The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023075	Bacillus velezensis strain K26 chromosome, complete genome	4047350	663862	673753	4047350		Synechococcus_phage(50.0%)	9	NA	NA
AXS59806.1|663862_665155_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
AXS59807.1|665230_665950_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	44.7	1.3e-47
AXS59808.1|665949_666204_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	34.6	2.1e-05
AXS59809.1|666200_666884_+	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
AXS59810.1|666867_669096_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	40.7	9.4e-158
AXS59811.1|669071_670502_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
AXS59812.1|670593_671634_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	1.4e-63
AXS59813.1|671630_672218_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
AXS59814.1|672214_673753_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.5	1.9e-77
>prophage 2
CP023075	Bacillus velezensis strain K26 chromosome, complete genome	4047350	1139597	1173188	4047350	tRNA,coat	Planktothrix_phage(16.67%)	38	NA	NA
AXS60238.1|1139597_1140590_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AXS60239.1|1141333_1142968_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXS60240.1|1143074_1144010_+	ABC transporter permease	NA	NA	NA	NA	NA
AXS60241.1|1144013_1144931_+	ABC transporter permease	NA	NA	NA	NA	NA
AXS60242.1|1144943_1146020_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
AXS60243.1|1146012_1146930_+	ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
AXS60244.1|1147036_1148215_+	GTP-binding protein	NA	NA	NA	NA	NA
AXS60245.1|1148332_1148911_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXS60246.1|1149089_1149485_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AXS60247.1|1149540_1150197_-	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	41.9	2.2e-30
AXS60248.1|1150472_1151129_+	adaptor protein MecA	NA	NA	NA	NA	NA
AXS60249.1|1151279_1152440_+	competence protein CoiA	NA	NA	NA	NA	NA
AXS62981.1|1152667_1154497_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AXS60250.1|1154534_1154702_-	hypothetical protein	NA	NA	NA	NA	NA
AXS60251.1|1154987_1155890_-	DsbA family protein	NA	NA	NA	NA	NA
AXS60252.1|1155886_1156285_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
AXS60253.1|1156513_1157200_-	lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.8e-38
AXS60254.1|1157204_1157777_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AXS60255.1|1157901_1158267_+	hypothetical protein	NA	NA	NA	NA	NA
AXS60256.1|1158294_1158930_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AXS60257.1|1158947_1159748_+	NAD kinase	NA	NA	NA	NA	NA
AXS60258.1|1159762_1160656_+	pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.4e-06
AXS60259.1|1160688_1161438_-	hypothetical protein	NA	A0A1V0SJW2	Klosneuvirus	26.4	9.9e-11
AXS60260.1|1161664_1163509_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AXS62982.1|1163758_1164466_+	thiaminase II	NA	NA	NA	NA	NA
AXS62983.1|1164443_1165061_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AXS60261.1|1165044_1166154_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AXS60262.1|1166150_1166354_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AXS60263.1|1166350_1167121_+	thiazole synthase	NA	NA	NA	NA	NA
AXS60264.1|1167117_1168128_+	thiamine biosynthesis protein MoeB	NA	NA	NA	NA	NA
AXS60265.1|1168150_1168963_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AXS60266.1|1169093_1169870_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AXS60267.1|1169967_1170576_+|coat	spore coat protein	coat	NA	NA	NA	NA
AXS60268.1|1170634_1171078_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXS60269.1|1171223_1171706_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXS60270.1|1171856_1172357_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXS60271.1|1172449_1172764_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXS60272.1|1172801_1173188_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
CP023075	Bacillus velezensis strain K26 chromosome, complete genome	4047350	1192061	1206373	4047350	coat,portal,transposase	Bacillus_phage(54.55%)	15	NA	NA
AXS60296.1|1192061_1195049_+	hypothetical protein	NA	O64076	Bacillus_phage	46.9	3.3e-222
AXS60297.1|1195376_1195595_+	transcriptional regulator	NA	NA	NA	NA	NA
AXS60298.1|1196633_1197347_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	42.4	7.4e-48
AXS60299.1|1197370_1198156_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	49.0	5.0e-37
AXS60300.1|1198164_1198752_+	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	47.8	1.3e-37
AXS60301.1|1198751_1198979_+	hypothetical protein	NA	NA	NA	NA	NA
AXS60302.1|1199013_1199487_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	38.7	6.5e-24
AXS60303.1|1199904_1200087_+	hypothetical protein	NA	NA	NA	NA	NA
AXS60304.1|1200079_1200292_+	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	51.6	4.5e-09
AXS60305.1|1200375_1200783_+|transposase	transposase	transposase	NA	NA	NA	NA
AXS60306.1|1200799_1201363_-	resolvase	NA	A0A0A8WIK3	Clostridium_phage	50.5	3.7e-42
AXS60307.1|1201715_1203470_+	hypothetical protein	NA	A0A1V0DZW7	Clostridioides_phage	46.9	3.8e-146
AXS60308.1|1203484_1204819_+|portal	phage portal protein	portal	I1TJV4	Clostridium_phage	31.1	2.3e-42
AXS60309.1|1204926_1205526_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	44.5	4.0e-31
AXS60310.1|1205554_1206373_+|coat	P22 coat protein - protein 5 domain protein	coat	E5DV53	Deep-sea_thermophilic_phage	43.3	3.8e-56
>prophage 4
CP023075	Bacillus velezensis strain K26 chromosome, complete genome	4047350	1247383	1297866	4047350	holin,coat,terminase,portal	Bacillus_phage(47.83%)	55	NA	NA
AXS60350.1|1247383_1247566_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXS60351.1|1247679_1247853_-	putative motility protein	NA	NA	NA	NA	NA
AXS60352.1|1247896_1248298_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
AXS60353.1|1248396_1248966_-	DUF4309 domain-containing protein	NA	NA	NA	NA	NA
AXS60354.1|1249088_1252046_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
AXS60355.1|1252038_1252581_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AXS60356.1|1252788_1254009_+	cytochrome P450	NA	NA	NA	NA	NA
AXS60357.1|1254005_1255190_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	30.2	7.3e-08
AXS60358.1|1255228_1255414_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	75.9	2.6e-21
AXS60359.1|1255589_1256408_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AXS60360.1|1256432_1257194_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AXS60361.1|1257195_1257933_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.3	8.3e-18
AXS60362.1|1257958_1258942_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
AXS60363.1|1259071_1259569_+	hypothetical protein	NA	NA	NA	NA	NA
AXS60364.1|1259956_1260373_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AXS60365.1|1260412_1261591_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXS60366.1|1261776_1263174_+	glucuronate isomerase	NA	NA	NA	NA	NA
AXS60367.1|1264646_1265645_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXS60368.1|1265720_1267166_+	tagaturonate reductase	NA	NA	NA	NA	NA
AXS60369.1|1267162_1268656_+	altronate dehydratase	NA	NA	NA	NA	NA
AXS60370.1|1268839_1269511_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.4e-24
AXS60371.1|1269507_1270866_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.6	3.5e-14
AXS60372.1|1270985_1271921_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.4	1.8e-41
AXS60373.1|1271901_1272633_+	ABC transporter permease	NA	NA	NA	NA	NA
AXS60374.1|1272650_1272842_+	Mas-related G-protein coupled receptor member D	NA	NA	NA	NA	NA
AXS60375.1|1272907_1274158_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXS60376.1|1274169_1274835_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXS60377.1|1275027_1275210_+	plantaricin C family lantibiotic	NA	NA	NA	NA	NA
AXS60378.1|1275296_1278479_+	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
AXS60379.1|1278468_1280616_+	ABC transporter	NA	W8CYL7	Bacillus_phage	26.6	2.4e-33
AXS60380.1|1281300_1284186_+	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
AXS60381.1|1284232_1284997_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AXS60382.1|1285145_1285613_-	hypothetical protein	NA	NA	NA	NA	NA
AXS60383.1|1285817_1286954_+	aspartate phosphatase	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
AXS60384.1|1286943_1287078_+	hypothetical protein	NA	NA	NA	NA	NA
AXS60385.1|1287220_1288174_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.3	2.4e-62
AXS60386.1|1288211_1288589_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	38.5	1.1e-15
AXS60387.1|1288698_1289304_+	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	6.1e-43
AXS60388.1|1289458_1290049_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
AXS60389.1|1290197_1290536_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	9.9e-19
AXS60390.1|1290726_1290906_+	hypothetical protein	NA	NA	NA	NA	NA
AXS60391.1|1290895_1291723_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	1.7e-19
AXS60392.1|1291622_1292423_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.9	2.3e-58
AXS60393.1|1292422_1292599_+	hypothetical protein	NA	NA	NA	NA	NA
AXS60394.1|1292687_1293029_+|portal	phage portal protein	portal	NA	NA	NA	NA
AXS60395.1|1293018_1293222_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
AXS60396.1|1293328_1293841_+	Fis family transcriptional regulator	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	2.9e-22
AXS60397.1|1293953_1294613_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	31.7	3.4e-07
AXS60398.1|1294510_1294978_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	47.1	5.7e-33
AXS60399.1|1294990_1295362_+	hypothetical protein	NA	NA	NA	NA	NA
AXS60400.1|1295366_1295564_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	7.3e-14
AXS60401.1|1295620_1296382_+|portal	phage portal protein	portal	NA	NA	NA	NA
AXS60402.1|1296433_1296697_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	65.5	2.1e-24
AXS60403.1|1296710_1296974_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
AXS60404.1|1296987_1297866_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
>prophage 5
CP023075	Bacillus velezensis strain K26 chromosome, complete genome	4047350	1830113	1836327	4047350		Bacillus_phage(50.0%)	7	NA	NA
AXS60836.1|1830113_1830506_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
AXS60837.1|1830465_1832568_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
AXS60838.1|1832585_1833575_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
AXS60839.1|1833623_1834241_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
AXS60840.1|1834293_1835052_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	3.1e-52
AXS60841.1|1835085_1835310_-	hypothetical protein	NA	NA	NA	NA	NA
AXS60842.1|1835358_1836327_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 6
CP023075	Bacillus velezensis strain K26 chromosome, complete genome	4047350	2107891	2120530	4047350	holin	Bacillus_phage(90.91%)	17	NA	NA
AXS61065.1|2107891_2108317_+	capsule biosynthesis protein CapD	NA	A0A1V0SAI8	Catovirus	34.8	2.3e-12
AXS61066.1|2108350_2108527_-	hypothetical protein	NA	O64196	Bacillus_phage	93.1	6.5e-22
AXS63015.1|2108894_2109248_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
AXS61067.1|2109458_2109695_+	hypothetical protein	NA	NA	NA	NA	NA
AXS61068.1|2109818_2110193_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.0	7.6e-28
AXS61069.1|2111251_2112388_+	tetratricopeptide repeat-containing protein	NA	A0A1P8CWN8	Bacillus_phage	76.1	5.3e-165
AXS61070.1|2112377_2112560_+	hypothetical protein	NA	NA	NA	NA	NA
AXS61071.1|2112887_2113907_+	hypothetical protein	NA	NA	NA	NA	NA
AXS61072.1|2113968_2114328_-	hypothetical protein	NA	O64028	Bacillus_phage	61.4	7.5e-33
AXS61073.1|2114333_2114801_-	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	56.5	8.0e-43
AXS61074.1|2114944_2115115_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AXS61075.1|2115402_2115936_-	N-acetyltransferase	NA	O64026	Bacillus_phage	98.9	4.0e-99
AXS61076.1|2115971_2116550_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	93.2	1.4e-100
AXS61077.1|2116613_2117111_-	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	98.2	4.8e-94
AXS61078.1|2117119_2118835_-	hypothetical protein	NA	O64023	Bacillus_phage	73.2	8.4e-239
AXS63016.1|2118871_2119309_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AXS61079.1|2119564_2120530_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	77.2	1.2e-80
>prophage 7
CP023075	Bacillus velezensis strain K26 chromosome, complete genome	4047350	2254964	2261217	4047350		Staphylococcus_phage(66.67%)	10	NA	NA
AXS61223.1|2254964_2255558_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
AXS61224.1|2255547_2256303_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
AXS61225.1|2256510_2256600_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
AXS61226.1|2256687_2257209_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AXS61227.1|2257153_2257369_+	hypothetical protein	NA	NA	NA	NA	NA
AXS61228.1|2257274_2257649_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXS61229.1|2257765_2258230_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
AXS61230.1|2258262_2259459_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
AXS61231.1|2259473_2260121_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	8.8e-40
AXS61232.1|2260101_2261217_-	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	1.2e-55
>prophage 8
CP023075	Bacillus velezensis strain K26 chromosome, complete genome	4047350	2587876	2675598	4047350	portal,tRNA,holin,terminase,head,tail,protease,integrase,capsid	Bacillus_phage(48.94%)	99	2580082:2580099	2656023:2656040
2580082:2580099	attL	CAGGCGTGACGAAAGACC	NA	NA	NA	NA
AXS61522.1|2587876_2588359_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AXS61523.1|2588422_2589307_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXS61524.1|2589431_2590640_+	MFS transporter	NA	NA	NA	NA	NA
AXS61525.1|2590789_2593951_-	NADPH--cytochrome reductase	NA	V5UQK0	Mycobacterium_phage	37.3	6.4e-75
AXS61526.1|2593978_2594545_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXS61527.1|2594754_2595294_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXS61528.1|2595794_2595935_-	YrzI family protein	NA	NA	NA	NA	NA
AXS61529.1|2595989_2596238_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61530.1|2596324_2597125_-	formate/nitrite transporter	NA	NA	NA	NA	NA
AXS61531.1|2597393_2597762_-	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
AXS63036.1|2598068_2601011_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
AXS61532.1|2601028_2601520_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AXS61533.1|2601558_2601789_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61534.1|2601872_2603015_-	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	29.6	7.3e-21
AXS61535.1|2603016_2603940_-	cysteine synthase	NA	A0A1X9I5F1	Streptococcus_phage	43.0	4.0e-62
AXS61536.1|2603987_2604683_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AXS61537.1|2604703_2605345_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXS63037.1|2605528_2605732_+	DUF2536 domain-containing protein	NA	NA	NA	NA	NA
AXS61538.1|2605771_2606488_-	DUF1510 domain-containing protein	NA	NA	NA	NA	NA
AXS61539.1|2606551_2608306_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
AXS61540.1|2608359_2608833_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AXS61541.1|2609446_2610106_+	hypothetical protein	NA	NA	NA	NA	NA
AXS61542.1|2610362_2610872_+	hypothetical protein	NA	NA	NA	NA	NA
AXS61543.1|2610889_2611084_+	hypothetical protein	NA	NA	NA	NA	NA
AXS61544.1|2611140_2612154_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	96.4	8.3e-186
AXS61545.1|2612201_2612624_-|holin	holin	holin	D6R405	Bacillus_phage	91.0	1.0e-60
AXS61546.1|2612669_2612858_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	98.4	8.2e-31
AXS61547.1|2612854_2613217_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	91.7	1.9e-55
AXS61548.1|2613213_2614491_-	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	82.8	1.4e-150
AXS61549.1|2614503_2617068_-	peptidase G2	NA	D6R401	Bacillus_phage	57.4	1.2e-289
AXS61550.1|2617118_2618822_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	56.7	4.6e-181
AXS61551.1|2618836_2619676_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.3	6.2e-94
AXS61552.1|2619669_2624157_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	43.5	9.4e-64
AXS61553.1|2624362_2624731_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61554.1|2624789_2625404_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	33.9	8.4e-24
AXS61555.1|2625418_2625802_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AXS61556.1|2625798_2626197_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61557.1|2626193_2626511_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	37.3	2.9e-12
AXS61558.1|2626500_2626803_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	40.5	4.4e-10
AXS61559.1|2626820_2627219_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	44.5	4.8e-12
AXS61560.1|2627246_2628539_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.4	9.2e-89
AXS61561.1|2628576_2629203_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	79.1	1.5e-84
AXS61562.1|2629165_2630446_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	3.4e-152
AXS61563.1|2630634_2632344_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
AXS61564.1|2632340_2632856_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	9.8e-34
AXS61565.1|2632865_2633087_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61566.1|2633083_2633449_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	7.9e-30
AXS61567.1|2633734_2635129_-	metal-binding protein	NA	NA	NA	NA	NA
AXS61568.1|2635538_2636474_-	hypothetical protein	NA	A0A1S5S8Z0	Streptococcus_phage	27.3	1.8e-14
AXS61569.1|2636713_2637256_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	65.0	2.6e-61
AXS63038.1|2637252_2637705_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	2.2e-37
AXS61570.1|2638032_2638215_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61571.1|2638225_2638660_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	71.4	1.8e-49
AXS61572.1|2638662_2638908_-	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
AXS61573.1|2638904_2639213_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61574.1|2639209_2639527_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	51.1	8.7e-17
AXS61575.1|2639523_2639847_-	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	7.8e-05
AXS61576.1|2639858_2641235_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	48.9	3.4e-142
AXS61577.1|2641238_2641499_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	43.4	1.9e-06
AXS61578.1|2641495_2641711_-	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	63.8	5.0e-16
AXS61579.1|2641707_2642070_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61580.1|2642210_2642414_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
AXS61581.1|2642713_2642941_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61582.1|2642909_2643458_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
AXS63039.1|2643773_2644607_-	DNA replication protein	NA	Q2I8C8	Bacillus_phage	34.4	3.5e-33
AXS61583.1|2644590_2645463_-	replication protein	NA	V9QKF6	Oenococcus_phage	43.2	2.4e-48
AXS61584.1|2645449_2645674_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61585.1|2645686_2646004_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61586.1|2646047_2646257_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXS61587.1|2646444_2646834_+	XRE family transcriptional regulator	NA	Q786F1	Bacillus_phage	31.1	5.3e-08
AXS61588.1|2647205_2648387_-	XRE family transcriptional regulator	NA	A0A288WGA2	Bacillus_phage	25.6	7.8e-10
AXS61589.1|2648433_2648688_+	hypothetical protein	NA	NA	NA	NA	NA
AXS61590.1|2648693_2649854_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.6	1.3e-65
AXS61591.1|2649918_2650551_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	4.1e-34
AXS61592.1|2650557_2651826_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	31.2	2.1e-37
AXS61593.1|2651843_2652773_-|protease	collagenase-like protease	protease	NA	NA	NA	NA
AXS61594.1|2652779_2653433_-	O-methyltransferase	NA	NA	NA	NA	NA
AXS61595.1|2653584_2654676_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61596.1|2654785_2655067_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61597.1|2655079_2655496_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AXS61598.1|2655504_2655771_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61599.1|2655855_2658492_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.1	4.1e-67
2656023:2656040	attR	GGTCTTTCGTCACGCCTG	NA	NA	NA	NA
AXS61600.1|2658823_2659885_-	AI-2E family transporter	NA	NA	NA	NA	NA
AXS61601.1|2660103_2660832_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	4.3e-35
AXS61602.1|2660852_2661680_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXS61603.1|2661736_2662387_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXS61604.1|2662405_2663062_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXS61605.1|2663097_2663229_-	DUF3918 domain-containing protein	NA	NA	NA	NA	NA
AXS61606.1|2663250_2663442_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61607.1|2663454_2663913_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61608.1|2664031_2666410_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.6	2.6e-81
AXS63040.1|2666428_2667049_-	hypothetical protein	NA	NA	NA	NA	NA
AXS61609.1|2667136_2668252_-|tRNA	tRNA(5-methylaminomethyl-2-thiouridine)- methyltransferase	tRNA	NA	NA	NA	NA
AXS61610.1|2668288_2669428_-	cysteine desulfurase	NA	NA	NA	NA	NA
AXS61611.1|2669446_2669863_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AXS61612.1|2670057_2671326_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.3	1.5e-112
AXS61613.1|2671440_2672205_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	33.5	2.2e-21
AXS61614.1|2672530_2674309_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.1	6.6e-13
AXS61615.1|2674323_2675598_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 9
CP023075	Bacillus velezensis strain K26 chromosome, complete genome	4047350	3277380	3345605	4047350	portal,holin,terminase,head,tail,protease,integrase,capsid,transposase	Bacillus_phage(68.0%)	91	3289177:3289201	3328178:3328202
AXS62173.1|3277380_3278530_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AXS62174.1|3278598_3279234_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AXS62175.1|3279427_3280756_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AXS62176.1|3280752_3281040_-	glutaredoxin family protein	NA	NA	NA	NA	NA
AXS62177.1|3281051_3282059_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AXS62178.1|3282055_3282835_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	5.4e-36
AXS62179.1|3282831_3283539_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXS62180.1|3283554_3284277_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXS62181.1|3284299_3285112_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXS62182.1|3285137_3285950_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXS62183.1|3285946_3286486_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXS62184.1|3286637_3287528_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXS62185.1|3287483_3288245_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXS62186.1|3288358_3288664_-	barnase inhibitor	NA	NA	NA	NA	NA
AXS62187.1|3288801_3289107_-	barnase inhibitor	NA	NA	NA	NA	NA
3289177:3289201	attL	GTTATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
AXS63073.1|3289886_3290432_+	hypothetical protein	NA	NA	NA	NA	NA
AXS62188.1|3290464_3290674_+	hypothetical protein	NA	NA	NA	NA	NA
AXS62189.1|3290709_3291873_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	50.2	3.9e-70
AXS62190.1|3291919_3292342_-|holin	holin	holin	D6R405	Bacillus_phage	98.5	2.3e-65
AXS62191.1|3292393_3292582_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	98.4	8.2e-31
AXS62192.1|3292578_3292941_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	91.7	4.9e-56
AXS62193.1|3292937_3294215_-	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	82.1	4.0e-153
AXS62194.1|3294231_3296793_-	peptidase G2	NA	D6R401	Bacillus_phage	97.3	0.0e+00
AXS62195.1|3296832_3298536_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	99.1	6.3e-312
AXS62196.1|3298547_3299387_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	93.5	1.7e-152
AXS62197.1|3299386_3303265_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	88.4	0.0e+00
AXS62198.1|3303465_3303804_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	91.1	6.8e-52
AXS62199.1|3303855_3304458_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	100.0	1.8e-111
AXS62200.1|3304458_3304839_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	94.4	1.4e-58
AXS62201.1|3304835_3305219_-	hypothetical protein	NA	Q9ZXF1	Bacillus_phage	99.2	1.9e-66
AXS62202.1|3305211_3305571_-|head,tail	head-tail adaptor protein	head,tail	Q9ZXF2	Bacillus_phage	96.6	1.0e-58
AXS62203.1|3305503_3305851_-	DNA-packaging protein	NA	Q9ZXF3	Bacillus_phage	95.7	4.2e-57
AXS62204.1|3305865_3306276_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	67.4	1.2e-37
AXS62205.1|3306303_3306615_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	96.2	2.3e-46
AXS62206.1|3306626_3307820_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	99.5	4.6e-220
AXS62207.1|3307859_3308486_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	100.0	6.8e-114
AXS62208.1|3308475_3309726_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	98.3	7.7e-242
AXS62209.1|3309731_3309962_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.3	1.5e-21
AXS62210.1|3309973_3311683_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	96.7	0.0e+00
AXS62211.1|3311682_3312189_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	95.8	3.1e-85
AXS62212.1|3312275_3312602_-	transglycosylase	NA	Q9T203	Bacillus_phage	97.2	1.1e-54
AXS62213.1|3312570_3312945_-	HNH endonuclease	NA	Q38456	Bacillus_phage	93.5	1.7e-67
AXS62214.1|3312941_3313364_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62215.1|3313363_3313591_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62216.1|3314156_3314699_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	59.4	1.8e-54
AXS62217.1|3314695_3315148_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	3.7e-37
AXS62218.1|3315448_3315883_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	4.1e-49
AXS62219.1|3315885_3316131_-	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
AXS62220.1|3316127_3316436_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62221.1|3316432_3316621_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62222.1|3316625_3316808_-	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	53.7	1.6e-10
AXS62223.1|3316823_3317051_-	hypothetical protein	NA	A0A217EQZ3	Bacillus_phage	63.5	2.0e-23
AXS62224.1|3317047_3317350_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62225.1|3317351_3318029_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	46.7	4.3e-37
AXS62226.1|3318025_3318349_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62227.1|3318430_3319270_-	hypothetical protein	NA	A0A0S2SXP3	Bacillus_phage	56.8	5.1e-88
AXS62228.1|3319273_3319531_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	41.2	3.9e-07
AXS62229.1|3319527_3319935_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	43.5	4.7e-23
AXS62230.1|3319931_3320294_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62231.1|3320434_3320638_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.9	9.8e-14
AXS62232.1|3321134_3321683_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
AXS62233.1|3321998_3322829_-	DNA replication protein	NA	A0A0U3U1U1	Bacillus_phage	35.6	8.4e-35
AXS62234.1|3322812_3323679_-	hypothetical protein	NA	D2XR43	Bacillus_phage	62.4	1.1e-50
AXS62235.1|3323671_3323902_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62236.1|3323919_3324243_-	DUF771 domain-containing protein	NA	A0A1B1IME6	Lactococcus_phage	38.0	5.6e-11
AXS62237.1|3324262_3324454_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.7	2.7e-13
AXS63074.1|3324489_3324693_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXS62238.1|3324855_3325254_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXS62239.1|3325680_3326781_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62240.1|3327041_3328106_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	65.3	3.6e-131
AXS62241.1|3328713_3329184_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.3	7.0e-47
3328178:3328202	attR	GTTATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
AXS62242.1|3329323_3331657_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.1	7.2e-92
AXS63075.1|3331675_3332422_-	carboxylesterase	NA	NA	NA	NA	NA
AXS62243.1|3332534_3332765_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AXS63076.1|3332888_3333074_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXS62244.1|3333269_3333680_+	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	62.0	7.8e-18
AXS62245.1|3333704_3334136_+	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	64.2	6.5e-15
AXS62246.1|3334216_3334534_+	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AXS62247.1|3334631_3336035_-	sensor histidine kinase	NA	NA	NA	NA	NA
AXS62248.1|3336025_3336688_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXS62249.1|3336709_3337480_-	lantibiotic protection ABC transporter permease	NA	NA	NA	NA	NA
AXS62250.1|3337476_3338211_-	lantibiotic protection ABC transporter permease	NA	NA	NA	NA	NA
AXS62251.1|3338207_3338921_-	lantibiotic ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.1	1.9e-56
AXS62252.1|3339032_3339710_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXS62253.1|3339728_3340646_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXS62254.1|3340660_3341314_-|holin	choline ABC transporter permease	holin	NA	NA	NA	NA
AXS62255.1|3341330_3342476_-	glycine/betaine ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	9.5e-13
AXS62256.1|3342761_3343295_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXS62257.1|3343328_3344003_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXS63077.1|3344020_3344914_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXS62258.1|3344951_3345605_-|holin	choline ABC transporter permease	holin	NA	NA	NA	NA
>prophage 10
CP023075	Bacillus velezensis strain K26 chromosome, complete genome	4047350	3681388	3735476	4047350	tRNA,coat,protease	Bacillus_phage(10.0%)	55	NA	NA
AXS62582.1|3681388_3683059_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AXS62583.1|3683055_3683484_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AXS62584.1|3683775_3684921_+	aspartate phosphatase	NA	A0A1P8CWN8	Bacillus_phage	43.4	6.5e-78
AXS62585.1|3685146_3686019_-	agmatinase	NA	NA	NA	NA	NA
AXS62586.1|3686078_3686909_-	spermidine synthase	NA	NA	NA	NA	NA
AXS62587.1|3687108_3689181_+	penicillin-binding protein	NA	NA	NA	NA	NA
AXS62588.1|3689205_3689637_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62589.1|3689780_3690299_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62590.1|3690311_3690971_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AXS62591.1|3691076_3691265_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AXS62592.1|3691302_3691722_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXS63090.1|3692105_3693485_+	amino acid permease	NA	NA	NA	NA	NA
AXS62593.1|3693549_3694050_-	YwgA family protein	NA	NA	NA	NA	NA
AXS62594.1|3694089_3695391_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
AXS62595.1|3695551_3695776_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AXS62596.1|3695978_3696752_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
AXS62597.1|3697051_3697327_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXS62598.1|3697327_3697882_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AXS62599.1|3697979_3698900_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	1.7e-36
AXS62600.1|3698896_3699850_+	ABC transporter permease	NA	NA	NA	NA	NA
AXS62601.1|3699839_3700676_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62602.1|3700666_3701464_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62603.1|3701432_3702356_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62604.1|3702404_3702584_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62605.1|3702736_3703600_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AXS62606.1|3703646_3704546_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
AXS62607.1|3704661_3705639_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AXS62608.1|3705675_3706647_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AXS62609.1|3706909_3707674_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
AXS62610.1|3707793_3708573_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXS62611.1|3708589_3709789_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AXS62612.1|3709801_3710983_-	MFS transporter	NA	NA	NA	NA	NA
AXS62613.1|3710979_3712398_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AXS62614.1|3712415_3713177_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	4.8e-21
AXS62615.1|3713173_3713884_-	bacilysin biosynthesis protein BacB	NA	NA	NA	NA	NA
AXS62616.1|3713873_3714488_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AXS62617.1|3714649_3715888_-	MFS transporter	NA	NA	NA	NA	NA
AXS62618.1|3716110_3717313_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	26.1	2.1e-26
AXS62619.1|3717345_3718764_-	amino acid permease	NA	NA	NA	NA	NA
AXS62620.1|3718788_3720471_-	peptidase M20	NA	NA	NA	NA	NA
AXS62621.1|3720542_3722090_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXS62622.1|3722297_3723584_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AXS62623.1|3723769_3724231_-	hypothetical protein	NA	NA	NA	NA	NA
AXS62624.1|3724447_3724903_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXS62625.1|3724899_3725748_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	7.0e-37
AXS62626.1|3725768_3726716_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.6	2.3e-68
AXS62627.1|3726718_3727456_-	glucose-1-phosphate thymidylyltransferase	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
AXS62628.1|3727483_3728488_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXS62629.1|3728489_3729233_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXS62630.1|3729222_3730344_-|coat	spore coat protein	coat	NA	NA	NA	NA
AXS62631.1|3730343_3731207_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXS62632.1|3731207_3732377_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
AXS62633.1|3732399_3733824_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AXS62634.1|3733828_3734599_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
AXS62635.1|3734879_3735476_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
