76438.1|2356824_2358417_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
AXT76439.1|2364589_2364856_+	transcriptional regulator	NA	NA	NA	NA	NA
AXT76440.1|2364855_2366178_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXT76441.1|2366188_2366422_+	hypothetical protein	NA	NA	NA	NA	NA
2366374:2366404	attL	CCGCAGAATTCGGAAAAAATCGTACGCTAAG	NA	NA	NA	NA
AXT76442.1|2368029_2369202_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.7	8.3e-230
AXT76443.1|2369198_2369999_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
AXT76444.1|2370396_2370744_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXT76445.1|2370949_2371738_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AXT78609.1|2371868_2372342_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
AXT76446.1|2372499_2373513_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXT76447.1|2373451_2374066_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AXT76448.1|2374241_2374802_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AXT76449.1|2374805_2377772_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.9	0.0e+00
2377768:2377798	attR	CTTAGCGTACGATTTTTTCCGAATTCTGCGG	NA	NA	NA	NA
>prophage 7
CP029687	Escherichia coli strain E706 chromosome, complete genome	4696142	2872948	3000821	4696142	tRNA,integrase,protease,plate,holin,terminase,tail,lysis,capsid,portal,head,transposase	Escherichia_phage(35.48%)	114	2884887:2884907	2987337:2987357
AXT76896.1|2872948_2874709_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AXT78639.1|2874777_2875296_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AXT76897.1|2875365_2875533_-	ribosome modulation factor	NA	NA	NA	NA	NA
AXT76898.1|2875788_2876352_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AXT76899.1|2876348_2877989_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
AXT76900.1|2877993_2879247_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AXT76901.1|2879376_2881284_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
AXT76902.1|2881295_2883404_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AXT76903.1|2883647_2884757_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AXT76904.1|2884753_2885296_-	cell division protein ZapC	NA	NA	NA	NA	NA
2884887:2884907	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
AXT76905.1|2885469_2886480_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AXT76906.1|2887292_2887808_-	fimbrial protein	NA	NA	NA	NA	NA
AXT76907.1|2887815_2888358_-	fimbrial protein	NA	NA	NA	NA	NA
AXT76908.1|2888369_2889440_-	fimbrial protein	NA	NA	NA	NA	NA
AXT76909.1|2892054_2892756_-	fimbrial chaperone protein ElfD	NA	NA	NA	NA	NA
AXT76910.1|2892838_2893378_-	fimbrial subunit ElfA	NA	NA	NA	NA	NA
AXT76911.1|2893733_2894309_+	NAD(P)H-dependent FMN reductase	NA	NA	NA	NA	NA
AXT76912.1|2894301_2895261_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXT76913.1|2895257_2896403_+	alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
AXT76914.1|2896413_2897205_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
AXT76915.1|2897201_2897969_+	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
AXT76916.1|2898029_2899142_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AXT76917.1|2899360_2901973_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
AXT76918.1|2902238_2903441_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AXT76919.1|2903609_2905010_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AXT76920.1|2906716_2906899_-	hypothetical protein	NA	NA	NA	NA	NA
AXT76921.1|2906885_2908076_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AXT76922.1|2908297_2908945_-	hypothetical protein	NA	NA	NA	NA	NA
AXT78640.1|2908971_2909520_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AXT76923.1|2909700_2911548_-	transpeptidase	NA	NA	NA	NA	NA
AXT76924.1|2911808_2916269_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
AXT76925.1|2916268_2916973_-	condensin subunit E	NA	NA	NA	NA	NA
AXT76926.1|2916953_2918276_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AXT76927.1|2918272_2919058_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AXT76928.1|2919193_2919973_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AXT76929.1|2919949_2920843_-	hypothetical protein	NA	NA	NA	NA	NA
AXT76930.1|2920996_2921743_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AXT76931.1|2921739_2921922_-	protein YcaR	NA	NA	NA	NA	NA
AXT76932.1|2921973_2923206_-	winged helix DNA-binding protein YcaQ	NA	NA	NA	NA	NA
AXT76933.1|2924224_2925973_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AXT76934.1|2926009_2928274_-	ComEC family protein	NA	NA	NA	NA	NA
AXT76935.1|2928481_2928766_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AXT76936.1|2928925_2930599_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AXT76937.1|2930709_2931393_-	cytidylate kinase	NA	NA	NA	NA	NA
AXT76938.1|2931565_2932330_-|protease	metalloprotease	protease	NA	NA	NA	NA
AXT76939.1|2932498_2933782_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AXT76940.1|2933852_2934941_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AXT76941.1|2935139_2935832_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AXT76942.1|2935961_2937722_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AXT76943.1|2938127_2938985_+	formate transporter FocA	NA	NA	NA	NA	NA
AXT76944.1|2939039_2941322_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AXT76945.1|2941641_2941896_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AXT76946.1|2941941_2943105_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
AXT76947.1|2943104_2943584_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.1e-84
AXT76948.1|2943598_2946046_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.2	0.0e+00
AXT78641.1|2946038_2946158_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AXT76949.1|2946190_2946466_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AXT76950.1|2946522_2947041_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AXT76951.1|2947053_2948244_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
AXT76952.1|2948303_2948897_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	96.4	8.7e-103
AXT78642.1|2948927_2949440_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	62.3	2.5e-45
AXT76953.1|2949439_2950033_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	61.9	5.6e-57
AXT76954.1|2950004_2950439_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.4	6.5e-23
AXT76955.1|2951868_2952480_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.0	7.1e-116
AXT76956.1|2952472_2953381_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	2.2e-161
AXT76957.1|2953385_2953733_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	1.1e-57
AXT76958.1|2953729_2954365_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	9.3e-111
AXT76959.1|2954431_2954884_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
AXT76960.1|2954876_2955344_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	6.7e-82
AXT76961.1|2955306_2955480_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
AXT76962.1|2955451_2955877_-	protein lysB	NA	U5N3W5	Enterobacteria_phage	96.5	1.2e-66
AXT76963.1|2956303_2956801_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AXT76964.1|2956800_2957082_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AXT76965.1|2957085_2957289_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AXT76966.1|2957288_2957798_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AXT76967.1|2957897_2958641_-|terminase	terminase	terminase	Q858W5	Yersinia_virus	98.8	4.6e-125
AXT76968.1|2958644_2959718_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
AXT76969.1|2959776_2960631_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.3e-136
AXT76970.1|2960804_2962577_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
AXT76971.1|2962576_2963611_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	1.9e-201
AXT76972.1|2963942_2964641_-	hypothetical protein	NA	NA	NA	NA	NA
AXT76973.1|2964845_2965577_-	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	79.8	4.1e-110
AXT76974.1|2965806_2966013_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	94.0	2.6e-30
AXT78643.1|2966012_2966465_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	97.3	1.2e-80
AXT76975.1|2966464_2968750_-	replication protein A	NA	Q858T4	Yersinia_virus	97.8	0.0e+00
AXT76976.1|2968739_2969015_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	98.9	6.6e-45
AXT76977.1|2969011_2969236_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AXT76978.1|2969235_2969538_-	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	99.0	3.8e-46
AXT76979.1|2969537_2969762_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AXT76980.1|2969825_2970326_-	replication protein B	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
AXT76981.1|2970322_2970520_-	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	98.5	2.3e-28
AXT76982.1|2970503_2970860_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	84.7	5.9e-54
AXT76983.1|2970964_2971264_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	79.8	1.0e-38
AXT76984.1|2971357_2972353_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.4	9.3e-190
AXT76985.1|2972384_2973182_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AXT76986.1|2973263_2973854_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
AXT76987.1|2974863_2976294_-	inner membrane transporter YcaM	NA	NA	NA	NA	NA
AXT76988.1|2976503_2977652_-	MFS transporter	NA	NA	NA	NA	NA
AXT76989.1|2977965_2978592_+	hydrolase	NA	NA	NA	NA	NA
AXT76990.1|2978626_2979490_-	dimethyl sulfoxide reductase subunit C	NA	NA	NA	NA	NA
AXT76991.1|2979491_2980109_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AXT76992.1|2980119_2982564_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AXT76993.1|2982802_2984095_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AXT76994.1|2984185_2985529_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AXT76995.1|2985539_2986151_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXT76996.1|2986305_2990334_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
2987337:2987357	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
AXT76997.1|2990468_2990963_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AXT76998.1|2991507_2992473_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AXT76999.1|2992595_2994362_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AXT77000.1|2994362_2996084_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
AXT77001.1|2996125_2996830_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXT77002.1|2997114_2997333_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXT77003.1|2998193_3000470_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
AXT77004.1|3000500_3000821_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 8
CP029687	Escherichia coli strain E706 chromosome, complete genome	4696142	3031934	3071476	4696142	integrase,plate,capsid,tail,portal,head,transposase	Salmonella_phage(76.09%)	52	3038029:3038042	3071925:3071938
AXT77032.1|3031934_3033086_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AXT77033.1|3033036_3033768_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AXT77034.1|3033751_3034039_-	DUF1418 domain-containing protein	NA	NA	NA	NA	NA
AXT77035.1|3034386_3035310_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
AXT77036.1|3035306_3035522_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	60.7	4.1e-10
AXT77037.1|3035551_3035929_-	hypothetical protein	NA	NA	NA	NA	NA
AXT77038.1|3036198_3037884_+	transporter	NA	NA	NA	NA	NA
3038029:3038042	attL	ATGGGTTTTTTGTT	NA	NA	NA	NA
AXT77039.1|3038119_3038338_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AXT77040.1|3038428_3039529_-	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	87.4	1.4e-175
AXT77041.1|3039525_3040011_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
AXT77042.1|3040007_3043085_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.5	0.0e+00
AXT77043.1|3043077_3043197_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AXT77044.1|3043211_3043514_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	4.1e-40
AXT77045.1|3043568_3044084_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AXT77046.1|3044093_3045266_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	3.5e-204
AXT77047.1|3045392_3045974_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	89.6	5.4e-89
AXT77048.1|3046004_3046517_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	64.2	1.0e-46
AXT77049.1|3046516_3047110_+|tail	phage tail protein	tail	K7P870	Enterobacteria_phage	63.1	1.6e-59
AXT77050.1|3047081_3047522_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	63.3	6.4e-50
AXT77051.1|3048944_3049550_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.6e-110
AXT77052.1|3049542_3050451_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	9.2e-144
AXT77053.1|3050437_3050797_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AXT77054.1|3050793_3051372_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	8.0e-93
AXT77055.1|3051440_3051887_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
AXT77056.1|3051879_3052311_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	5.8e-72
AXT77057.1|3052273_3052477_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	1.8e-23
AXT77058.1|3052406_3052835_-	hypothetical protein	NA	E5G6N2	Salmonella_phage	77.3	4.9e-47
AXT77059.1|3052831_3053209_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	3.9e-16
AXT78645.1|3053210_3053684_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	1.3e-80
AXT77060.1|3053703_3053919_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AXT77061.1|3053922_3054126_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AXT77062.1|3054125_3054590_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
AXT77063.1|3054685_3055336_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AXT77064.1|3055339_3056398_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	9.3e-180
AXT77065.1|3056414_3057248_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.8	1.4e-122
AXT77066.1|3057390_3059157_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
AXT77067.1|3059156_3060188_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.5	2.9e-170
AXT77068.1|3060227_3061994_-	hypothetical protein	NA	D0UIM0	Aggregatibacter_phage	34.8	4.1e-79
AXT77069.1|3062365_3063238_-	hypothetical protein	NA	NA	NA	NA	NA
AXT77070.1|3063449_3063755_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AXT77071.1|3063693_3063882_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AXT77072.1|3064034_3066449_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.6	0.0e+00
AXT77073.1|3066445_3067303_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	94.4	1.5e-156
AXT77074.1|3067299_3067527_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AXT77075.1|3067526_3067760_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
AXT77076.1|3067827_3068169_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AXT77077.1|3068286_3068583_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
AXT77078.1|3068590_3069100_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AXT77079.1|3069132_3069354_-	regulator	NA	NA	NA	NA	NA
AXT77080.1|3069479_3070049_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
AXT77081.1|3070064_3070256_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
AXT77082.1|3070444_3071476_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	1.9e-105
3071925:3071938	attR	ATGGGTTTTTTGTT	NA	NA	NA	NA
>prophage 9
CP029687	Escherichia coli strain E706 chromosome, complete genome	4696142	3605125	3688592	4696142	integrase,protease,plate,holin,terminase,tail,capsid,portal,head,transposase	Shigella_phage(50.0%)	91	3668630:3668647	3695900:3695917
AXT77559.1|3605125_3607159_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AXT78661.1|3607155_3607371_-	hypothetical protein	NA	NA	NA	NA	NA
AXT77560.1|3607287_3607875_+	transcriptional regulator	NA	NA	NA	NA	NA
AXT77561.1|3607888_3609361_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AXT77562.1|3609374_3611045_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AXT77563.1|3611257_3611926_+	hypothetical protein	NA	NA	NA	NA	NA
AXT77564.1|3611897_3612095_+	universal stress protein	NA	NA	NA	NA	NA
AXT77565.1|3612001_3612214_+	hypothetical protein	NA	NA	NA	NA	NA
AXT77566.1|3612168_3612864_-	lactate utilization protein C	NA	NA	NA	NA	NA
AXT77567.1|3612856_3614284_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AXT77568.1|3614294_3615014_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AXT77569.1|3615538_3616393_-	transcriptional regulator	NA	NA	NA	NA	NA
AXT77570.1|3616618_3617944_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
AXT77571.1|3618052_3618289_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXT77572.1|3618300_3618894_+	protein RclC	NA	NA	NA	NA	NA
AXT77573.1|3620102_3621375_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
AXT77574.1|3621350_3621671_+	transcriptional regulator	NA	NA	NA	NA	NA
AXT77575.1|3621810_3626067_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
AXT77576.1|3627181_3627283_+	hypothetical protein	NA	NA	NA	NA	NA
AXT77577.1|3627646_3627910_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AXT77578.1|3627909_3628050_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AXT77579.1|3628084_3628312_-	hypothetical protein	NA	NA	NA	NA	NA
AXT77580.1|3628373_3628553_-	hypothetical protein	NA	NA	NA	NA	NA
AXT77581.1|3629087_3629678_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXT77582.1|3629752_3630340_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
AXT77583.1|3630397_3631066_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
AXT77584.1|3631091_3633617_+	usher protein EcpC	NA	NA	NA	NA	NA
AXT77585.1|3633606_3635250_+	fimbria adhesin EcpD	NA	NA	NA	NA	NA
AXT77586.1|3636240_3636570_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXT78662.1|3636564_3636744_-	hypothetical protein	NA	NA	NA	NA	NA
AXT77587.1|3637543_3637669_+	transporter	NA	NA	NA	NA	NA
AXT77588.1|3638534_3639491_+	xanthine dehydrogenase	NA	NA	NA	NA	NA
AXT77589.1|3639487_3641686_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.6	9.6e-38
AXT77590.1|3641695_3642652_+	XdhC family protein	NA	NA	NA	NA	NA
AXT77591.1|3642630_3643041_+	hypothetical protein	NA	NA	NA	NA	NA
AXT77592.1|3643278_3643413_-	hypothetical protein	NA	NA	NA	NA	NA
AXT77593.1|3643575_3646329_+	ABC transporter	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	26.0	9.6e-27
AXT78663.1|3646928_3647426_+	hypothetical protein	NA	NA	NA	NA	NA
AXT77594.1|3647768_3648323_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.7	1.8e-86
AXT77595.1|3648352_3648739_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	70.0	2.1e-09
AXT77596.1|3649931_3650534_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	8.6e-98
AXT77597.1|3650533_3651361_-|integrase	integrase	integrase	U5P0I1	Shigella_phage	94.4	6.4e-51
AXT77598.1|3651364_3651949_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	97.9	1.6e-112
AXT77599.1|3651939_3652998_-|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	98.0	1.1e-199
AXT77600.1|3652984_3653413_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	5.2e-81
AXT77601.1|3653409_3653958_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.4	3.3e-96
AXT77602.1|3653957_3655037_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
AXT77603.1|3655033_3656404_-	DNA circularization protein	NA	S5FUX4	Shigella_phage	98.2	1.1e-252
AXT77604.1|3658248_3658431_-	hypothetical protein	NA	NA	NA	NA	NA
AXT77605.1|3658397_3658667_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
AXT77606.1|3661709_3662120_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	96.3	2.1e-71
AXT77607.1|3662116_3662440_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
AXT77608.1|3662442_3662643_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
AXT77609.1|3662692_3663898_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.8	3.1e-224
AXT77610.1|3663912_3664599_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	1.1e-125
AXT77611.1|3664540_3665782_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	4.5e-242
AXT77612.1|3665781_3665964_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	96.7	1.1e-24
AXT77613.1|3665975_3667709_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.4	0.0e+00
AXT77614.1|3667705_3668209_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	2.3e-88
AXT77615.1|3668325_3668676_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	3.1e-63
3668630:3668647	attL	TGGCGGCAGCCGCGAACG	NA	NA	NA	NA
AXT77616.1|3668803_3669238_-	hypothetical protein	NA	NA	NA	NA	NA
AXT77617.1|3669763_3670156_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	86.2	1.4e-53
AXT77618.1|3670139_3670616_-	lysozyme	NA	U5P0A9	Shigella_phage	99.4	2.9e-88
AXT78664.1|3670619_3670955_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
AXT77619.1|3671031_3672084_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.0	4.1e-204
AXT77620.1|3672234_3672438_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AXT77621.1|3672757_3673777_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
AXT77622.1|3673791_3674172_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.1e-57
AXT77623.1|3674186_3675176_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	1.2e-194
AXT77624.1|3675183_3675981_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	4.4e-150
AXT77625.1|3676000_3676390_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AXT77626.1|3676386_3676713_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
AXT77627.1|3676709_3677363_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
AXT77628.1|3677362_3677857_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	1.2e-86
AXT77629.1|3677853_3678795_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
AXT77630.1|3678784_3678964_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AXT77631.1|3679139_3679691_-	hypothetical protein	NA	U5P4K1	Shigella_phage	100.0	2.0e-101
AXT77632.1|3679734_3679935_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AXT77633.1|3680025_3680700_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
AXT77634.1|3680919_3681141_+	hypothetical protein	NA	NA	NA	NA	NA
AXT77635.1|3681112_3681547_-	hypothetical protein	NA	U5P096	Shigella_phage	99.3	3.2e-78
AXT77636.1|3681465_3681810_-	hypothetical protein	NA	U5P0J5	Shigella_phage	99.1	3.3e-62
AXT78665.1|3681718_3681943_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	63.1	4.1e-13
AXT77637.1|3682091_3682628_+	HD family hydrolase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
AXT77638.1|3682618_3682981_+	hypothetical protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
AXT77639.1|3682980_3683286_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
AXT77640.1|3683285_3683636_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AXT78666.1|3683737_3684676_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
AXT77641.1|3684880_3686134_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	1.3e-95
AXT77642.1|3686145_3687249_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AXT77643.1|3687536_3688592_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
3695900:3695917	attR	CGTTCGCGGCTGCCGCCA	NA	NA	NA	NA
>prophage 1
CP029688	Escherichia coli strain E706 plasmid pLKJULY7989, complete sequence	151879	15869	76307	151879	integrase,transposase	Escherichia_phage(43.9%)	58	37877:37923	82629:82675
AXT78711.1|15869_16850_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.2	9.8e-184
AXT78712.1|17213_20546_+	helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	41.9	3.3e-239
AXT78713.1|20549_21236_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
AXT78825.1|21310_23155_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	40.6	1.2e-121
AXT78714.1|23164_26242_+	restriction endonuclease subunit R	NA	A0A2K5B2C2	Erysipelothrix_phage	33.1	1.6e-126
AXT78715.1|27880_28231_+	hypothetical protein	NA	Q716C1	Shigella_phage	98.9	1.4e-39
AXT78716.1|30240_31317_+|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
AXT78717.1|31638_31833_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	72.1	3.3e-19
AXT78718.1|31865_32387_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXT78719.1|32394_32664_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AXT78720.1|32983_33649_+	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	98.2	2.0e-116
AXT78721.1|33648_34008_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
AXT78722.1|34060_34828_-	hypothetical protein	NA	NA	NA	NA	NA
AXT78723.1|34972_36245_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	6.1e-170
AXT78724.1|36442_37177_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXT78725.1|37568_37982_+	hypothetical protein	NA	Q716C1	Shigella_phage	53.5	8.7e-17
37877:37923	attL	TGTAGATTCAATTGGTCAACGCAACAGTTATGTGAAAACATGGGGTT	NA	NA	NA	NA
AXT78726.1|37938_39090_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.6e-42
AXT78727.1|39009_39360_-	hypothetical protein	NA	Q716C1	Shigella_phage	97.7	5.2e-39
AXT78728.1|39812_39968_+	norphogenetic protein	NA	Q1MVH0	Enterobacteria_phage	98.0	1.2e-19
AXT78729.1|39909_40572_+	norphogenetic protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
AXT78730.1|40469_41096_+	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	100.0	2.1e-123
AXT78731.1|41092_41770_+	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	96.4	6.6e-131
AXT78732.1|41766_42468_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	97.4	2.8e-140
AXT78733.1|42549_42768_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AXT78734.1|42769_43132_+	hypothetical protein	NA	A0A077SL55	Escherichia_phage	97.6	4.6e-38
AXT78735.1|43077_43782_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXT78736.1|43986_44778_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AXT78737.1|44783_45074_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AXT78738.1|45185_45683_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AXT78739.1|45827_46841_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXT78740.1|46779_47394_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AXT78741.1|47519_48080_+	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AXT78742.1|51030_51438_+	hypothetical protein	NA	NA	NA	NA	NA
AXT78743.1|54302_55463_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.2	4.0e-19
AXT78744.1|55490_55796_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXT78745.1|55907_57401_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXT78746.1|57431_57683_+	hypothetical protein	NA	NA	NA	NA	NA
AXT78747.1|57576_57879_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXT78748.1|57965_58781_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AXT78749.1|58870_59960_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AXT78750.1|60157_60637_-	phenol hydroxylase	NA	NA	NA	NA	NA
AXT78751.1|60692_61397_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT78752.1|63015_63153_+	pdcA	NA	Q71TH5	Escherichia_phage	97.8	2.4e-16
AXT78753.1|63180_64224_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.6	1.5e-203
AXT78754.1|64526_64838_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	98.0	2.9e-49
AXT78755.1|64870_65722_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	1.0e-157
AXT78756.1|65832_66042_-	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
AXT78757.1|66007_66103_-	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AXT78758.1|66121_66235_-	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AXT78759.1|66646_66868_+	creatininase	NA	Q5QBN7	Enterobacteria_phage	98.6	5.8e-36
AXT78760.1|66875_67907_+	recombinase	NA	Q71TG5	Escherichia_phage	99.1	3.2e-193
AXT78761.1|67957_68269_+	lysogeny establishment protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	2.8e-44
AXT78762.1|68518_69079_+	recombinase	NA	Q71TG3	Escherichia_phage	98.9	1.0e-100
AXT78763.1|69267_69912_+	maturation control protein	NA	A0A1B0VAG4	Salmonella_phage	86.3	1.7e-96
AXT78764.1|70004_70655_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AXT78765.1|71649_71898_-	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AXT78766.1|71894_72335_-	peptide-binding protein	NA	Q71TR9	Escherichia_phage	99.3	3.8e-79
AXT78767.1|72368_76307_-	helicase	NA	Q1MVN7	Enterobacteria_phage	98.2	0.0e+00
82629:82675	attR	AACCCCATGTTTTCACATAACTGTTGCGTTGACCAATTGAATCTACA	NA	NA	NA	NA
>prophage 2
CP029688	Escherichia coli strain E706 plasmid pLKJULY7989, complete sequence	151879	92516	151879	151879	plate,transposase	Escherichia_phage(40.54%)	50	NA	NA
AXT78779.1|92516_93221_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXT78780.1|93833_94694_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXT78781.1|95689_97156_+	HAMP domain-containing protein	NA	A0A1B0V854	Salmonella_phage	98.6	3.6e-73
AXT78782.1|97390_97771_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	9.7e-63
AXT78783.1|97770_97992_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	3.3e-31
AXT78826.1|99369_100341_-	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.1	1.4e-179
AXT78784.1|100447_101152_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXT78785.1|103658_104363_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXT78786.1|105295_106111_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AXT78787.1|106171_106975_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AXT78788.1|106974_107811_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXT78789.1|107938_108409_+	micrococcal nuclease	NA	A0A0R6PHV6	Moraxella_phage	37.1	2.8e-19
AXT78790.1|108823_109069_+	hypothetical protein	NA	NA	NA	NA	NA
AXT78791.1|109088_111413_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.2	6.0e-38
AXT78792.1|111424_111874_+	DNA-binding protein	NA	NA	NA	NA	NA
AXT78793.1|112322_115310_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.4	1.1e-294
AXT78794.1|116009_117143_-	permease	NA	NA	NA	NA	NA
AXT78795.1|117248_117572_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXT78796.1|118748_119453_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT78828.1|119343_119595_-	hypothetical protein	NA	NA	NA	NA	NA
AXT78827.1|119581_120346_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXT78797.1|120317_120695_-	hypothetical protein	NA	Q6JIG6	Burkholderia_virus	38.4	2.0e-07
AXT78798.1|120777_120996_-	hypothetical protein	NA	NA	NA	NA	NA
AXT78799.1|121103_121772_+	LexA family transcriptional repressor	NA	B1B6L9	Salmonella_phage	38.8	4.5e-23
AXT78800.1|121897_122254_-	hypothetical protein	NA	NA	NA	NA	NA
AXT78801.1|122199_122784_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXT78802.1|124017_124923_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXT78803.1|125515_126220_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT78804.1|126864_127875_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.9	6.7e-87
AXT78805.1|128615_129782_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
AXT78806.1|129781_130753_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	89.7	4.2e-155
AXT78807.1|131847_133056_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	81.8	1.7e-190
AXT78808.1|133372_134644_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	1.0e-153
AXT78809.1|134643_135069_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
AXT78810.1|135221_135473_+	hypothetical protein	NA	NA	NA	NA	NA
AXT78811.1|135606_136779_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.7	8.3e-230
AXT78812.1|136775_137576_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
AXT78829.1|137774_138005_+	reverse transcriptase	NA	NA	NA	NA	NA
AXT78813.1|138030_139243_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	3.5e-167
AXT78814.1|139246_139585_-	hypothetical protein	NA	U5P429	Shigella_phage	87.8	9.6e-38
AXT78815.1|140345_140501_+	type I toxin-antitoxin system hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
AXT78816.1|141965_142475_-|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	6.6e-91
AXT78817.1|142486_143068_-	hypothetical protein	NA	Q71TM4	Escherichia_phage	96.9	1.8e-100
AXT78818.1|143103_143919_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	97.0	3.9e-109
AXT78819.1|143928_145518_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	97.9	4.9e-302
AXT78820.1|145577_147284_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
AXT78821.1|147509_148511_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AXT78822.1|148527_149724_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AXT78823.1|149892_150702_-	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.4	1.3e-154
AXT78824.1|150994_151879_-	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
