The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031810	Klebsiella pneumoniae strain INF014-sc-2279884 chromosome, complete genome	5348492	67213	153688	5348492	terminase,tRNA,tail,integrase,holin,portal,protease	Enterobacteria_phage(19.57%)	94	90221:90244	130935:130958
AXS33547.1|67213_68632_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AXS33548.1|68683_69076_-	hypothetical protein	NA	NA	NA	NA	NA
AXS33549.1|69079_69433_-	hypothetical protein	NA	NA	NA	NA	NA
AXS33550.1|70054_72268_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXS33551.1|72274_73477_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AXS33552.1|73823_75065_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AXS33553.1|75122_75482_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AXS33554.1|75612_76605_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
AXS38341.1|76785_78447_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
AXS33555.1|78443_79679_-	ion channel protein	NA	NA	NA	NA	NA
AXS33556.1|79942_80908_+	glucokinase	NA	NA	NA	NA	NA
AXS38342.1|80961_81699_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
AXS33557.1|81710_83408_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
AXS33558.1|83516_83702_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
AXS33559.1|83790_85005_+	alanine transaminase	NA	NA	NA	NA	NA
AXS38343.1|85075_85147_-	membrane protein YpdK	NA	NA	NA	NA	NA
AXS33560.1|85485_86682_-	MFS transporter	NA	NA	NA	NA	NA
AXS33561.1|86678_87137_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	9.4e-12
AXS33562.1|87269_88178_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
AXS33563.1|88187_89069_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
AXS33564.1|89437_89920_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
90221:90244	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AXS33565.1|90438_91623_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	82.7	5.5e-197
AXS33566.1|91647_92577_+	hypothetical protein	NA	NA	NA	NA	NA
AXS38344.1|92582_92768_-	DNA-binding protein	NA	A0A2R2Z2X2	Escherichia_phage	60.0	2.6e-13
AXS33567.1|92779_92962_-	hypothetical protein	NA	NA	NA	NA	NA
AXS33568.1|92958_93105_-|integrase	integrase	integrase	NA	NA	NA	NA
AXS38345.1|93280_94144_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	58.2	2.0e-71
AXS33569.1|94225_95038_-	DUF2303 family protein	NA	NA	NA	NA	NA
AXS33570.1|95081_95441_-	hypothetical protein	NA	NA	NA	NA	NA
AXS33571.1|95876_96812_+	hypothetical protein	NA	NA	NA	NA	NA
AXS38346.1|97629_98304_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	86.8	3.3e-114
AXS33572.1|98394_98595_+	transcriptional regulator	NA	U5P445	Shigella_phage	76.9	2.8e-21
AXS33573.1|98638_99154_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	63.4	2.6e-58
AXS33574.1|99192_99471_+	hypothetical protein	NA	NA	NA	NA	NA
AXS33575.1|99632_99908_+	hypothetical protein	NA	NA	NA	NA	NA
AXS33576.1|99900_101430_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	6.6e-203
AXS33577.1|101426_102398_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.1	2.1e-109
AXS38347.1|102367_103012_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
AXS33578.1|103008_103650_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.9	1.3e-83
AXS33579.1|103646_104225_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.7e-50
AXS33580.1|104298_104895_-	hypothetical protein	NA	NA	NA	NA	NA
AXS33581.1|105024_105420_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AXS33582.1|105406_105688_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AXS33583.1|105687_106317_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.4	2.7e-86
AXS33584.1|106319_106595_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.8	1.3e-24
AXS33585.1|106545_106743_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.5	5.0e-23
AXS33586.1|106832_107174_+	hypothetical protein	NA	NA	NA	NA	NA
AXS33587.1|107317_107563_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	9.3e-35
AXS38348.1|107788_108049_+	hypothetical protein	NA	NA	NA	NA	NA
AXS33588.1|108622_109114_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	83.4	1.4e-66
AXS33589.1|109113_111222_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.6	0.0e+00
AXS33590.1|111218_111434_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	78.6	1.5e-25
AXS33591.1|111430_112930_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.4	4.3e-247
AXS33592.1|112874_114890_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.1	0.0e+00
AXS33593.1|114970_115297_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	67.3	8.1e-34
AXS33594.1|115289_115583_+	ATP-binding protein	NA	NA	NA	NA	NA
AXS33595.1|115572_116124_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	4.5e-53
AXS33596.1|116120_116519_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
AXS33597.1|116526_117009_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
AXS33598.1|117051_117447_+|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	2.4e-08
AXS33599.1|117467_117785_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
AXS33600.1|117765_120462_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.6	1.3e-201
AXS33601.1|120461_120935_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.9	1.7e-53
AXS33602.1|120921_121404_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	97.5	2.1e-83
AXS33603.1|121413_121794_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	95.2	4.0e-69
AXS33604.1|121790_124859_+	kinase	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
AXS33605.1|124934_127088_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.0	8.1e-90
AXS33606.1|127100_127835_+	hypothetical protein	NA	NA	NA	NA	NA
AXS33607.1|127889_128534_-	hypothetical protein	NA	NA	NA	NA	NA
AXS38349.1|128848_129388_+	DNA-invertase	NA	A0A286S1P7	Klebsiella_phage	79.6	1.1e-59
AXS33608.1|129438_129861_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	43.8	8.9e-25
AXS33609.1|130272_130512_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	54.4	9.8e-21
AXS33610.1|130468_130840_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	9.2e-26
AXS33611.1|131046_131976_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.4	5.2e-134
130935:130958	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AXS33612.1|132265_133027_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AXS33613.1|133088_134417_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AXS33614.1|134784_135069_+	DUF406 family protein	NA	NA	NA	NA	NA
AXS33615.1|135228_136539_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AXS33616.1|136538_138683_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AXS33617.1|138892_139378_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AXS33618.1|139398_139950_-	endonuclease SmrB	NA	NA	NA	NA	NA
AXS33619.1|140117_141050_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXS33620.1|141091_142177_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
AXS33621.1|142179_143004_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AXS33622.1|143003_143813_+	hypothetical protein	NA	NA	NA	NA	NA
AXS33623.1|143812_144361_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AXS33624.1|144392_144674_+	YfcL family protein	NA	NA	NA	NA	NA
AXS38350.1|144735_146724_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AXS33625.1|146882_148103_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AXS33626.1|148312_149488_+	arabinose transporter	NA	NA	NA	NA	NA
AXS33627.1|149574_150552_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AXS38351.1|150686_151799_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.0	3.5e-20
AXS33628.1|151862_152876_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXS33629.1|152875_153688_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 2
CP031810	Klebsiella pneumoniae strain INF014-sc-2279884 chromosome, complete genome	5348492	358328	365233	5348492		Planktothrix_phage(33.33%)	6	NA	NA
AXS38358.1|358328_359192_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AXS33806.1|359202_359976_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AXS38359.1|360216_361110_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	1.6e-15
AXS33807.1|361355_362717_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AXS33808.1|363035_363758_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AXS33809.1|363754_365233_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
CP031810	Klebsiella pneumoniae strain INF014-sc-2279884 chromosome, complete genome	5348492	585948	653752	5348492	terminase,tRNA,capsid,tail,integrase,holin,portal,head,protease	Klebsiella_phage(54.17%)	85	585801:585860	624864:624988
585801:585860	attL	GATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTG	NA	NA	NA	NA
AXS33979.1|585948_586983_-|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	64.0	7.0e-124
AXS33980.1|586982_587213_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AXS33981.1|587245_587518_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	44.8	5.0e-13
AXS33982.1|587514_587790_-	hypothetical protein	NA	NA	NA	NA	NA
AXS33983.1|587786_588269_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.3	1.4e-71
AXS33984.1|588261_588606_-	hypothetical protein	NA	NA	NA	NA	NA
AXS33985.1|588733_589519_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	4.0e-63
AXS33986.1|589518_589818_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	9.4e-13
AXS33987.1|590436_591093_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	87.2	2.0e-108
AXS33988.1|591191_591389_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	86.2	1.1e-25
AXS33989.1|591534_591858_-	hypothetical protein	NA	NA	NA	NA	NA
AXS33990.1|591916_592384_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	85.8	7.4e-65
AXS33991.1|592621_592801_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
AXS33992.1|592790_593759_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.7	9.3e-86
AXS33993.1|593755_594565_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	2.7e-110
AXS33994.1|594574_594952_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
AXS33995.1|594964_595945_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.1e-134
AXS33996.1|595963_596305_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	2.5e-54
AXS33997.1|596353_596839_-	hypothetical protein	NA	NA	NA	NA	NA
AXS33998.1|596863_597685_-	hypothetical protein	NA	NA	NA	NA	NA
AXS33999.1|599082_599394_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.5	1.1e-40
AXS34000.1|599390_599930_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	97.2	4.8e-100
AXS34001.1|599926_600274_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	2.0e-38
AXS34002.1|600270_600546_+	hypothetical protein	NA	NA	NA	NA	NA
AXS34003.1|600496_600688_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	94.6	3.4e-24
AXS34004.1|601007_601253_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	90.1	1.1e-30
AXS34005.1|601324_601531_+	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	100.0	2.7e-35
AXS34006.1|601602_601893_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	97.9	6.9e-53
AXS34007.1|601905_602115_+	serine acetyltransferase	NA	A0A286N2R4	Klebsiella_phage	88.4	1.2e-25
AXS34008.1|602236_602671_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
AXS34009.1|602680_604213_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	99.8	1.1e-295
AXS34010.1|604215_605493_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
AXS34011.1|605498_606179_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
AXS34012.1|606190_607354_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.7	1.0e-211
AXS34013.1|607580_607907_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
AXS34014.1|607967_608165_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
AXS34015.1|608166_608499_+|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	99.1	2.0e-56
AXS34016.1|608491_609031_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
AXS34017.1|609027_609393_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	91.7	1.9e-60
AXS34018.1|609449_609941_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	2.5e-87
AXS34019.1|609984_610338_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	99.1	3.8e-61
AXS34020.1|610370_610634_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	97.7	1.7e-42
AXS34021.1|610699_611167_+	hypothetical protein	NA	NA	NA	NA	NA
AXS34022.1|611211_613659_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.1	1.2e-275
AXS34023.1|613658_614138_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	95.6	8.1e-91
AXS34024.1|614124_614607_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	98.1	1.1e-84
AXS34025.1|614616_614997_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	96.0	1.4e-69
AXS34026.1|614993_618062_+	kinase	NA	A0A286S259	Klebsiella_phage	98.1	0.0e+00
AXS34027.1|618136_620290_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	3.6e-90
AXS34028.1|620302_621037_+	hypothetical protein	NA	NA	NA	NA	NA
AXS34029.1|621048_621378_-	hypothetical protein	NA	NA	NA	NA	NA
AXS34030.1|621414_621744_-	hypothetical protein	NA	NA	NA	NA	NA
AXS34031.1|622096_622336_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	1.5e-21
AXS34032.1|622292_622661_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.1	2.3e-24
AXS34033.1|622833_624213_-	hypothetical protein	NA	NA	NA	NA	NA
AXS34034.1|625147_626029_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
624864:624988	attR	GATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTGGGAAATACAGAATAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTACGGGTGGTTTTTTTGTT	NA	NA	NA	NA
AXS34035.1|626127_626796_+	YecA family protein	NA	NA	NA	NA	NA
AXS34036.1|626820_628032_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
AXS34037.1|628223_628463_+	DUF2492 family protein	NA	NA	NA	NA	NA
AXS34038.1|628498_628996_-	non-heme ferritin	NA	NA	NA	NA	NA
AXS34039.1|629053_629233_-	hypothetical protein	NA	NA	NA	NA	NA
AXS34040.1|629404_630043_+	hypothetical protein	NA	NA	NA	NA	NA
AXS34041.1|630077_631502_-	MFS transporter	NA	NA	NA	NA	NA
AXS34042.1|631652_631904_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AXS34043.1|631941_633504_-	MFS transporter	NA	NA	NA	NA	NA
AXS34044.1|633518_633677_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AXS34045.1|633747_634257_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
AXS34046.1|634350_634554_+	hypothetical protein	NA	NA	NA	NA	NA
AXS34047.1|635148_636129_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXS34048.1|636191_637706_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
AXS34049.1|637720_638701_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AXS34050.1|638862_639651_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AXS34051.1|639625_641050_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AXS34052.1|641073_641502_-	universal stress protein UspC	NA	NA	NA	NA	NA
AXS34053.1|641854_643438_+	MFS transporter	NA	NA	NA	NA	NA
AXS34054.1|643442_644582_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
AXS34055.1|644643_646377_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.9	8.0e-88
AXS34056.1|646612_647182_+	VOC family protein	NA	NA	NA	NA	NA
AXS34057.1|647258_648002_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXS34058.1|648083_649088_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AXS34059.1|649084_649828_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
AXS34060.1|649867_650263_-	hypothetical protein	NA	NA	NA	NA	NA
AXS34061.1|650315_651134_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	2.0e-60
AXS34062.1|651130_651697_-	hydrolase	NA	NA	NA	NA	NA
AXS34063.1|651964_653752_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
>prophage 4
CP031810	Klebsiella pneumoniae strain INF014-sc-2279884 chromosome, complete genome	5348492	1462595	1473482	5348492		Escherichia_phage(87.5%)	9	NA	NA
AXS34817.1|1462595_1465703_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AXS34818.1|1465757_1467023_+	MFS transporter	NA	NA	NA	NA	NA
AXS34819.1|1467053_1468142_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	4.0e-210
AXS34820.1|1468228_1468489_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AXS34821.1|1468786_1469647_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AXS34822.1|1469667_1470429_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXS34823.1|1470689_1471592_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AXS34824.1|1471603_1472869_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
AXS34825.1|1472861_1473482_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
CP031810	Klebsiella pneumoniae strain INF014-sc-2279884 chromosome, complete genome	5348492	2149822	2237960	5348492	tRNA,lysis,tail,capsid,integrase,portal,plate,head,protease	Salmonella_phage(54.39%)	93	2205459:2205479	2238697:2238717
AXS35426.1|2149822_2151115_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AXS35427.1|2151205_2152549_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	5.6e-81
AXS35428.1|2152557_2153169_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXS35429.1|2153291_2157545_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AXS35430.1|2157680_2158175_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AXS35431.1|2158680_2159676_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
AXS35432.1|2159790_2161557_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AXS35433.1|2161557_2163279_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	9.0e-15
AXS35434.1|2163323_2164025_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXS35435.1|2164378_2164597_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXS35436.1|2164715_2166995_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXS35437.1|2167025_2167343_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXS35438.1|2167668_2167890_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXS35439.1|2167844_2168027_-	hypothetical protein	NA	NA	NA	NA	NA
AXS35440.1|2167966_2169907_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AXS35441.1|2169903_2171019_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AXS35442.1|2171165_2172824_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AXS35443.1|2173243_2173939_+	aquaporin Z	NA	NA	NA	NA	NA
AXS35444.1|2174054_2174954_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AXS38442.1|2175097_2176750_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AXS35445.1|2176760_2177729_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AXS35446.1|2177940_2178375_-	DoxX family protein	NA	NA	NA	NA	NA
AXS38443.1|2178526_2180245_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AXS35447.1|2180283_2181285_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AXS35448.1|2181295_2182738_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXS35449.1|2182825_2183839_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXS35450.1|2183835_2184666_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AXS35451.1|2184697_2185837_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXS35452.1|2185889_2186069_+	hypothetical protein	NA	NA	NA	NA	NA
AXS35453.1|2186714_2187230_+	lipoprotein	NA	NA	NA	NA	NA
AXS35454.1|2187456_2188185_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AXS38444.1|2188205_2188937_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXS35455.1|2188943_2189660_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AXS35456.1|2189659_2190328_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AXS35457.1|2190511_2191243_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXS35458.1|2191329_2192802_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AXS35459.1|2192798_2193515_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	1.2e-34
AXS35460.1|2193593_2194721_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AXS35461.1|2194762_2195251_-	DUF2593 family protein	NA	NA	NA	NA	NA
AXS35462.1|2195308_2196154_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AXS35463.1|2196150_2197104_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AXS38445.1|2197114_2198248_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AXS35464.1|2198411_2199524_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AXS35465.1|2199872_2200352_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AXS35466.1|2200440_2201343_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.9	7.7e-34
AXS35467.1|2201457_2202180_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AXS35468.1|2202163_2202451_-	DUF1418 family protein	NA	NA	NA	NA	NA
AXS35469.1|2202653_2202917_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AXS35470.1|2202923_2203307_-	hypothetical protein	NA	NA	NA	NA	NA
AXS38446.1|2203573_2205259_+	transporter	NA	NA	NA	NA	NA
2205459:2205479	attL	TGGCGACAAAGTGGCGACAGC	NA	NA	NA	NA
AXS35471.1|2205480_2205699_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	66.2	8.3e-19
AXS35472.1|2205785_2206883_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	82.0	1.3e-168
AXS35473.1|2206879_2207365_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	5.0e-64
AXS35474.1|2207361_2209992_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.9	6.8e-115
AXS35475.1|2209984_2210104_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AXS35476.1|2210118_2210418_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	77.0	1.4e-32
AXS35477.1|2210470_2210986_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AXS35478.1|2210995_2212168_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.8	5.4e-205
AXS35479.1|2212306_2213467_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	50.0	1.2e-44
AXS35480.1|2213544_2213820_-	hypothetical protein	NA	NA	NA	NA	NA
AXS35481.1|2213833_2216059_-	endo-N-neuraminidase	NA	K4I5E8	Salmonella_phage	41.3	3.0e-10
AXS38447.1|2216064_2216661_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	56.0	1.8e-55
AXS35482.1|2216653_2217562_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	3.4e-106
AXS35483.1|2217548_2217911_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
AXS35484.1|2217907_2218480_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	2.1e-77
AXS35485.1|2218583_2219246_+	hypothetical protein	NA	NA	NA	NA	NA
AXS35486.1|2219258_2219711_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.4	6.5e-50
AXS35487.1|2219703_2220135_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AXS35488.1|2220097_2220301_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	78.5	5.2e-23
AXS35489.1|2220230_2220659_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	5.6e-51
AXS35490.1|2220663_2221173_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	9.5e-82
AXS35491.1|2221153_2221369_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	85.9	1.5e-28
AXS35492.1|2221372_2221576_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AXS35493.1|2221575_2222040_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	84.4	6.7e-74
AXS35494.1|2222136_2222787_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	86.1	2.1e-102
AXS35495.1|2222790_2223843_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	89.1	2.1e-171
AXS35496.1|2223859_2224693_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	74.4	2.2e-99
AXS35497.1|2224832_2226596_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	92.6	0.0e+00
AXS35498.1|2226595_2227624_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.3	6.2e-173
AXS35499.1|2227670_2229335_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.9	4.5e-11
AXS35500.1|2229325_2229556_-	hypothetical protein	NA	NA	NA	NA	NA
AXS35501.1|2229630_2229816_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	50.0	5.6e-08
AXS35502.1|2232332_2232560_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	80.0	7.8e-28
AXS35503.1|2232559_2232796_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	55.4	8.2e-12
AXS35504.1|2232863_2233205_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	80.5	1.3e-45
AXS35505.1|2233168_2233369_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	80.3	1.2e-24
AXS35506.1|2233376_2233886_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	82.1	1.4e-72
AXS35507.1|2233918_2234140_-	regulator	NA	NA	NA	NA	NA
AXS35508.1|2234265_2234826_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	44.8	2.0e-40
AXS35509.1|2234837_2235422_+	hypothetical protein	NA	NA	NA	NA	NA
AXS35510.1|2235432_2236506_+	N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	40.0	1.1e-68
AXS35511.1|2236483_2236855_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	52.4	6.2e-30
AXS35512.1|2236934_2237960_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	5.2e-103
2238697:2238717	attR	TGGCGACAAAGTGGCGACAGC	NA	NA	NA	NA
>prophage 1
CP031811	Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence	169460	1728	65118	169460	integrase,transposase	Enterobacteria_phage(14.29%)	61	NA	NA
AXS38556.1|1728_2469_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AXS38557.1|2837_2951_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXS38558.1|3189_4113_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	2.8e-172
AXS38701.1|4565_5474_+	HNH endonuclease	NA	NA	NA	NA	NA
AXS38559.1|5882_6233_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
AXS38560.1|6376_6808_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AXS38561.1|7058_8534_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AXS38562.1|8526_9207_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
AXS38563.1|9396_10782_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AXS38564.1|10810_11164_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXS38565.1|11277_12570_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXS38566.1|12580_15727_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AXS38567.1|15813_16254_+	hypothetical protein	NA	NA	NA	NA	NA
AXS38568.1|16380_18828_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AXS38569.1|18868_19066_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AXS38570.1|19099_19837_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AXS38571.1|20125_20575_-	copper resistance protein	NA	NA	NA	NA	NA
AXS38572.1|20809_22627_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AXS38573.1|22626_23523_+	copper resistance protein B	NA	NA	NA	NA	NA
AXS38574.1|23562_23943_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AXS38575.1|23947_24877_+	copper resistance protein D	NA	NA	NA	NA	NA
AXS38576.1|24931_25612_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AXS38577.1|25608_27009_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AXS38578.1|27224_27659_+	copper-binding protein	NA	NA	NA	NA	NA
AXS38702.1|27890_28070_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXS38579.1|29812_30322_+	porin	NA	NA	NA	NA	NA
AXS38703.1|30371_30869_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXS38580.1|31200_31527_+	transcriptional regulator	NA	NA	NA	NA	NA
AXS38704.1|31526_32237_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AXS38581.1|32245_32791_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXS38582.1|32866_33229_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AXS38583.1|35125_35662_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXS38584.1|36062_39068_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
AXS38585.1|39231_39789_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AXS38586.1|39971_40832_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXS38587.1|41041_41581_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXS38588.1|41552_42389_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXS38589.1|42388_43192_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AXS38590.1|43252_44068_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AXS38591.1|44397_44574_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AXS38592.1|44755_45760_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXS38593.1|47568_48273_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXS38594.1|48263_48581_+	hypothetical protein	NA	NA	NA	NA	NA
AXS38706.1|49286_49613_-	hypothetical protein	NA	NA	NA	NA	NA
AXS38705.1|49664_49751_+	ABC transporter	NA	NA	NA	NA	NA
AXS38595.1|50375_51080_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXS38596.1|52071_53460_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
AXS38707.1|53459_53690_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
AXS38597.1|53714_54419_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXS38598.1|54936_55788_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
AXS38599.1|55717_55897_-	hypothetical protein	NA	NA	NA	NA	NA
AXS38600.1|56132_56948_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.9	4.3e-161
AXS38601.1|58276_58834_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AXS38602.1|58871_59195_-|transposase	transposase	transposase	NA	NA	NA	NA
AXS38603.1|59139_60153_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXS38604.1|60308_60782_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AXS38605.1|61002_61269_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AXS38606.1|61411_62176_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXS38607.1|62217_62430_+	resolvase	NA	NA	NA	NA	NA
AXS38608.1|62442_63651_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AXS38609.1|63684_65118_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
