The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031814	Klebsiella pneumoniae strain KSB1_7F-sc-2280268 chromosome, complete genome	5276478	1647298	1654203	5276478		Planktothrix_phage(33.33%)	6	NA	NA
AXS11568.1|1647298_1648162_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AXS08211.1|1648172_1648946_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AXS11569.1|1649186_1650080_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AXS08212.1|1650325_1651687_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AXS08213.1|1652005_1652728_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AXS08214.1|1652724_1654203_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 2
CP031814	Klebsiella pneumoniae strain KSB1_7F-sc-2280268 chromosome, complete genome	5276478	1693673	1710996	5276478		Escherichia_phage(38.46%)	16	NA	NA
AXS08240.1|1693673_1695053_+	hypothetical protein	NA	K4MM73	Escherichia_phage	48.9	2.0e-118
AXS08241.1|1695241_1696648_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	27.8	3.4e-36
AXS08242.1|1696870_1697935_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
AXS08243.1|1697961_1698831_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
AXS08244.1|1698862_1699753_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AXS08245.1|1699767_1700322_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.1e-51
AXS08246.1|1700502_1701669_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	9.1e-112
AXS08247.1|1702613_1703618_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	5.2e-31
AXS08248.1|1703573_1703855_+	hypothetical protein	NA	NA	NA	NA	NA
AXS08249.1|1704457_1705522_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	5.8e-105
AXS08250.1|1705535_1706405_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
AXS08251.1|1706436_1707327_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AXS08252.1|1707341_1707896_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.1e-51
AXS08253.1|1707982_1708813_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AXS08254.1|1708841_1709675_+	ABC transporter permease	NA	NA	NA	NA	NA
AXS08255.1|1709664_1710996_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	6.9e-15
>prophage 3
CP031814	Klebsiella pneumoniae strain KSB1_7F-sc-2280268 chromosome, complete genome	5276478	2649767	2660655	5276478		Escherichia_phage(87.5%)	9	NA	NA
AXS09146.1|2649767_2652875_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.7	0.0e+00
AXS09147.1|2652929_2654195_+	MFS transporter	NA	NA	NA	NA	NA
AXS09148.1|2654225_2655314_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AXS09149.1|2655400_2655661_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AXS09150.1|2655959_2656820_+	class A beta-lactamase SHV-119	NA	A0A077SL40	Escherichia_phage	98.6	9.3e-154
AXS09151.1|2656840_2657602_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXS09152.1|2657862_2658765_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	3.4e-159
AXS09153.1|2658776_2660042_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
AXS09154.1|2660034_2660655_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
CP031814	Klebsiella pneumoniae strain KSB1_7F-sc-2280268 chromosome, complete genome	5276478	2830857	2895300	5276478	plate,protease,transposase,tRNA	Escherichia_phage(22.22%)	56	NA	NA
AXS09308.1|2830857_2831793_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	5.9e-138
AXS09309.1|2831838_2833212_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	1.9e-52
AXS09310.1|2833226_2833421_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09311.1|2833737_2834721_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AXS11622.1|2834999_2835743_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	6.0e-16
AXS09312.1|2835705_2836824_+	oxidoreductase	NA	NA	NA	NA	NA
AXS09313.1|2837060_2837255_+	hypothetical protein	NA	NA	NA	NA	NA
AXS09314.1|2837367_2838114_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09315.1|2838364_2839744_-	amino acid permease	NA	NA	NA	NA	NA
AXS09316.1|2840078_2840558_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXS09317.1|2840809_2841424_+	YitT family protein	NA	NA	NA	NA	NA
AXS09318.1|2841462_2842662_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AXS09319.1|2842690_2843359_-	ABC transporter permease	NA	NA	NA	NA	NA
AXS09320.1|2843351_2844365_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	2.9e-29
AXS09321.1|2844373_2845180_-	methionine-binding protein	NA	NA	NA	NA	NA
AXS09322.1|2845400_2846576_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AXS09323.1|2846620_2847655_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AXS09324.1|2847743_2848292_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXS09325.1|2848346_2849258_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
AXS09326.1|2849250_2850117_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXS09327.1|2850207_2851131_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXS09328.1|2851150_2852056_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXS09329.1|2852195_2853125_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
AXS09330.1|2853150_2853357_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXS09331.1|2853407_2854286_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXS09332.1|2854444_2855200_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXS09333.1|2855204_2855798_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXS09334.1|2855871_2856585_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXS09335.1|2856651_2857146_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09336.1|2857272_2857815_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXS09337.1|2857792_2858878_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXS09338.1|2858841_2860596_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXS09339.1|2860672_2861143_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09340.1|2861139_2862195_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09341.1|2862225_2863824_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AXS09342.1|2863820_2867279_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AXS09343.1|2867275_2868484_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09344.1|2868823_2869048_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09345.1|2869931_2871030_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.7e-46
AXS09346.1|2871222_2871744_-	hypothetical protein	NA	NA	NA	NA	NA
AXS11623.1|2872679_2872940_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09347.1|2875428_2876352_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	2.1e-172
AXS11624.1|2876554_2876830_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09348.1|2876963_2878175_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09349.1|2878167_2880687_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	1.4e-19
AXS09350.1|2880751_2881138_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09351.1|2881138_2882353_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09352.1|2882345_2884865_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.8	2.2e-17
AXS09353.1|2884857_2887512_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.6	2.9e-97
AXS09354.1|2887776_2888268_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AXS09355.1|2888272_2889979_-	OmpA family protein	NA	NA	NA	NA	NA
AXS09356.1|2889975_2890665_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AXS11625.1|2890661_2892002_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXS09357.1|2892014_2893559_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXS09358.1|2893601_2894093_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXS09359.1|2894733_2895300_+|protease	protease	protease	NA	NA	NA	NA
>prophage 5
CP031814	Klebsiella pneumoniae strain KSB1_7F-sc-2280268 chromosome, complete genome	5276478	2939710	2990120	5276478	terminase,holin,tail,integrase	Salmonella_phage(19.64%)	72	2931790:2931805	2987426:2987441
2931790:2931805	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
AXS11628.1|2939710_2941135_+	hypothetical protein	NA	K4MM73	Escherichia_phage	60.4	4.3e-172
AXS09398.1|2941142_2941397_+	hypothetical protein	NA	K4MPX1	Escherichia_phage	59.0	8.8e-20
AXS09399.1|2941429_2941696_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09400.1|2943839_2946908_-	kinase	NA	A0A286S259	Klebsiella_phage	95.6	0.0e+00
AXS09401.1|2946904_2947285_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AXS09402.1|2947294_2947777_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
AXS09403.1|2947957_2948422_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	59.2	6.5e-53
AXS09404.1|2948736_2949072_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09405.1|2949155_2952035_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.5	5.6e-102
AXS09406.1|2952136_2952478_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	43.3	2.6e-06
AXS09407.1|2952566_2952734_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09408.1|2952901_2953384_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09409.1|2953437_2954610_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
AXS09410.1|2954633_2955026_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AXS09411.1|2955022_2955574_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
AXS09412.1|2955575_2955959_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	9.2e-21
AXS09413.1|2955945_2956179_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
AXS09414.1|2956188_2956443_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
AXS09415.1|2956444_2956840_-	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	4.3e-13
AXS09416.1|2957161_2958115_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
AXS09417.1|2958125_2958911_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.4	1.7e-66
AXS09418.1|2959007_2959271_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09419.1|2959423_2960536_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	2.5e-111
AXS09420.1|2960519_2961920_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	1.9e-127
AXS09421.1|2961921_2963235_-|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	73.6	2.2e-183
AXS09422.1|2963218_2964214_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.1e-38
AXS09423.1|2964562_2964835_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	100.0	7.0e-31
AXS09424.1|2965209_2965404_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	3.3e-19
AXS09425.1|2965476_2965698_-	DNA gyrase subunit B	NA	NA	NA	NA	NA
AXS09426.1|2965806_2966004_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09427.1|2966152_2966446_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.1	1.3e-30
AXS09428.1|2966442_2966637_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	90.6	2.2e-26
AXS09429.1|2966587_2966863_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	39.3	1.4e-07
AXS09430.1|2966865_2967495_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.4	9.3e-87
AXS09431.1|2967494_2967776_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	47.3	2.4e-18
AXS09432.1|2967762_2968149_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
AXS09433.1|2968255_2968453_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09434.1|2968842_2969664_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	69.7	5.4e-103
AXS09435.1|2969779_2970136_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	65.0	5.2e-42
AXS09436.1|2970132_2970429_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
AXS09437.1|2970431_2970632_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	71.2	1.1e-22
AXS09438.1|2970628_2971234_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.6	8.7e-90
AXS11629.1|2971268_2971505_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	77.5	1.4e-27
AXS09439.1|2971612_2971846_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
AXS09440.1|2972597_2972897_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09441.1|2972992_2973421_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09442.1|2973424_2973646_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	2.9e-11
AXS09443.1|2973642_2973897_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
AXS09444.1|2973889_2974093_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
AXS09445.1|2974089_2974875_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.7	7.3e-65
AXS09446.1|2974867_2975203_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	1.3e-10
AXS09447.1|2975210_2975960_-	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
AXS09448.1|2975962_2976871_-	DNA-binding protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
AXS09449.1|2976885_2977074_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09450.1|2977161_2977698_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
AXS09451.1|2977700_2977934_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
AXS09452.1|2978038_2978434_+	XRE family transcriptional regulator	NA	K7PM35	Enterobacteria_phage	74.0	3.1e-48
AXS09453.1|2978655_2978775_+	hypothetical protein	NA	NA	NA	NA	NA
AXS09454.1|2978881_2979745_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	62.5	1.3e-94
AXS09455.1|2979777_2979981_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	76.1	6.3e-21
AXS09456.1|2980264_2980573_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	61.2	8.4e-25
AXS09457.1|2980664_2980763_+	hypothetical protein	NA	NA	NA	NA	NA
AXS09458.1|2980869_2981061_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXS09459.1|2981069_2981225_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	71.2	5.7e-14
AXS09460.1|2981362_2984461_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	56.9	1.4e-292
AXS09461.1|2984473_2985562_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	55.7	5.3e-106
AXS09462.1|2985602_2985842_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
AXS09463.1|2985851_2986166_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AXS09464.1|2986062_2987250_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
AXS09465.1|2987426_2988317_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
2987426:2987441	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
AXS09466.1|2988316_2989309_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AXS09467.1|2989310_2990120_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 6
CP031814	Klebsiella pneumoniae strain KSB1_7F-sc-2280268 chromosome, complete genome	5276478	3109962	3196977	5276478	head,transposase,holin,plate,portal,tRNA,capsid,terminase,tail,integrase	Escherichia_phage(15.91%)	108	3141107:3141166	3184220:3184280
AXS09583.1|3109962_3110463_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AXS09584.1|3110580_3111027_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AXS11633.1|3111010_3111802_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXS09585.1|3111903_3113088_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AXS09586.1|3113119_3113812_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09587.1|3113957_3114467_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AXS09588.1|3114453_3114810_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AXS09589.1|3114799_3115039_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AXS09590.1|3115339_3116353_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
AXS09591.1|3116410_3116512_+	hypothetical protein	NA	NA	NA	NA	NA
AXS11634.1|3116511_3116586_+	protein YoaJ	NA	NA	NA	NA	NA
AXS09592.1|3116703_3116829_+	hypothetical protein	NA	NA	NA	NA	NA
AXS09593.1|3116888_3117152_-	DUF2534 family protein	NA	NA	NA	NA	NA
AXS09594.1|3117282_3117921_-	leucine efflux protein	NA	NA	NA	NA	NA
AXS09595.1|3118010_3118925_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AXS09596.1|3119140_3119332_+	hypothetical protein	NA	NA	NA	NA	NA
AXS09597.1|3119586_3120630_-	type II asparaginase	NA	NA	NA	NA	NA
AXS09598.1|3120932_3122141_+	HD domain-containing protein	NA	NA	NA	NA	NA
AXS09599.1|3122214_3123999_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AXS09600.1|3124005_3124896_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXS09601.1|3125016_3126525_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
AXS09602.1|3126835_3127522_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AXS09603.1|3127919_3128099_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09604.1|3128138_3128771_-	DNA-binding protein	NA	NA	NA	NA	NA
AXS09605.1|3129337_3129535_+	hypothetical protein	NA	NA	NA	NA	NA
AXS09606.1|3129650_3130661_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AXS09607.1|3130657_3132064_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXS09608.1|3132119_3133007_-	manganese catalase family protein	NA	NA	NA	NA	NA
AXS09609.1|3133023_3133530_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXS09610.1|3133556_3134051_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXS09611.1|3134141_3134327_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AXS09612.1|3134948_3136142_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AXS09613.1|3136254_3136482_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AXS09614.1|3136536_3137082_-	cysteine hydrolase	NA	NA	NA	NA	NA
AXS09615.1|3137403_3137877_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AXS09616.1|3137994_3138576_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXS09617.1|3138709_3139141_+	glyoxalase	NA	NA	NA	NA	NA
AXS09618.1|3139395_3139707_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AXS09619.1|3139711_3140104_+	amino acid-binding protein	NA	NA	NA	NA	NA
AXS09620.1|3140100_3140814_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
3141107:3141166	attL	GCGCCTTCCATGCCTTTGACGATCAGGTCTGCGGCTTCGAACCACTGCATGTGGCGCAGC	NA	NA	NA	NA
AXS09621.1|3141334_3141661_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.8	1.9e-27
AXS11635.1|3141660_3141900_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	1.8e-14
AXS09622.1|3142002_3142830_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09623.1|3145048_3146110_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	22.8	3.8e-08
AXS09624.1|3146645_3147329_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	37.2	8.4e-33
AXS09625.1|3147325_3148474_-|plate	baseplate J/gp47 family protein	plate	R9TN81	Rhizobium_phage	25.6	1.2e-15
AXS09626.1|3148463_3148913_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	42.1	3.3e-17
AXS09627.1|3148909_3149491_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AXS09628.1|3149487_3150573_-|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	30.2	1.4e-37
AXS09629.1|3150569_3151970_-	hypothetical protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	42.0	4.0e-05
AXS09630.1|3152017_3153871_-	hypothetical protein	NA	A0A172JGI1	Citrobacter_phage	44.5	2.0e-20
AXS09631.1|3153863_3154055_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09632.1|3154012_3154291_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXS09633.1|3154292_3154664_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXS09634.1|3154667_3156179_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.2	1.5e-106
AXS09635.1|3156175_3156361_-	DUF2635 domain-containing protein	NA	A0A2P9JZJ7	Alteromonadaceae_phage	42.6	1.8e-06
AXS09636.1|3156364_3156910_-	ATP-binding protein	NA	NA	NA	NA	NA
AXS09637.1|3156906_3157266_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09638.1|3157271_3157670_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09639.1|3157641_3158691_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	30.0	5.4e-39
AXS09640.1|3158789_3159194_-|head	head decoration protein	head	A0A0C5AN05	Bacteriophage	37.6	3.1e-11
AXS09641.1|3159193_3159775_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09642.1|3159776_3160643_-	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	47.7	1.4e-48
AXS09643.1|3160639_3162277_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	36.0	6.8e-89
AXS09644.1|3162276_3162537_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AXS09645.1|3162545_3164669_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.8	6.5e-100
AXS09646.1|3164610_3165195_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09647.1|3165512_3165797_+	DUF2622 domain-containing protein	NA	NA	NA	NA	NA
AXS09648.1|3165971_3166610_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09649.1|3166725_3167232_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09650.1|3167305_3167545_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	60.5	3.3e-16
AXS09651.1|3167612_3167816_-	hypothetical protein	NA	A0A0K1YB51	Cronobacter_phage	49.2	3.4e-06
AXS09652.1|3167876_3168167_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.1	2.4e-29
AXS09653.1|3168533_3168716_+	hypothetical protein	NA	NA	NA	NA	NA
AXS09654.1|3168897_3169377_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.8	1.3e-59
AXS09655.1|3169363_3169681_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	7.3e-48
AXS09656.1|3170547_3170703_-	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	68.8	2.5e-09
AXS09657.1|3170699_3171125_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	82.3	5.5e-59
AXS09658.1|3171344_3171923_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
AXS09659.1|3171936_3172917_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	1.1e-134
AXS09660.1|3172929_3173307_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
AXS09661.1|3173316_3174126_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	2.7e-110
AXS09662.1|3174122_3175076_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	69.0	1.0e-89
AXS09663.1|3175065_3175245_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
AXS09664.1|3175482_3175944_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AXS09665.1|3175969_3176167_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
AXS11636.1|3176271_3176919_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
AXS09666.1|3177465_3177765_+	hypothetical protein	NA	NA	NA	NA	NA
AXS09667.1|3177764_3178550_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	2.6e-62
AXS09668.1|3179566_3180241_+	hypothetical protein	NA	A0A2H4FRZ0	Salmonella_phage	57.8	2.9e-38
AXS09669.1|3180240_3180756_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	75.8	5.0e-70
AXS09670.1|3182114_3182333_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.6	2.1e-09
AXS09671.1|3182332_3182605_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	38.3	1.2e-06
AXS09672.1|3182633_3182870_+	excisionase	NA	NA	NA	NA	NA
AXS09673.1|3182859_3184002_+|integrase	integrase	integrase	Q77Z02	Phage_21	81.9	2.6e-172
AXS09674.1|3184116_3185367_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	5.7e-19
3184220:3184280	attR	GCGCCTTCCATGCCTTTGACGATCAGGTCTGCGGCTTCGAACCACTGCATGTGGCGCAGCA	NA	NA	NA	NA
AXS09675.1|3185607_3186258_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AXS09676.1|3186274_3186733_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXS11637.1|3186789_3187896_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AXS09677.1|3187950_3188592_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AXS09678.1|3188595_3189966_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.2e-107
AXS09679.1|3190020_3190383_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AXS09680.1|3190466_3191273_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXS09681.1|3191555_3192227_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AXS09682.1|3192226_3193693_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AXS09683.1|3193778_3194900_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXS09684.1|3195037_3195529_-|transposase	transposase	transposase	NA	NA	NA	NA
AXS09685.1|3195613_3196977_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 7
CP031814	Klebsiella pneumoniae strain KSB1_7F-sc-2280268 chromosome, complete genome	5276478	3417107	3507349	5276478	head,transposase,lysis,plate,protease,portal,tRNA,capsid,integrase,tail	Salmonella_phage(52.54%)	90	3473522:3473542	3507686:3507706
AXS09876.1|3417107_3418400_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AXS09877.1|3418490_3419834_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AXS09878.1|3419842_3420454_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXS09879.1|3420576_3424830_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AXS09880.1|3424965_3425460_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AXS09881.1|3425965_3426961_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
AXS09882.1|3427075_3428842_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AXS09883.1|3428842_3430564_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AXS09884.1|3430608_3431310_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXS09885.1|3431663_3431882_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXS09886.1|3432001_3434281_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXS09887.1|3434311_3434629_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXS09888.1|3434954_3435176_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXS09889.1|3435109_3435313_-	hypothetical protein	NA	NA	NA	NA	NA
AXS09890.1|3435252_3437193_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AXS09891.1|3437189_3438305_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AXS09892.1|3438451_3440110_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AXS09893.1|3442117_3443017_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AXS11650.1|3443160_3444813_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AXS09894.1|3444823_3445792_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AXS09895.1|3445999_3446434_-	DoxX family protein	NA	NA	NA	NA	NA
AXS11651.1|3446585_3448304_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AXS09896.1|3448342_3449344_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AXS09897.1|3449354_3450797_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXS09898.1|3450884_3451898_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXS09899.1|3451894_3452725_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AXS09900.1|3452756_3453896_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXS09901.1|3453948_3454128_+	hypothetical protein	NA	NA	NA	NA	NA
AXS09902.1|3454773_3455289_+	lipoprotein	NA	NA	NA	NA	NA
AXS09903.1|3455515_3456244_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.6e-29
AXS09904.1|3457009_3457726_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AXS09905.1|3457725_3458394_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AXS09906.1|3458577_3459309_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXS09907.1|3459393_3460866_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AXS09908.1|3460862_3461579_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AXS09909.1|3461657_3462785_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AXS09910.1|3462826_3463315_-	DUF2593 family protein	NA	NA	NA	NA	NA
AXS09911.1|3463372_3464218_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AXS09912.1|3464214_3465168_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AXS11652.1|3465178_3466312_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AXS09913.1|3466475_3467588_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AXS09914.1|3467936_3468416_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AXS09915.1|3468504_3469407_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AXS09916.1|3469521_3470244_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AXS09917.1|3470227_3470515_-	DUF1418 family protein	NA	NA	NA	NA	NA
AXS09918.1|3470717_3470981_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AXS09919.1|3470987_3471371_-	hypothetical protein	NA	NA	NA	NA	NA
AXS11653.1|3471637_3473323_+	transporter	NA	NA	NA	NA	NA
3473522:3473542	attL	TGGCGACAAAGTGGCGGCAGC	NA	NA	NA	NA
AXS11654.1|3473543_3473762_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	67.6	4.9e-19
AXS09920.1|3473849_3474947_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.0	7.4e-172
AXS09921.1|3474943_3475429_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
AXS09922.1|3475425_3478053_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.4	2.3e-118
AXS09923.1|3478045_3478165_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AXS09924.1|3478179_3478479_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
AXS09925.1|3478531_3479047_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	86.5	7.4e-82
AXS09926.1|3479056_3480229_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	8.6e-211
AXS09927.1|3480367_3481534_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	48.0	6.9e-43
AXS09928.1|3481549_3481816_-	hypothetical protein	NA	K4MPX1	Escherichia_phage	54.2	6.6e-18
AXS11655.1|3481822_3483247_-	hypothetical protein	NA	K4MM73	Escherichia_phage	60.4	1.3e-171
AXS09929.1|3484801_3485710_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.2	3.4e-106
AXS09930.1|3485696_3486059_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
AXS09931.1|3486055_3486628_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	71.7	1.4e-76
AXS09932.1|3486712_3487153_+	hypothetical protein	NA	NA	NA	NA	NA
AXS09933.1|3487158_3487602_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	76.4	1.6e-53
AXS09934.1|3487594_3488026_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	81.8	9.9e-64
AXS09935.1|3487988_3488192_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	5.2e-23
AXS09936.1|3488121_3488550_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	4.3e-51
AXS09937.1|3488554_3489064_-	lysozyme	NA	E5G6N1	Salmonella_phage	84.0	3.3e-82
AXS09938.1|3489044_3489260_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	87.3	3.0e-29
AXS09939.1|3489263_3489467_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AXS09940.1|3489466_3489931_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	1.3e-74
AXS09941.1|3490027_3490678_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	86.6	9.6e-103
AXS09942.1|3490681_3491746_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.3	4.3e-185
AXS09943.1|3491762_3492596_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.2	3.3e-100
AXS09944.1|3492736_3494500_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	93.0	0.0e+00
AXS09945.1|3494499_3495522_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.4	2.1e-176
AXS09946.1|3496222_3497455_-	ATP-binding protein	NA	NA	NA	NA	NA
AXS09947.1|3497732_3497918_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.2	7.3e-08
AXS09948.1|3498033_3500418_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	92.9	0.0e+00
AXS09949.1|3500414_3501272_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	6.0e-161
AXS09950.1|3501268_3501496_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AXS09951.1|3501495_3501672_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.6	5.5e-21
AXS09952.1|3501764_3502688_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	2.1e-172
AXS09953.1|3502862_3503204_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	2.3e-55
AXS09954.1|3503167_3503368_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
AXS09955.1|3503375_3503885_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	99.4	2.0e-87
AXS09956.1|3503949_3504153_-	regulator	NA	P79674	Haemophilus_phage	41.9	6.4e-05
AXS11656.1|3504298_3504874_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	42.5	2.8e-37
AXS09957.1|3504905_3506237_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.6	7.9e-19
AXS09958.1|3506317_3507349_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	3.3e-105
3507686:3507706	attR	TGGCGACAAAGTGGCGGCAGC	NA	NA	NA	NA
>prophage 1
CP031815	Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence	139276	22670	53043	139276	transposase	Enterobacteria_phage(28.57%)	22	NA	NA
AXS11831.1|22670_23594_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	4.0e-171
AXS11747.1|23828_25562_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
AXS11748.1|25569_26517_-	acetamidase	NA	A0A1V0S8X7	Catovirus	23.0	3.3e-11
AXS11749.1|26561_28166_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXS11750.1|28178_29099_-	ABC transporter permease	NA	NA	NA	NA	NA
AXS11751.1|29098_29947_-	ABC transporter permease	NA	NA	NA	NA	NA
AXS11752.1|29943_30537_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
AXS11753.1|30533_31661_-	regulator	NA	NA	NA	NA	NA
AXS11754.1|32055_32979_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	1.6e-175
AXS11755.1|34851_35987_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	3.8e-46
AXS11756.1|36819_37224_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXS11757.1|37455_37728_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXS11758.1|37724_39296_-	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AXS11759.1|39342_40440_-	chemotaxis protein	NA	NA	NA	NA	NA
AXS11760.1|40896_42107_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	78.1	1.2e-135
AXS11761.1|42225_43257_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AXS11762.1|43518_44307_-	hypothetical protein	NA	NA	NA	NA	NA
AXS11763.1|44306_44771_-	hypothetical protein	NA	NA	NA	NA	NA
AXS11832.1|45803_47669_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AXS11833.1|48586_48670_+	helicase subunit	NA	NA	NA	NA	NA
AXS11764.1|50823_51021_+	hypothetical protein	NA	NA	NA	NA	NA
AXS11765.1|52119_53043_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	6.6e-166
>prophage 2
CP031815	Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence	139276	130709	138547	139276	transposase	Stx2-converting_phage(33.33%)	6	NA	NA
AXS11821.1|130709_131938_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	79.1	7.5e-141
AXS11822.1|131984_133577_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	6.1e-175
AXS11823.1|133607_133958_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	1.2e-38
AXS11824.1|133954_134395_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	59.0	1.3e-18
AXS11825.1|136409_137381_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
AXS11826.1|137380_138547_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
