The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023416	Klebsiella pneumoniae strain 1050 chromosome, complete genome	5338202	649099	669018	5338202	terminase,capsid,portal,head,protease,tail,integrase	uncultured_Caudovirales_phage(61.54%)	22	649024:649049	666304:666329
649024:649049	attL	TTGCGGTATCCTATAGGTATCCTAGA	NA	NA	NA	NA
AXT64386.1|649099_650524_+|integrase	integrase	integrase	H7BV31	unidentified_phage	24.9	3.3e-07
AXT64387.1|650520_651150_+	hypothetical protein	NA	NA	NA	NA	NA
AXT64388.1|651293_651515_+	DNA-binding protein	NA	NA	NA	NA	NA
AXT64389.1|651535_652219_+	toxin Bro	NA	A0A1B5FPC0	Escherichia_phage	44.8	6.0e-23
AXT68661.1|652891_653083_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AXT64390.1|653222_653411_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AXT64391.1|653403_653598_+	hypothetical protein	NA	NA	NA	NA	NA
AXT64392.1|653594_653807_+	hypothetical protein	NA	NA	NA	NA	NA
AXT64393.1|653790_655542_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	51.4	6.5e-130
AXT64394.1|655844_656027_+	hypothetical protein	NA	NA	NA	NA	NA
AXT64395.1|656261_657422_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	94.0	4.5e-204
AXT64396.1|657473_658034_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	93.5	6.8e-97
AXT68662.1|658044_659262_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	93.9	2.1e-223
AXT64397.1|659258_659597_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	92.0	3.6e-53
AXT64398.1|659593_659887_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	92.8	3.4e-47
AXT64399.1|659886_660330_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.2	1.5e-78
AXT64400.1|660604_660961_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.1	2.7e-51
AXT64401.1|660944_662606_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.8	0.0e+00
AXT64402.1|662619_666027_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	43.2	1.6e-185
AXT64403.1|666082_666274_+	hypothetical protein	NA	NA	NA	NA	NA
AXT64404.1|666570_667077_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
666304:666329	attR	TTGCGGTATCCTATAGGTATCCTAGA	NA	NA	NA	NA
AXT64405.1|667176_669018_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
>prophage 2
CP023416	Klebsiella pneumoniae strain 1050 chromosome, complete genome	5338202	1247226	1302902	5338202	terminase,holin,tRNA,tail,coat,transposase,integrase	Salmonella_phage(23.64%)	75	1245905:1245921	1279569:1279585
1245905:1245921	attL	GCGGGTGAAGTGCTCGC	NA	NA	NA	NA
AXT64939.1|1247226_1248312_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AXT64940.1|1248369_1249059_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AXT64941.1|1249371_1249755_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AXT64942.1|1249800_1251132_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
AXT64943.1|1251263_1252001_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AXT64944.1|1251985_1253605_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AXT64945.1|1254025_1254601_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AXT64946.1|1254633_1255284_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AXT64947.1|1255283_1256240_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AXT64948.1|1256236_1256716_+	SoxR reducing system protein RseC	NA	NA	NA	NA	NA
AXT64949.1|1257147_1258377_+|integrase	integrase	integrase	H6WRW7	Salmonella_phage	96.3	1.3e-238
AXT64950.1|1258354_1258630_-	excisionase	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
AXT68684.1|1258667_1258907_-	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
AXT64951.1|1258914_1259223_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	4.2e-24
AXT64952.1|1259936_1261025_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	56.0	1.4e-106
AXT64953.1|1261037_1264136_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.6	6.0e-296
AXT64954.1|1264273_1264429_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
AXT64955.1|1264437_1264629_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AXT68685.1|1265094_1265298_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	76.1	1.1e-20
AXT64956.1|1265326_1265737_-	hypothetical protein	NA	NA	NA	NA	NA
AXT64957.1|1265863_1266250_-	transcriptional regulator	NA	A0A0M4R5D1	Salmonella_phage	92.9	1.0e-56
AXT64958.1|1266353_1266584_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	85.9	3.2e-29
AXT64959.1|1266586_1267150_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	44.1	2.1e-29
AXT64960.1|1267494_1267683_+	hypothetical protein	NA	NA	NA	NA	NA
AXT64961.1|1267697_1268606_+	DNA-binding protein	NA	V5URT9	Shigella_phage	49.2	2.9e-89
AXT64962.1|1268608_1269358_+	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	84.3	3.1e-121
AXT64963.1|1269365_1269701_+	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	43.0	7.6e-11
AXT64964.1|1269693_1270479_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	1.6e-64
AXT64965.1|1270606_1271020_+	hypothetical protein	NA	T1SBJ7	Salmonella_phage	52.8	1.4e-19
AXT64966.1|1271016_1271223_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	100.0	1.6e-32
AXT64967.1|1271761_1272730_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXT64968.1|1272918_1273212_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
AXT64969.1|1273208_1273865_+	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	51.7	4.7e-49
AXT64970.1|1273857_1274109_+	hypothetical protein	NA	A0A2P1MXF0	Escherichia_phage	42.7	5.3e-09
AXT64971.1|1274877_1275111_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
AXT64972.1|1275216_1275465_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
AXT64973.1|1275499_1276096_+	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	79.6	1.9e-89
AXT64974.1|1276095_1276302_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	74.2	2.8e-24
AXT64975.1|1276304_1276601_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
AXT64976.1|1276597_1276954_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.5e-41
AXT64977.1|1276950_1277073_+	hypothetical protein	NA	NA	NA	NA	NA
AXT64978.1|1277069_1277891_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.4e-98
AXT64979.1|1278136_1278448_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
AXT64980.1|1278444_1278984_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
AXT64981.1|1278980_1279328_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	1.8e-39
AXT64982.1|1279324_1279600_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	90.1	5.8e-09
1279569:1279585	attR	GCGAGCACTTCACCCGC	NA	NA	NA	NA
AXT64983.1|1279550_1279745_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	82.8	3.2e-22
AXT64984.1|1279835_1280120_-	hypothetical protein	NA	NA	NA	NA	NA
AXT64985.1|1280252_1280525_+	hypothetical protein	NA	NA	NA	NA	NA
AXT64986.1|1280457_1280709_-	hypothetical protein	NA	NA	NA	NA	NA
AXT64987.1|1280835_1281036_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	3.4e-19
AXT64988.1|1281434_1281671_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	64.1	2.2e-17
AXT64989.1|1281729_1281918_+	hypothetical protein	NA	NA	NA	NA	NA
AXT64990.1|1281921_1282926_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.0	2.8e-37
AXT64991.1|1282903_1284208_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	4.8e-146
AXT64992.1|1284212_1285637_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.5	1.5e-193
AXT64993.1|1285620_1286733_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.8	2.1e-110
AXT64994.1|1286839_1287604_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.8	1.1e-78
AXT64995.1|1287691_1288828_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.9	6.9e-157
AXT64996.1|1288877_1289162_+	hypothetical protein	NA	NA	NA	NA	NA
AXT64997.1|1289165_1289576_+	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	40.4	6.0e-10
AXT64998.1|1289577_1289961_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	5.4e-21
AXT64999.1|1289962_1290514_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.8	6.6e-28
AXT65000.1|1290510_1290903_+	electron transfer flavoprotein subunit beta	NA	A0A059VK45	Pseudomonas_phage	34.6	2.4e-16
AXT65001.1|1290926_1292099_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	3.2e-24
AXT65002.1|1292152_1292635_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65003.1|1292802_1292970_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65004.1|1293146_1293677_+	hypothetical protein	NA	A0A2H4FQV0	Salmonella_phage	68.4	6.1e-63
AXT65005.1|1293758_1294256_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65006.1|1294301_1294664_+	hypothetical protein	NA	S4TR42	Salmonella_phage	72.4	2.3e-05
AXT65007.1|1294759_1298326_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	29.7	7.4e-80
AXT65008.1|1298325_1298790_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.9e-58
AXT65009.1|1298970_1299453_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	95.0	1.8e-82
AXT65010.1|1299462_1299843_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	77.0	1.5e-55
AXT65011.1|1299839_1302902_+	kinase	NA	A0A286S259	Klebsiella_phage	93.8	0.0e+00
>prophage 3
CP023416	Klebsiella pneumoniae strain 1050 chromosome, complete genome	5338202	1367575	1414269	5338202	terminase,tRNA,tail,transposase,integrase	Salmonella_phage(29.55%)	59	1378443:1378469	1424225:1424251
AXT65063.1|1367575_1368850_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AXT65064.1|1368884_1369505_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65065.1|1369515_1370694_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AXT65066.1|1370807_1372286_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AXT65067.1|1372403_1373483_+	oxidoreductase	NA	NA	NA	NA	NA
AXT65068.1|1373532_1373751_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65069.1|1373734_1375126_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
AXT65070.1|1375284_1376751_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AXT65071.1|1376818_1378396_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
1378443:1378469	attL	AACCCTCTGTTTTTACAGAGGGTTTTT	NA	NA	NA	NA
AXT65072.1|1378587_1379838_+|integrase	integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
AXT65073.1|1379854_1380046_-	hypothetical protein	NA	NA	NA	NA	NA
AXT65074.1|1380042_1380636_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.9	4.3e-110
AXT65075.1|1380632_1380791_-	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
AXT65076.1|1380783_1381077_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
AXT65077.1|1381186_1381435_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
AXT65078.1|1381483_1382419_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	72.2	4.4e-133
AXT65079.1|1382415_1383237_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	82.4	1.6e-134
AXT65080.1|1383233_1383533_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	6.1e-20
AXT68688.1|1383540_1384572_-	hypothetical protein	NA	A0A059VK18	Pseudomonas_phage	51.6	9.4e-36
AXT65081.1|1384975_1385557_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	4.6e-64
AXT65082.1|1385711_1385945_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
AXT68689.1|1386091_1386295_+	hypothetical protein	NA	Q858D5	Salmonella_phage	82.1	2.3e-23
AXT65083.1|1386322_1387093_+	DNA replication domain protein	NA	G9L6A8	Escherichia_phage	91.7	5.5e-57
AXT65084.1|1387218_1387563_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	4.1e-52
AXT65085.1|1387755_1388178_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65086.1|1388174_1388381_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	95.6	4.0e-31
AXT65087.1|1388377_1388773_+	hypothetical protein	NA	G8C7U4	Escherichia_phage	80.6	8.8e-59
AXT65088.1|1388765_1389254_+	hypothetical protein	NA	A0A248XD51	Klebsiella_phage	58.7	1.8e-21
AXT65089.1|1389265_1390234_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXT65090.1|1390422_1390635_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	9.6e-12
AXT68690.1|1390817_1391384_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	36.8	3.5e-08
AXT65091.1|1391383_1391572_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	75.0	5.5e-19
AXT65092.1|1391564_1391903_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	3.1e-44
AXT68691.1|1391977_1392235_+	lF-82	NA	NA	NA	NA	NA
AXT68692.1|1392312_1392897_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	87.0	1.0e-87
AXT65093.1|1392893_1394369_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.7	2.4e-279
AXT65094.1|1394412_1394784_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	94.3	5.2e-61
AXT65095.1|1394834_1395065_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65096.1|1395369_1395558_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65097.1|1395577_1395784_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AXT65098.1|1395798_1397481_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.8	3.0e-265
AXT65099.1|1397477_1397777_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	68.4	3.1e-32
AXT65100.1|1397773_1398097_+|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AXT65101.1|1398108_1398798_+	peptidase	NA	G9L6C4	Escherichia_phage	81.4	5.3e-67
AXT65102.1|1398812_1399799_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.9e-179
AXT65103.1|1399852_1400290_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	6.3e-66
AXT65104.1|1400300_1400642_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	71.7	8.2e-37
AXT65105.1|1400692_1401016_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
AXT65106.1|1401015_1401621_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	79.0	4.3e-89
AXT65107.1|1401620_1404098_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
AXT65108.1|1404097_1404562_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
AXT65109.1|1404561_1405101_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
AXT65110.1|1405111_1407628_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	81.4	0.0e+00
AXT65111.1|1407624_1409430_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	73.3	1.3e-237
AXT65112.1|1409433_1411908_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	86.9	0.0e+00
AXT65113.1|1412106_1412403_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	94.8	4.4e-47
AXT65114.1|1412437_1412590_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	85.7	1.9e-14
AXT68693.1|1412688_1412949_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	62.8	7.9e-24
AXT65115.1|1413048_1414269_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
1424225:1424251	attR	AACCCTCTGTTTTTACAGAGGGTTTTT	NA	NA	NA	NA
>prophage 4
CP023416	Klebsiella pneumoniae strain 1050 chromosome, complete genome	5338202	1752613	1759518	5338202		Planktothrix_phage(33.33%)	6	NA	NA
AXT68705.1|1752613_1753477_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AXT65407.1|1753487_1754261_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AXT68706.1|1754501_1755395_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	3.6e-15
AXT65408.1|1755640_1757002_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AXT65409.1|1757320_1758043_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AXT65410.1|1758039_1759518_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
CP023416	Klebsiella pneumoniae strain 1050 chromosome, complete genome	5338202	1803296	1818558	5338202		Hokovirus(18.18%)	13	NA	NA
AXT65441.1|1803296_1804703_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AXT65442.1|1804944_1806360_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AXT68708.1|1806382_1807753_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.0	6.4e-32
AXT65443.1|1807909_1808974_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	7.5e-105
AXT65444.1|1809000_1809870_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
AXT65445.1|1809901_1810792_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
AXT65446.1|1810806_1811361_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.5e-51
AXT65447.1|1811541_1812708_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	5.3e-112
AXT65448.1|1813654_1814659_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
AXT65449.1|1814614_1814809_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65450.1|1815171_1815456_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65451.1|1815737_1817153_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AXT68709.1|1817175_1818558_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.8	4.2e-31
>prophage 6
CP023416	Klebsiella pneumoniae strain 1050 chromosome, complete genome	5338202	2032388	2115068	5338202	head,tail,lysis,transposase,integrase,plate	Salmonella_phage(37.74%)	99	2034057:2034072	2069947:2069962
AXT65654.1|2032388_2034032_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
2034057:2034072	attL	GGCGCCGACCTGCTGG	NA	NA	NA	NA
AXT65655.1|2034081_2034558_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXT65656.1|2034656_2035583_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXT65657.1|2035886_2037182_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
AXT65658.1|2037196_2038003_+	molybdenum ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXT65659.1|2038243_2039506_-|integrase	integrase	integrase	A0A286S1S8	Klebsiella_phage	95.0	1.7e-233
AXT65660.1|2039553_2039796_-	excisionase	NA	A0A286S2A4	Klebsiella_phage	81.3	2.0e-29
AXT65661.1|2039799_2040018_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	50.9	8.6e-08
AXT65662.1|2040014_2040764_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	59.9	6.7e-84
AXT65663.1|2040760_2040985_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.5e-18
AXT65664.1|2040981_2041209_-	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	48.4	2.1e-09
AXT65665.1|2041510_2041804_-	hypothetical protein	NA	NA	NA	NA	NA
AXT65666.1|2042437_2042656_-	hypothetical protein	NA	NA	NA	NA	NA
AXT65667.1|2043132_2043729_-	XRE family transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	5.3e-07
AXT65668.1|2043837_2044050_+	transcriptional regulator	NA	NA	NA	NA	NA
AXT65669.1|2044070_2044292_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AXT65670.1|2044487_2044742_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65671.1|2044738_2045833_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	51.1	3.7e-30
AXT65672.1|2045859_2046255_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65673.1|2046254_2046476_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65674.1|2046468_2047254_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	9.0e-63
AXT68720.1|2047537_2048116_+	hypothetical protein	NA	A0A0M4RTV1	Salmonella_phage	61.8	9.6e-38
AXT65675.1|2048105_2048501_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	75.6	4.4e-50
AXT65676.1|2048547_2048817_+	hypothetical protein	NA	H6WRY4	Salmonella_phage	80.7	6.0e-35
AXT65677.1|2049371_2049680_+	hypothetical protein	NA	Q6V7S4	Burkholderia_virus	57.6	1.2e-23
AXT65678.1|2049672_2050332_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	78.1	7.7e-100
AXT65679.1|2050328_2050907_+	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	55.6	2.7e-48
AXT65680.1|2051003_2051279_-	hypothetical protein	NA	NA	NA	NA	NA
AXT65681.1|2051277_2051475_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65682.1|2051579_2052626_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AXT65683.1|2053098_2053347_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AXT65684.1|2053349_2053880_+	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	7.1e-80
AXT65685.1|2053876_2054266_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	49.2	5.3e-24
AXT65686.1|2054509_2054740_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65687.1|2054821_2055457_+	hypothetical protein	NA	I6S676	Salmonella_phage	82.1	3.6e-102
AXT65688.1|2055488_2055962_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	69.0	1.7e-53
AXT65689.1|2056222_2056414_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AXT68721.1|2056508_2058122_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	82.9	8.9e-275
AXT65690.1|2058125_2059577_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	69.0	3.2e-191
AXT68722.1|2059632_2060181_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
AXT65691.1|2060232_2061435_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	54.9	3.2e-112
AXT65692.1|2061438_2061933_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AXT65693.1|2061944_2062883_+	hypothetical protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.2	3.5e-138
AXT65694.1|2062922_2063204_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65695.1|2063172_2063592_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	5.7e-40
AXT65696.1|2063588_2064095_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65697.1|2064094_2064499_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	71.5	1.1e-43
AXT65698.1|2064491_2065043_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.4	4.4e-40
AXT65699.1|2065044_2066196_+	DUF3383 domain-containing protein	NA	A0A0M4RD26	Salmonella_phage	81.5	2.1e-177
AXT65700.1|2066206_2066647_+	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	79.5	2.1e-61
AXT65701.1|2066650_2067100_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	55.3	1.1e-36
AXT68723.1|2067141_2067294_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
AXT65702.1|2067283_2069206_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	6.2e-190
AXT65703.1|2069205_2069781_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	66.0	5.0e-63
AXT68724.1|2069856_2070084_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	50.0	6.2e-17
2069947:2069962	attR	GGCGCCGACCTGCTGG	NA	NA	NA	NA
AXT65704.1|2070086_2071151_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	67.9	1.1e-135
AXT65705.1|2071150_2071483_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.9	1.0e-23
AXT65706.1|2071650_2071869_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65707.1|2071908_2072676_+|plate	phage baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	70.5	4.8e-93
AXT65708.1|2072675_2073029_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.8e-50
AXT65709.1|2073028_2074228_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	74.8	3.2e-160
AXT65710.1|2074224_2074998_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	50.6	5.3e-68
AXT65711.1|2074997_2075771_+	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	49.7	3.0e-26
AXT65712.1|2078104_2079487_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65713.1|2079592_2079832_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	6.1e-15
AXT65714.1|2079831_2080149_+	hypothetical protein	NA	I6PCW5	Cronobacter_phage	53.7	5.3e-22
AXT65715.1|2081123_2081606_-	cold-shock protein	NA	NA	NA	NA	NA
AXT65716.1|2081796_2082495_+	pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	6.9e-06
AXT68725.1|2082520_2083060_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
AXT65717.1|2083174_2083504_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AXT65718.1|2083844_2084024_-	hypothetical protein	NA	NA	NA	NA	NA
AXT65719.1|2084071_2085412_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXT65720.1|2085408_2086062_+	type VI secretion system protein ImpK	NA	NA	NA	NA	NA
AXT65721.1|2086065_2087763_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
AXT65722.1|2088224_2090711_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXT65723.1|2090734_2092090_+	S-type Pyocin	NA	NA	NA	NA	NA
AXT65724.1|2092090_2092600_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65725.1|2093400_2094756_+	S-type Pyocin	NA	NA	NA	NA	NA
AXT65726.1|2094756_2095266_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65727.1|2095262_2095769_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65728.1|2096005_2096515_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65729.1|2096808_2098164_+	S-type Pyocin	NA	NA	NA	NA	NA
AXT65730.1|2098164_2098674_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65731.1|2098670_2099177_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65732.1|2099222_2099453_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65733.1|2099558_2100995_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65734.1|2101016_2101910_+	sulfatase modifying factor 1	NA	A0A7H6	Microcystis_virus	31.0	1.8e-14
AXT65735.1|2102093_2102987_+	sulfatase modifying factor 1	NA	A0A075BSL8	Microcystis_phage	27.4	2.8e-12
AXT65736.1|2103162_2104056_+	sulfatase modifying factor 1	NA	A0A075BSL8	Microcystis_phage	27.1	2.2e-12
AXT65737.1|2104231_2105122_+	sulfatase modifying factor 1	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
AXT65738.1|2105257_2105599_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65739.1|2105800_2106043_+	hypothetical protein	NA	NA	NA	NA	NA
AXT65740.1|2106340_2106607_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXT65741.1|2106610_2107768_+	type VI secretion protein	NA	NA	NA	NA	NA
AXT65742.1|2107751_2111162_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AXT65743.1|2111295_2113059_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXT65744.1|2113058_2114105_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXT68726.1|2114085_2114622_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXT65745.1|2114624_2115068_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 7
CP023416	Klebsiella pneumoniae strain 1050 chromosome, complete genome	5338202	2770159	2781046	5338202		Escherichia_phage(87.5%)	9	NA	NA
AXT66360.1|2770159_2773267_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AXT66361.1|2773321_2774587_+	MFS transporter	NA	NA	NA	NA	NA
AXT66362.1|2774617_2775706_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AXT66363.1|2775792_2776053_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AXT66364.1|2776350_2777211_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AXT66365.1|2777231_2777993_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXT66366.1|2778253_2779156_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AXT66367.1|2779167_2780433_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
AXT66368.1|2780425_2781046_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
CP023416	Klebsiella pneumoniae strain 1050 chromosome, complete genome	5338202	3168038	3256289	5338202	terminase,holin,capsid,portal,head,tRNA,tail,transposase,integrase	Klebsiella_phage(41.3%)	94	3194854:3194868	3254100:3254114
AXT66721.1|3168038_3168539_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AXT66722.1|3168655_3169102_+	DUF441 family protein	NA	NA	NA	NA	NA
AXT68770.1|3169085_3169877_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXT66723.1|3169978_3171163_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AXT66724.1|3171194_3171887_-	hypothetical protein	NA	NA	NA	NA	NA
AXT66725.1|3172032_3172542_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AXT66726.1|3172528_3172885_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AXT66727.1|3172874_3173114_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AXT66728.1|3173415_3174429_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
AXT66729.1|3174486_3174588_+	hypothetical protein	NA	NA	NA	NA	NA
AXT68771.1|3174545_3174662_+	hypothetical protein	NA	NA	NA	NA	NA
AXT66730.1|3174779_3174905_+	hypothetical protein	NA	NA	NA	NA	NA
AXT66731.1|3174964_3175228_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AXT66732.1|3175358_3175997_-	leucine efflux protein	NA	NA	NA	NA	NA
AXT66733.1|3176086_3177001_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AXT66734.1|3177216_3177408_+	hypothetical protein	NA	NA	NA	NA	NA
AXT66735.1|3177662_3178706_-	L-asparaginase	NA	NA	NA	NA	NA
AXT66736.1|3179008_3180217_+	phosphodiesterase	NA	NA	NA	NA	NA
AXT66737.1|3180290_3182075_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.5	2.6e-17
AXT66738.1|3182081_3182972_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXT66739.1|3183092_3184601_+	3,4-dihydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AXT66740.1|3184911_3185598_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AXT66741.1|3185995_3186175_-	hypothetical protein	NA	NA	NA	NA	NA
AXT66742.1|3186214_3186847_-	DNA-binding protein	NA	NA	NA	NA	NA
AXT66743.1|3187413_3187611_+	hypothetical protein	NA	NA	NA	NA	NA
AXT66744.1|3187726_3188737_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AXT66745.1|3188733_3190140_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXT66746.1|3190195_3191083_-	Mn-containing catalase	NA	NA	NA	NA	NA
AXT66747.1|3191099_3191606_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXT66748.1|3191632_3192127_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXT66749.1|3192217_3192403_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AXT66750.1|3193024_3194218_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AXT66751.1|3194330_3194558_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AXT66752.1|3194578_3194764_-	hypothetical protein	NA	NA	NA	NA	NA
3194854:3194868	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
AXT66753.1|3195007_3195331_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AXT66754.1|3195323_3195716_+	amino acid-binding protein	NA	NA	NA	NA	NA
AXT66755.1|3195712_3196426_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXT66756.1|3196698_3196851_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AXT66757.1|3197005_3198502_-|tail	phage tail protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	6.4e-126
AXT66758.1|3202774_3203743_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXT66759.1|3212449_3213043_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.2	8.0e-80
AXT66760.1|3213069_3213492_-	hypothetical protein	NA	J9Q806	Salmonella_phage	49.3	2.9e-28
AXT66761.1|3213533_3214244_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	91.1	3.8e-137
AXT66762.1|3214245_3215001_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	6.1e-125
AXT66763.1|3214997_3215336_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
AXT66764.1|3215335_3218671_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.6	0.0e+00
AXT66765.1|3218670_3218883_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
AXT66766.1|3218903_3219269_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AXT66767.1|3219326_3219788_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AXT66768.1|3219819_3220221_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
AXT66769.1|3220217_3220607_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AXT66770.1|3220587_3220926_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AXT66771.1|3220922_3221240_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	2.6e-45
AXT66772.1|3221220_3221481_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
AXT66773.1|3221539_3222826_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	1.5e-216
AXT66774.1|3222903_3223824_-	serine peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.1e-148
AXT66775.1|3223860_3225120_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	2.8e-223
AXT66776.1|3225119_3225299_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
AXT66777.1|3225292_3227014_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
AXT66778.1|3227013_3227448_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AXT66779.1|3227695_3228127_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	2.4e-41
AXT66780.1|3228123_3228441_-	hypothetical protein	NA	NA	NA	NA	NA
AXT66781.1|3228392_3228755_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
AXT66782.1|3229881_3230232_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	36.8	2.5e-09
AXT66783.1|3230228_3230726_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	87.0	8.7e-80
AXT66784.1|3230725_3230941_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
AXT66785.1|3232353_3232956_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.5	4.2e-76
AXT66786.1|3232972_3234004_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	1.1e-95
AXT66787.1|3234003_3234207_-	hypothetical protein	NA	NA	NA	NA	NA
AXT66788.1|3234203_3234596_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
AXT66789.1|3234636_3234927_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
AXT66790.1|3234938_3235172_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	72.4	1.3e-25
AXT66791.1|3235797_3236775_+	thymidylate synthase	NA	A0A1G5SB41	Enterococcus_phage	31.5	1.1e-22
AXT66792.1|3236774_3237719_+	hypothetical protein	NA	NA	NA	NA	NA
AXT66793.1|3237721_3238804_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	38.6	2.1e-09
AXT66794.1|3238800_3239127_-	killer suppression protein HigA	NA	NA	NA	NA	NA
AXT66795.1|3239272_3239539_+	hypothetical protein	NA	A0A2C9CX56	Yersinia_phage	70.7	8.6e-26
AXT66796.1|3241710_3242151_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AXT68772.1|3242164_3242629_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	68.9	1.7e-61
AXT66797.1|3242621_3243605_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.8	2.4e-44
AXT66798.1|3243656_3244211_-	hypothetical protein	NA	NA	NA	NA	NA
AXT66799.1|3244213_3244429_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
AXT66800.1|3244530_3244920_+	transcriptional regulator	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
AXT66801.1|3245762_3245957_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AXT66802.1|3245999_3246344_+	transcriptional regulator	NA	NA	NA	NA	NA
AXT66803.1|3246485_3248624_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	43.0	5.0e-100
AXT66804.1|3248676_3248922_+	excisionase	NA	NA	NA	NA	NA
AXT66805.1|3248902_3250030_+|integrase	integrase	integrase	O21925	Phage_21	57.8	1.8e-117
AXT66806.1|3250252_3250819_-	hypothetical protein	NA	NA	NA	NA	NA
AXT66807.1|3250815_3252336_-	hypothetical protein	NA	A0A2I7RNF1	Vibrio_phage	21.5	1.1e-05
AXT66808.1|3252509_3253760_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	92.6	1.1e-19
AXT66809.1|3254000_3254651_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3254100:3254114	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
AXT66810.1|3254667_3255126_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXT68773.1|3255182_3256289_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
CP023416	Klebsiella pneumoniae strain 1050 chromosome, complete genome	5338202	3494707	3504171	5338202	protease,tRNA	Brazilian_cedratvirus(16.67%)	9	NA	NA
AXT67019.1|3494707_3496429_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AXT67020.1|3496473_3497175_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXT67021.1|3497528_3497747_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXT67022.1|3497867_3500147_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXT67023.1|3500177_3500495_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXT67024.1|3500820_3501042_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXT67025.1|3500996_3501179_-	hypothetical protein	NA	NA	NA	NA	NA
AXT67026.1|3501118_3503059_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AXT67027.1|3503055_3504171_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
CP023417	Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence	311641	6400	140204	311641	protease,transposase	Stx2-converting_phage(13.33%)	120	NA	NA
AXT68872.1|6400_7058_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.5	2.4e-117
AXT68873.1|7332_7932_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXT68874.1|7942_8713_+	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	1.8e-23
AXT68875.1|8749_9514_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXT68876.1|9519_10209_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXT68877.1|10205_10898_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXT68878.1|10915_11806_+	arginase	NA	NA	NA	NA	NA
AXT68879.1|12699_13548_+	alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	26.4	3.4e-07
AXT68880.1|13573_14542_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	2.5e-179
AXT68881.1|14985_15990_+|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AXT68882.1|16387_17467_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	26.6	7.3e-23
AXT68883.1|17606_18392_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXT68884.1|18634_19408_-	histidine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	35.2	1.5e-22
AXT68885.1|19417_20134_-	histidine ABC transporter permease HisM	NA	NA	NA	NA	NA
AXT68886.1|20130_20817_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
AXT69107.1|20885_21872_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
AXT69108.1|21871_23368_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXT68887.1|23371_24409_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
AXT68888.1|24405_25644_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.4	3.8e-23
AXT68889.1|26019_26937_-	amidinotransferase	NA	NA	NA	NA	NA
AXT68890.1|26959_27973_-	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	52.6	3.3e-94
AXT68891.1|28097_28520_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXT68892.1|28638_29562_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	98.0	4.3e-173
AXT68893.1|30302_32612_+	ATPase	NA	NA	NA	NA	NA
AXT68894.1|32615_33932_+	ATP-binding protein	NA	NA	NA	NA	NA
AXT68895.1|33928_36124_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AXT68896.1|36443_37604_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	6.0e-39
AXT68897.1|37922_38153_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXT68898.1|38149_38566_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AXT68899.1|40298_41372_+	hypothetical protein	NA	NA	NA	NA	NA
AXT68900.1|41368_43033_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69109.1|44111_45035_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	3.9e-174
AXT68901.1|45354_45783_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
AXT68902.1|45932_47171_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.4	5.6e-11
AXT68903.1|47467_48463_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.9	4.1e-20
AXT68904.1|49307_50459_-	2-alkenal reductase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	1.7e-25
AXT68905.1|50483_51449_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AXT68906.1|51426_51924_-	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AXT68907.1|51926_53636_-	sodium:proton exchanger	NA	NA	NA	NA	NA
AXT68908.1|53639_54080_-	thiol reductase thioredoxin	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	5.8e-11
AXT68909.1|54069_55215_-	hypothetical protein	NA	NA	NA	NA	NA
AXT68910.1|55263_55905_-	hypothetical protein	NA	NA	NA	NA	NA
AXT68911.1|55994_56882_-	hypothetical protein	NA	NA	NA	NA	NA
AXT68912.1|56984_57899_-	hypothetical protein	NA	NA	NA	NA	NA
AXT68913.1|57921_58380_-	heat-shock protein Hsp20	NA	NA	NA	NA	NA
AXT69110.1|58467_58608_-	hypothetical protein	NA	NA	NA	NA	NA
AXT68914.1|59525_62375_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.9	7.6e-128
AXT68915.1|62480_63050_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXT69111.1|63084_63366_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	6.8e-05
AXT68916.1|63870_64125_-	hypothetical protein	NA	NA	NA	NA	NA
AXT68917.1|65578_66655_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXT68918.1|68472_68643_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AXT68919.1|68699_69953_-	MFS transporter	NA	NA	NA	NA	NA
AXT68920.1|70004_73079_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.9	0.0e+00
AXT68921.1|73200_74283_-	lac repressor	NA	C6ZCU4	Enterobacteria_phage	97.8	1.9e-188
AXT68922.1|76048_77053_+|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AXT68923.1|79217_79796_+	resolvase	NA	A0A0F7LA37	Escherichia_phage	37.7	1.1e-22
AXT68924.1|79971_81177_+	chromate transporter	NA	NA	NA	NA	NA
AXT68925.1|81187_81493_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXT68926.1|81621_82320_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	4.5e-90
AXT68927.1|82405_82726_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	6.5e-20
AXT69112.1|82770_84060_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.9	1.3e-167
AXT68928.1|84072_84498_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.9e-51
AXT68929.1|84672_85677_+|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AXT69113.1|85995_86217_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AXT68930.1|86547_86841_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
AXT68931.1|86939_87707_-	ferric citrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	1.3e-13
AXT68932.1|87707_88664_-	iron-dicitrate transporter subunit FecD	NA	NA	NA	NA	NA
AXT68933.1|88660_89659_-	iron-dicitrate transporter permease subunit	NA	NA	NA	NA	NA
AXT68934.1|89655_90558_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AXT68935.1|90602_92927_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AXT68936.1|93013_93967_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AXT68937.1|93963_94485_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AXT68938.1|94648_95617_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
AXT69114.1|96071_96980_+	HNH endonuclease	NA	NA	NA	NA	NA
AXT68939.1|97366_97717_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
AXT68940.1|97860_98292_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AXT68941.1|98542_100018_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AXT69115.1|100010_100691_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AXT68942.1|100880_102266_+	hypothetical protein	NA	NA	NA	NA	NA
AXT68943.1|102294_102657_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXT68944.1|102770_104063_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXT68945.1|104073_107220_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.3	1.8e-61
AXT68946.1|107306_107747_+	hypothetical protein	NA	NA	NA	NA	NA
AXT68947.1|107873_110321_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AXT68948.1|110361_110559_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AXT68949.1|110592_111330_-	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
AXT68950.1|111618_112068_-	copper resistance protein	NA	NA	NA	NA	NA
AXT68951.1|112301_114119_+	copper resistance protein A	NA	NA	NA	NA	NA
AXT68952.1|114118_115015_+	copper resistance protein B	NA	NA	NA	NA	NA
AXT68953.1|115054_115435_+	copper resistance protein CopC	NA	NA	NA	NA	NA
AXT68954.1|115439_116369_+	copper resistance protein D	NA	NA	NA	NA	NA
AXT68955.1|116423_117104_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.8	3.0e-30
AXT68956.1|117100_118501_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
AXT68957.1|118716_119151_+	copper-binding protein	NA	NA	NA	NA	NA
AXT68958.1|119562_119649_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXT68959.1|119748_119952_+	hypothetical protein	NA	Q76S41	Shigella_phage	61.5	1.0e-10
AXT68960.1|119961_120930_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
AXT68961.1|121964_122933_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	2.5e-179
AXT68962.1|124088_124436_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
AXT68963.1|124432_124759_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	79.5	3.0e-44
AXT68964.1|125526_125838_+	cytoplasmic protein	NA	NA	NA	NA	NA
AXT68965.1|125834_126254_+	transcriptional regulator	NA	NA	NA	NA	NA
AXT69116.1|127400_127595_+	hypothetical protein	NA	E8ZD70	Streptococcus_phage	59.6	8.2e-10
AXT68966.1|128307_128751_+	hypothetical protein	NA	NA	NA	NA	NA
AXT68967.1|128747_129218_+	RES domain-containing protein	NA	NA	NA	NA	NA
AXT68968.1|129328_129589_-	hypothetical protein	NA	NA	NA	NA	NA
AXT68969.1|130150_131332_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AXT68970.1|131403_131562_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AXT68971.1|133339_133717_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXT69117.1|133898_134087_-	hypothetical protein	NA	NA	NA	NA	NA
AXT68972.1|134043_134340_+	hydrogenase expression/formation protein HypD	NA	NA	NA	NA	NA
AXT68973.1|134408_135476_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69118.1|135631_135979_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69119.1|136057_136291_+	hypothetical protein	NA	NA	NA	NA	NA
AXT68974.1|136931_137189_+	hypothetical protein	NA	NA	NA	NA	NA
AXT68975.1|137242_137920_-	nuclease-related domain protein	NA	A0A2R2ZH57	Clostridioides_phage	46.4	2.5e-05
AXT69120.1|137894_138272_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	92.1	7.1e-58
AXT68976.1|138268_138616_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
AXT68977.1|138665_140204_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
>prophage 2
CP023417	Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence	311641	171286	215242	311641	transposase	Shigella_phage(20.0%)	31	NA	NA
AXT69002.1|171286_172507_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXT69003.1|172721_174125_+|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AXT69004.1|174153_174786_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69005.1|174962_176495_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
AXT69006.1|176606_178010_+|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AXT69007.1|178038_178671_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69008.1|178866_179160_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69009.1|179257_179656_-	DNA-binding protein H-NS-like protein	NA	NA	NA	NA	NA
AXT69010.1|180058_180877_-	DNA repair protein	NA	NA	NA	NA	NA
AXT69011.1|180986_181481_-	nuclease	NA	A0A0R6PHV6	Moraxella_phage	36.0	4.2e-18
AXT69012.1|181920_182889_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.9e-185
AXT69123.1|185475_185589_+	hypothetical protein	NA	U5P429	Shigella_phage	81.1	4.7e-10
AXT69013.1|185680_187279_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.9	8.6e-20
AXT69014.1|187811_188120_-	hypothetical protein	NA	Q9ZXG3	Shigella_phage	54.3	2.7e-15
AXT69015.1|188639_188867_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69016.1|189551_190361_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AXT69017.1|190353_191562_-	imidazolonepropionase	NA	NA	NA	NA	NA
AXT69018.1|191573_192965_-	cytosine permease	NA	NA	NA	NA	NA
AXT69019.1|193017_194694_-	urocanate hydratase	NA	NA	NA	NA	NA
AXT69020.1|197441_197999_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69021.1|197995_198757_-	histidine utilization repressor	NA	NA	NA	NA	NA
AXT69022.1|198855_200223_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AXT69023.1|201597_201807_-	hypothetical protein	NA	S5WIU1	Leptospira_phage	54.8	1.0e-13
AXT69024.1|203557_204481_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AXT69025.1|204526_206002_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69026.1|206527_206734_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69027.1|208049_209456_+	cytosine permease	NA	NA	NA	NA	NA
AXT69028.1|209492_211082_+	hypothetical protein	NA	Q75ZG1	Hepacivirus	25.0	2.1e-34
AXT69029.1|211078_212071_+	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
AXT69030.1|212675_212975_+	hypothetical protein	NA	Q71TE9	Escherichia_phage	68.2	3.6e-28
AXT69031.1|214219_215242_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP023417	Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence	311641	302686	309735	311641	transposase	Stx2-converting_phage(28.57%)	7	NA	NA
AXT69098.1|302686_303655_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
AXT69099.1|303664_303838_-	hypothetical protein	NA	Q76S41	Shigella_phage	94.5	1.4e-21
AXT69100.1|303923_305516_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	9.4e-176
AXT69101.1|305546_305897_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
AXT69102.1|305893_306334_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
AXT69103.1|306530_306713_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
AXT69104.1|308763_309735_-	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	2.4e-150
>prophage 1
CP023418	Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence	138885	9729	52072	138885	transposase	Salmonella_phage(60.0%)	44	NA	NA
AXT69138.1|9729_10290_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AXT69139.1|10293_13221_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.4	0.0e+00
AXT69140.1|13201_14476_-|transposase	IS4/IS5 family transposase	transposase	NA	NA	NA	NA
AXT69141.1|14632_15004_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69142.1|15321_16590_+|transposase	IS4 family transposase ISApu1	transposase	NA	NA	NA	NA
AXT69143.1|17199_18210_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AXT69144.1|18283_18715_+	heme-binding protein	NA	NA	NA	NA	NA
AXT69277.1|18777_19068_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
AXT69145.1|19219_19690_+	thiol-disulfide isomerase	NA	NA	NA	NA	NA
AXT69146.1|19693_20206_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69147.1|20193_21465_+	MFS transporter	NA	NA	NA	NA	NA
AXT69148.1|21495_21897_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69149.1|22003_22453_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69150.1|22540_23113_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69151.1|23204_24173_-	magnesium transporter	NA	NA	NA	NA	NA
AXT69152.1|24169_24874_-	glutathione S-transferase	NA	NA	NA	NA	NA
AXT69153.1|25006_25546_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AXT69154.1|25547_25991_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AXT69155.1|26137_27097_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXT69156.1|27241_28474_+	osmotically inducible protein C	NA	NA	NA	NA	NA
AXT69157.1|28476_29070_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AXT69158.1|29069_30095_+	oxidoreductase	NA	NA	NA	NA	NA
AXT69159.1|30491_31067_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXT69278.1|31302_31485_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69160.1|31543_32032_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69161.1|32302_32689_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69162.1|32727_33687_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69279.1|33713_34247_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXT69163.1|34503_35400_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXT69164.1|35396_35636_-	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
AXT69165.1|35635_36856_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AXT69166.1|36852_37902_-	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
AXT69167.1|38496_39501_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXT69168.1|39579_42546_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
AXT69169.1|42704_42995_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AXT69170.1|42991_43393_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AXT69171.1|43382_43739_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXT69172.1|43993_44320_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69173.1|44316_44817_+|transposase	transposase	transposase	NA	NA	NA	NA
AXT69174.1|44813_45185_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69175.1|45178_45736_+	DNA invertase	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AXT69176.1|45814_46819_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXT69177.1|50647_50848_-	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AXT69280.1|51148_52072_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
>prophage 1
CP023419	Klebsiella pneumoniae strain 1050 plasmid pKp1050-3, complete sequence	70869	7755	39672	70869	transposase,integrase,protease	Escherichia_phage(35.29%)	49	NA	NA
AXT69293.1|7755_8409_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXT69294.1|8627_9092_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AXT69295.1|9184_9619_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	55.3	1.2e-29
AXT69296.1|9567_10872_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	49.9	5.1e-111
AXT69297.1|10994_11204_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69298.1|11206_11425_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69299.1|11469_12153_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69300.1|12149_12422_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXT69301.1|12440_13715_-	RelB antitoxin	NA	NA	NA	NA	NA
AXT69302.1|14241_14586_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69303.1|14768_15353_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69304.1|15658_16204_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69305.1|16344_16806_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69306.1|16802_17051_+	transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
AXT69307.1|17043_17631_+	restriction endonuclease	NA	NA	NA	NA	NA
AXT69308.1|17627_18113_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69309.1|18109_18358_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69310.1|18376_19117_+	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
AXT69374.1|19357_20332_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	52.0	7.9e-85
AXT69311.1|20334_20778_+	plasmid stability family protein	NA	NA	NA	NA	NA
AXT69312.1|20787_21351_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.3	3.9e-20
AXT69313.1|21729_21975_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXT69314.1|21967_22447_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69315.1|22475_22886_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69316.1|23003_23267_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69317.1|23288_23651_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
AXT69318.1|23772_24222_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AXT69319.1|24266_24533_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXT69320.1|24913_25417_-|transposase	IS1 family transposase	transposase	U5P0U6	Shigella_phage	98.8	1.8e-93
AXT69321.1|25335_25611_-|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
AXT69322.1|25644_25836_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69323.1|25889_26549_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	99.1	4.2e-130
AXT69324.1|26749_27127_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXT69325.1|27437_28442_-|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AXT69326.1|28795_29500_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT69327.1|29390_30350_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AXT69328.1|30516_31317_+	subclass B1 metallo-beta-lactamase VIM-1	NA	NA	NA	NA	NA
AXT69329.1|31424_31979_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
AXT69330.1|32109_32346_+	trimethoprim-resistant dihydrofolate reductase DfrB1	NA	A0A0H5ARK7	Pseudomonas_phage	68.1	1.6e-12
AXT69331.1|32459_33251_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AXT69332.1|33303_33936_+	type B-2 chloramphenicol O-acetyltransferase CatB2	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	44.4	4.1e-26
AXT69333.1|34104_34452_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXT69334.1|34445_35285_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXT69335.1|35214_35394_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69336.1|35412_35913_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXT69375.1|36088_36871_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AXT69337.1|37617_38322_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT69338.1|38548_38977_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69339.1|38967_39672_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP023420	Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence	64940	0	45490	64940	transposase,integrase	Escherichia_phage(45.0%)	51	2741:2758	9925:9942
AXT69379.1|0_720_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
AXT69380.1|1366_1846_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69381.1|2267_2837_-	hypothetical protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
2741:2758	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
AXT69382.1|2976_3291_-|transposase	transposase	transposase	NA	NA	NA	NA
AXT69383.1|3229_4243_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXT69384.1|4389_4872_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AXT69385.1|5092_5359_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AXT69386.1|5501_6266_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXT69387.1|6307_6520_+	resolvase	NA	NA	NA	NA	NA
AXT69388.1|6532_7741_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AXT69389.1|7774_9208_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AXT69390.1|9589_9796_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69445.1|9800_10289_-	restriction endonuclease	NA	NA	NA	NA	NA
9925:9942	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
AXT69391.1|10497_10809_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69392.1|10844_11159_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
AXT69393.1|11155_11500_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69446.1|11515_11866_-	KorB	NA	NA	NA	NA	NA
AXT69394.1|11929_12664_+	traL protein	NA	NA	NA	NA	NA
AXT69447.1|12672_12954_+	transcriptional regulator	NA	NA	NA	NA	NA
AXT69395.1|12963_13257_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AXT69396.1|13306_13624_+	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
AXT69397.1|13623_16224_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AXT69398.1|16241_16955_+	type IV secretion system protein	NA	NA	NA	NA	NA
AXT69399.1|16962_17190_+	entry exclusion protein	NA	NA	NA	NA	NA
AXT69400.1|17205_18246_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AXT69401.1|18328_18475_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AXT69402.1|18464_19163_+	type IV secretion system protein VirB8	NA	NA	NA	NA	NA
AXT69403.1|19236_20058_+	conjugal transfer protein TraO	NA	NA	NA	NA	NA
AXT69404.1|20057_21218_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AXT69405.1|21259_22255_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AXT69406.1|22254_22788_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
AXT69407.1|23759_24464_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT69448.1|24711_25089_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXT69408.1|25289_25949_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	99.1	4.2e-130
AXT69409.1|26155_26860_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT69410.1|27537_28182_+	quinolone resistance pentapeptide repeat protein QnrB19	NA	NA	NA	NA	NA
AXT69411.1|28190_28508_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69412.1|28671_29934_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AXT69413.1|31719_32481_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXT69414.1|32501_33362_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AXT69415.1|33325_33508_-	hypothetical protein	NA	NA	NA	NA	NA
AXT69416.1|33498_34203_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXT69417.1|34560_35118_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AXT69418.1|35300_36161_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXT69419.1|36302_37163_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AXT69420.1|37175_37469_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69421.1|38383_39913_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXT69422.1|40058_40763_+|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AXT69423.1|40985_41558_+	aminoglycoside N-acetyltransferase AAC(6')-Ian	NA	A0A0N9SKF6	Staphylococcus_phage	40.1	8.0e-37
AXT69424.1|42214_43744_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXT69425.1|44785_45490_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP023421	Klebsiella pneumoniae strain 1050 plasmid unnamed, complete sequence	53096	0	28046	53096	terminase,tail	Klebsiella_phage(82.35%)	37	NA	NA
AXT69452.1|770_950_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	78.9	9.2e-16
AXT69453.1|943_2653_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
AXT69454.1|2687_3122_-|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	95.1	5.3e-73
AXT69503.1|3338_3539_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	89.4	2.9e-10
AXT69455.1|3624_4056_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.9	2.9e-39
AXT69456.1|4052_4337_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	2.4e-05
AXT69457.1|4333_4696_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	92.5	7.8e-62
AXT69458.1|4679_5756_-	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	37.4	9.8e-36
AXT69459.1|5925_6225_-	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
AXT69460.1|6478_6955_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	1.7e-61
AXT69461.1|6971_7463_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.8	1.9e-82
AXT69462.1|7459_7771_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	88.1	1.8e-43
AXT69463.1|7829_8891_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	93.2	1.6e-171
AXT69464.1|9161_9389_-	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
AXT69504.1|9400_9622_-	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
AXT69465.1|9792_10101_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
AXT69466.1|10100_10388_+	XRE family transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
AXT69467.1|10477_10681_-	hypothetical protein	NA	Q6UAT5	Klebsiella_phage	76.6	3.5e-19
AXT69468.1|10784_11012_-	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
AXT69469.1|11032_11359_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	3.9e-52
AXT69470.1|11351_11597_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
AXT69471.1|12197_12806_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.5	1.7e-98
AXT69472.1|13015_13237_-	hypothetical protein	NA	A0A2I6TCB2	Escherichia_phage	75.3	1.1e-29
AXT69473.1|13217_13955_-	phage antitermination protein	NA	Q6UAU4	Klebsiella_phage	84.1	1.4e-118
AXT69505.1|13944_14154_-	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
AXT69474.1|14234_14843_+	helix-turn-helix domain-containing protein	NA	Q6UAU6	Klebsiella_phage	92.1	4.8e-104
AXT69475.1|15093_19098_+	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.3	0.0e+00
AXT69476.1|19090_19387_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69477.1|19383_19734_+	hypothetical protein	NA	O64343	Escherichia_phage	77.6	8.6e-50
AXT69478.1|20315_20483_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69479.1|20534_20699_+	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
AXT69480.1|20695_20926_+	hypothetical protein	NA	NA	NA	NA	NA
AXT69481.1|20922_21702_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	82.4	2.0e-118
AXT69482.1|21756_23679_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	94.8	0.0e+00
AXT69483.1|24386_25550_+	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
AXT69484.1|25552_26518_+	chromosome partitioning protein ParB	NA	Q6UAV8	Klebsiella_phage	86.6	1.5e-155
AXT69485.1|26597_28046_-|tail	phage tail protein	tail	A0A0P0IDN1	Klebsiella_phage	53.4	7.9e-97
>prophage 2
CP023421	Klebsiella pneumoniae strain 1050 plasmid unnamed, complete sequence	53096	41175	52571	53096	head,capsid,tail	Klebsiella_phage(87.5%)	16	NA	NA
AXT69486.1|41175_41769_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.2	8.0e-80
AXT69487.1|41795_42218_-	hypothetical protein	NA	A0A1B0VMH3	Pseudomonas_phage	37.9	1.1e-14
AXT69488.1|42259_42970_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	91.1	3.8e-137
AXT69489.1|42971_43727_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
AXT69490.1|43723_44062_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	90.2	2.2e-58
AXT69491.1|44061_47418_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.0	0.0e+00
AXT69492.1|47417_47630_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
AXT69493.1|47650_48016_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AXT69494.1|48073_48535_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AXT69495.1|48566_48968_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
AXT69496.1|48964_49354_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AXT69497.1|49334_49673_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AXT69498.1|49669_49987_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	9.9e-45
AXT69499.1|49967_50228_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
AXT69500.1|50286_51573_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	1.5e-216
AXT69501.1|51650_52571_-	serine peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.1e-148
