The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031800	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 chromosome, complete genome	5509899	67517	154887	5509899	terminase,portal,integrase,tRNA,head,tail,protease,capsid,holin	Klebsiella_phage(18.87%)	94	90523:90546	132134:132157
AXS17091.1|67517_68936_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AXS17092.1|68987_69380_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17093.1|69383_69737_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17094.1|70358_72530_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AXS17095.1|72578_73781_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AXS17096.1|74127_75369_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AXS17097.1|75426_75786_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AXS17098.1|75916_76909_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
AXS22074.1|77089_78751_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
AXS17099.1|78747_79983_-	ion channel protein	NA	NA	NA	NA	NA
AXS17100.1|80246_81212_+	glucokinase	NA	NA	NA	NA	NA
AXS22075.1|81265_82003_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
AXS17101.1|82014_83712_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
AXS17102.1|83820_84006_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
AXS17103.1|84094_85309_+	alanine transaminase	NA	NA	NA	NA	NA
AXS22076.1|85379_85451_-	membrane protein YpdK	NA	NA	NA	NA	NA
AXS17104.1|85787_86984_-	cyanate transporter	NA	NA	NA	NA	NA
AXS17105.1|86980_87439_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	4.2e-12
AXS17106.1|87571_88480_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.8	1.0e-09
AXS17107.1|88489_89371_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
AXS17108.1|89739_90222_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
90523:90546	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AXS17109.1|90740_91910_+	DUF4102 domain-containing protein	NA	A0A2R2Z2Y0	Escherichia_phage	86.3	2.5e-202
AXS17110.1|91942_92881_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	28.8	9.9e-08
AXS17111.1|92896_93082_-	DNA-binding protein	NA	G3CFG7	Escherichia_phage	61.4	2.4e-14
AXS17112.1|93964_94252_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17113.1|94244_94469_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.8	1.8e-13
AXS17114.1|94465_94594_-|integrase	integrase	integrase	NA	NA	NA	NA
AXS17115.1|94783_95644_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	52.7	5.2e-72
AXS17116.1|95725_96538_-	DUF2303 family protein	NA	NA	NA	NA	NA
AXS17117.1|96579_96939_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17118.1|97860_98571_-	LexA family transcriptional regulator	NA	K7P8B2	Enterobacteria_phage	67.5	4.0e-86
AXS17119.1|98678_98873_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	79.4	3.6e-21
AXS17120.1|98950_99466_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	64.0	3.0e-59
AXS17121.1|99504_99783_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17122.1|99944_100220_+	hypothetical protein	NA	A0A1P8VVT6	Streptococcus_phage	42.3	8.7e-05
AXS17123.1|100212_101742_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	1.9e-202
AXS17124.1|101738_102710_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.1	1.6e-109
AXS22077.1|102679_103324_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
AXS17125.1|103320_103965_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	67.8	3.4e-84
AXS17126.1|103954_104359_+	antitermination protein	NA	S5M7R9	Escherichia_phage	54.0	5.5e-32
AXS17127.1|104568_104955_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
AXS17128.1|104941_105223_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
AXS17129.1|105222_105852_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.4	9.3e-87
AXS17130.1|105854_106130_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	68.9	8.3e-24
AXS17131.1|106080_106272_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	93.2	8.9e-25
AXS17132.1|106303_106504_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	65.1	7.9e-16
AXS17133.1|106568_106814_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	63.0	6.1e-18
AXS17134.1|106875_107226_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.0	2.7e-51
AXS17135.1|107384_107882_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	71.3	7.4e-63
AXS17136.1|107885_109637_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.0	3.3e-251
AXS17137.1|109784_111011_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	2.5e-208
AXS17138.1|111003_111603_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
AXS17139.1|111612_112851_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	67.0	3.9e-153
AXS17140.1|112928_113246_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	7.4e-24
AXS17141.1|113254_113593_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	6.6e-39
AXS17142.1|113589_114039_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
AXS17143.1|114035_114383_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
AXS17144.1|114439_115144_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.5	1.6e-79
AXS17145.1|115174_115579_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
AXS17146.1|115581_115887_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
AXS17147.1|115960_116194_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
AXS17148.1|116254_119641_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.6	1.1e-301
AXS17149.1|119662_120136_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
AXS17150.1|120122_120599_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	63.9	3.4e-49
AXS17151.1|120611_120992_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	81.0	2.5e-58
AXS17152.1|120988_124066_+	kinase	NA	A0A286S259	Klebsiella_phage	62.1	0.0e+00
AXS17153.1|125934_126780_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17154.1|126882_127629_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17155.1|127643_129407_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	85.0	2.3e-50
AXS17156.1|129497_130046_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	96.7	3.2e-91
AXS17157.1|130617_131094_-	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	40.7	1.2e-22
AXS17158.1|131471_131711_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	6.8e-22
AXS17159.1|131667_132039_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	1.2e-25
AXS17160.1|132245_133175_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.4	5.2e-134
132134:132157	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AXS17161.1|133464_134226_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AXS17162.1|134287_135616_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AXS17163.1|135983_136268_+	DUF406 family protein	NA	NA	NA	NA	NA
AXS17164.1|136427_137738_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AXS17165.1|137737_139882_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AXS17166.1|140091_140577_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AXS17167.1|140597_141149_-	endonuclease SmrB	NA	NA	NA	NA	NA
AXS17168.1|141316_142249_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXS17169.1|142290_143376_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
AXS17170.1|143378_144203_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AXS17171.1|144202_145012_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17172.1|145011_145560_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AXS17173.1|145591_145873_+	YfcL family protein	NA	NA	NA	NA	NA
AXS22078.1|145934_147923_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AXS17174.1|148081_149302_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AXS17175.1|149511_150687_+	arabinose transporter	NA	NA	NA	NA	NA
AXS17176.1|150773_151751_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AXS17177.1|151861_152998_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
AXS17178.1|153061_154075_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXS17179.1|154074_154887_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 2
CP031800	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 chromosome, complete genome	5509899	249068	257353	5509899	tRNA	Pectobacterium_phage(33.33%)	6	NA	NA
AXS22080.1|249068_249314_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	46.5	2.7e-10
AXS17261.1|249453_249963_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	41.8	6.1e-20
AXS17262.1|250026_250326_-	hypothetical protein	NA	A0A2H4JEE3	uncultured_Caudovirales_phage	40.3	7.4e-10
AXS22081.1|250754_253070_+	lytic transglycosylase domain-containing protein	NA	A0A193GYI3	Enterobacter_phage	35.1	1.6e-107
AXS17263.1|253066_254875_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	71.3	5.2e-239
AXS17264.1|254878_257353_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	86.4	0.0e+00
>prophage 3
CP031800	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 chromosome, complete genome	5509899	370835	377740	5509899		Planktothrix_phage(33.33%)	6	NA	NA
AXS22088.1|370835_371699_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AXS17363.1|371709_372483_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	6.6e-26
AXS22089.1|372723_373617_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AXS17364.1|373862_375224_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.5	1.1e-206
AXS17365.1|375542_376265_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AXS17366.1|376261_377740_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
CP031800	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 chromosome, complete genome	5509899	421084	434401	5509899		Enterobacteria_phage(22.22%)	11	NA	NA
AXS17395.1|421084_422491_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AXS17396.1|422717_424133_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AXS17397.1|424154_425525_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
AXS22092.1|425679_426744_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
AXS17398.1|426757_427627_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	1.3e-110
AXS17399.1|427658_428549_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AXS17400.1|428563_429118_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
AXS17401.1|429297_430464_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AXS22093.1|432078_432183_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17402.1|433133_433328_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17403.1|433396_434401_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 5
CP031800	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 chromosome, complete genome	5509899	610177	619695	5509899	integrase	Pectobacterium_phage(58.33%)	14	609359:609374	622919:622934
609359:609374	attL	GTGAGATCATTATCTC	NA	NA	NA	NA
AXS17550.1|610177_611194_-|integrase	integrase	integrase	H9C152	Pectobacterium_phage	64.5	3.9e-127
AXS17551.1|611177_611423_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	44.3	1.3e-07
AXS17552.1|611358_611583_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	62.0	3.5e-12
AXS17553.1|611632_611818_-	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	3.6e-07
AXS17554.1|611819_612386_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	63.0	1.5e-51
AXS17555.1|612385_614527_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.9	1.6e-98
AXS17556.1|614556_614802_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	59.5	6.3e-15
AXS22106.1|614809_615043_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17557.1|615766_616222_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	55.0	4.1e-36
AXS17558.1|616330_616564_+	XRE family transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
AXS17559.1|616626_617073_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.7e-26
AXS22107.1|617156_617315_+	adenylate cyclase	NA	NA	NA	NA	NA
AXS17560.1|617317_618310_+	replication protein RepO	NA	A0A067ZIA1	Vibrio_phage	52.3	6.9e-28
AXS17561.1|618306_619695_+	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	47.5	1.5e-105
622919:622934	attR	GTGAGATCATTATCTC	NA	NA	NA	NA
>prophage 6
CP031800	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 chromosome, complete genome	5509899	623392	646295	5509899	transposase,tail,holin	uncultured_Caudovirales_phage(50.0%)	25	NA	NA
AXS17568.1|623392_623986_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.1	4.7e-80
AXS17569.1|624055_625024_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	8.5e-172
AXS22109.1|625062_625365_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.6	2.8e-25
AXS17570.1|625520_625817_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17571.1|625844_626285_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17572.1|626295_626517_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17573.1|626520_628146_+|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	59.7	6.8e-174
AXS17574.1|628142_628376_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17575.1|628362_629211_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	42.5	5.3e-45
AXS17576.1|629410_629617_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17577.1|629761_630667_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	39.2	2.8e-44
AXS17578.1|630726_631290_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	49.2	1.0e-47
AXS17579.1|631289_633281_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.0	4.7e-185
AXS17580.1|633280_633733_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	43.6	1.5e-22
AXS17581.1|633735_634224_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	48.3	7.9e-09
AXS17582.1|634229_636944_+	lytic transglycosylase	NA	G9L6D3	Escherichia_phage	58.8	7.4e-290
AXS17583.1|636943_639823_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	68.4	0.0e+00
AXS17584.1|639865_640192_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17585.1|640264_640612_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	47.8	1.0e-18
AXS17586.1|640608_642219_+	transcriptional regulator	NA	A0A2H4JCA3	uncultured_Caudovirales_phage	69.9	1.8e-222
AXS17587.1|642237_644880_+	hypothetical protein	NA	A0A1I9SEI8	Klebsiella_phage	41.8	1.2e-140
AXS17588.1|644892_645096_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17589.1|645194_645419_+|holin	holin	holin	A5LH82	Enterobacteria_phage	71.6	4.1e-21
AXS17590.1|645402_645939_+	lysozyme	NA	H6WRZ4	Salmonella_phage	76.1	1.4e-78
AXS17591.1|645935_646295_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	43.1	1.1e-15
>prophage 7
CP031800	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 chromosome, complete genome	5509899	670780	719663	5509899	head	Salmonella_phage(27.78%)	71	NA	NA
AXS17617.1|670780_671524_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
AXS17618.1|671563_671959_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17619.1|672786_674046_-	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	89.9	2.3e-225
AXS17620.1|674088_674334_-	excisionase	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
AXS17621.1|674337_674556_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
AXS17622.1|674552_674744_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
AXS17623.1|674740_675358_-	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	47.0	7.8e-38
AXS17624.1|675243_675465_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22110.1|675461_675989_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	59.8	1.2e-55
AXS17625.1|676017_676641_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.7	1.2e-57
AXS17626.1|676637_677384_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	67.7	3.1e-65
AXS17627.1|677400_677685_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	61.7	5.2e-29
AXS17628.1|677765_677972_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
AXS17629.1|678588_678792_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	70.1	2.3e-18
AXS17630.1|678828_679710_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17631.1|679696_680461_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17632.1|680585_680705_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17633.1|680727_681417_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
AXS17634.1|681521_681755_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
AXS17635.1|681794_682016_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AXS22111.1|682149_682878_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
AXS17636.1|682874_683651_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.0	1.1e-94
AXS17637.1|683650_683953_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXS17638.1|683949_684417_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	32.5	9.2e-07
AXS17639.1|684413_684674_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
AXS17640.1|685166_685460_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
AXS22112.1|685567_686128_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	30.3	2.7e-05
AXS17641.1|686127_686376_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17642.1|686541_686862_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17643.1|687216_687684_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	9.8e-33
AXS17644.1|687664_687835_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	3.3e-15
AXS17645.1|687827_688463_+	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.9	9.1e-82
AXS17646.1|688459_688600_+	YlcG family protein	NA	NA	NA	NA	NA
AXS17647.1|688596_689097_+	antiterminator	NA	G8C7V7	Escherichia_phage	91.5	5.7e-87
AXS17648.1|689490_689706_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17649.1|689830_690145_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	4.9e-44
AXS17650.1|690147_690642_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	90.2	2.0e-84
AXS17651.1|690638_690989_+	hypothetical protein	NA	H2EQH5	Salmonella_phage	36.2	8.7e-10
AXS17652.1|691436_691655_-	hypothetical protein	NA	NA	NA	NA	NA
AXS17653.1|691780_692416_+	hypothetical protein	NA	I6S676	Salmonella_phage	79.7	3.3e-100
AXS17654.1|692446_692926_+	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	74.8	1.4e-63
AXS17655.1|692912_694397_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	86.4	2.2e-256
AXS17656.1|694458_694725_+	hypothetical protein	NA	Q5G8Y6	Enterobacteria_phage	77.3	3.0e-34
AXS17657.1|694794_696144_+	DUF1073 domain-containing protein	NA	Q5G8Y4	Enterobacteria_phage	90.2	7.8e-240
AXS17658.1|696103_697030_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	91.6	3.4e-162
AXS17659.1|697032_698298_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	90.7	1.4e-219
AXS17660.1|698310_698760_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	85.9	2.5e-65
AXS17661.1|698777_699854_+	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	87.4	1.7e-184
AXS17662.1|699863_700157_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	87.6	3.6e-41
AXS17663.1|700223_700625_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	74.6	3.6e-52
AXS17664.1|700624_700795_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	50.0	3.4e-12
AXS17665.1|700798_701182_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17666.1|701178_701541_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	48.3	1.3e-19
AXS17667.1|701543_701912_+	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	83.6	1.0e-48
AXS17668.1|701908_702292_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17669.1|703182_703878_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	9.4e-64
AXS17670.1|704070_704874_-	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	37.3	1.9e-20
AXS17671.1|705127_705841_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	40.3	5.3e-38
AXS17672.1|705910_706663_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	53.9	1.2e-59
AXS17673.1|706817_707177_+	hypothetical protein	NA	A0A1V0E5N7	Salmonella_phage	54.2	6.8e-34
AXS17674.1|707256_707469_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	58.8	1.0e-13
AXS17675.1|707543_708572_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17676.1|708637_712054_+	hypothetical protein	NA	R9TMK1	Aeromonas_phage	48.0	4.5e-191
AXS17677.1|712094_712274_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AXS17678.1|712250_712517_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AXS22113.1|712687_713107_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
AXS17679.1|713106_713577_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
AXS17680.1|713573_713969_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	55.6	1.2e-36
AXS17681.1|713955_716433_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	1.8e-197
AXS17682.1|718518_719319_+	hypothetical protein	NA	NA	NA	NA	NA
AXS17683.1|719423_719663_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	3.8e-17
>prophage 8
CP031800	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 chromosome, complete genome	5509899	1538802	1548978	5509899	transposase	Escherichia_phage(77.78%)	10	NA	NA
AXS18450.1|1538802_1539891_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AXS18451.1|1539977_1540238_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AXS18452.1|1540662_1541925_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AXS18453.1|1542180_1543056_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AXS18454.1|1543102_1543435_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AXS22146.1|1544282_1545143_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AXS18455.1|1545163_1545925_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXS18456.1|1546185_1547088_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AXS18457.1|1547099_1548365_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
AXS18458.1|1548357_1548978_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 9
CP031800	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 chromosome, complete genome	5509899	1942847	2015812	5509899	terminase,portal,integrase,tRNA,tail,protease,holin	Klebsiella_phage(22.0%)	92	1969664:1969678	2016152:2016166
AXS18812.1|1942847_1943348_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AXS18813.1|1943464_1943911_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AXS22162.1|1943894_1944686_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXS18814.1|1944787_1945972_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AXS18815.1|1946003_1946696_-	hypothetical protein	NA	NA	NA	NA	NA
AXS18816.1|1946841_1947351_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AXS18817.1|1947337_1947694_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AXS18818.1|1947683_1947923_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AXS18819.1|1948223_1949237_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.8	1.1e-12
AXS18820.1|1949294_1949396_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22163.1|1949395_1949470_+	protein YoaJ	NA	NA	NA	NA	NA
AXS18821.1|1949587_1949713_+	hypothetical protein	NA	NA	NA	NA	NA
AXS18822.1|1949772_1950036_-	DUF2534 family protein	NA	NA	NA	NA	NA
AXS18823.1|1950166_1950805_-	leucine efflux protein	NA	NA	NA	NA	NA
AXS18824.1|1950894_1951809_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AXS18825.1|1952024_1952216_+	hypothetical protein	NA	NA	NA	NA	NA
AXS18826.1|1952470_1953514_-	type II asparaginase	NA	NA	NA	NA	NA
AXS18827.1|1953816_1955025_+	HD domain-containing protein	NA	NA	NA	NA	NA
AXS18828.1|1955098_1956883_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AXS18829.1|1956889_1957780_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXS18830.1|1957900_1959409_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
AXS18831.1|1959719_1960406_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AXS18832.1|1960804_1960984_-	hypothetical protein	NA	NA	NA	NA	NA
AXS18833.1|1961023_1961656_-	DNA-binding protein	NA	NA	NA	NA	NA
AXS18834.1|1962222_1962420_+	hypothetical protein	NA	NA	NA	NA	NA
AXS18835.1|1962535_1963546_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AXS18836.1|1963542_1964949_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXS18837.1|1965004_1965892_-	manganese catalase family protein	NA	NA	NA	NA	NA
AXS18838.1|1965908_1966415_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXS18839.1|1966441_1966936_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AXS18840.1|1967026_1967212_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AXS18841.1|1967834_1969028_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AXS18842.1|1969140_1969368_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AXS18843.1|1969388_1969574_-	hypothetical protein	NA	NA	NA	NA	NA
1969664:1969678	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
AXS18844.1|1969817_1970141_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AXS18845.1|1970133_1970526_+	amino acid-binding protein	NA	NA	NA	NA	NA
AXS18846.1|1970522_1971236_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXS18847.1|1971508_1971661_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AXS18848.1|1971869_1972670_+	hypothetical protein	NA	NA	NA	NA	NA
AXS18849.1|1973705_1975412_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22164.1|1975608_1975902_-	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	80.0	3.9e-27
AXS18850.1|1976744_1977167_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	43.8	1.2e-24
AXS18851.1|1977244_1977427_-	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	87.0	1.8e-19
AXS18852.1|1977437_1978238_-	hypothetical protein	NA	NA	NA	NA	NA
AXS18853.1|1980281_1983350_-	kinase	NA	A0A286S259	Klebsiella_phage	66.3	0.0e+00
AXS18854.1|1983346_1983733_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	50.8	4.7e-33
AXS18855.1|1983740_1984223_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
AXS18856.1|1984209_1984683_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	3.9e-53
AXS18857.1|1984682_1987379_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.6	2.2e-201
AXS18858.1|1987359_1987677_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
AXS18859.1|1987697_1988093_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
AXS18860.1|1988135_1988618_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
AXS18861.1|1988625_1989024_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
AXS18862.1|1989020_1989572_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.6e-53
AXS18863.1|1989561_1989855_-	ATP-binding protein	NA	NA	NA	NA	NA
AXS18864.1|1989847_1990174_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	4.0e-33
AXS18865.1|1990254_1992270_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.6	0.0e+00
AXS18866.1|1992214_1993714_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.2	1.9e-247
AXS18867.1|1993710_1993926_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
AXS18868.1|1993922_1996031_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.2	0.0e+00
AXS18869.1|1996030_1996522_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
AXS18870.1|1996843_1997029_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	1.9e-11
AXS22165.1|1997094_1997355_-	hypothetical protein	NA	NA	NA	NA	NA
AXS18871.1|1997580_1997826_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	95.1	3.9e-33
AXS18872.1|1998639_1998834_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	90.6	1.1e-25
AXS18873.1|1998784_1999060_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	60.7	7.3e-20
AXS18874.1|1999056_1999401_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
AXS18875.1|1999397_1999937_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
AXS18876.1|1999933_2000245_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.5e-48
AXS18877.1|2000845_2001292_+	hypothetical protein	NA	NA	NA	NA	NA
AXS18878.1|2001197_2001455_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	2.8e-42
AXS18879.1|2001767_2002346_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
AXS18880.1|2002359_2003340_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.9e-134
AXS18881.1|2003352_2003730_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
AXS18882.1|2003739_2004549_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	5.9e-110
AXS18883.1|2004545_2005499_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	75.5	3.7e-103
AXS18884.1|2005488_2005668_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
AXS18885.1|2005905_2006367_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AXS18886.1|2006401_2006644_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
AXS18887.1|2006741_2007437_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.7	3.2e-88
AXS18888.1|2007738_2008098_+	hypothetical protein	NA	NA	NA	NA	NA
AXS18889.1|2008307_2009225_+	hypothetical protein	NA	A0A1W6JP69	Morganella_phage	36.5	8.9e-46
AXS18890.1|2009314_2009614_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	1.1e-13
AXS18891.1|2009613_2010399_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	2.2e-61
AXS18892.1|2011086_2011347_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.0	7.4e-30
AXS18893.1|2011343_2011550_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	1.1e-31
AXS18894.1|2012201_2012570_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	55.2	1.1e-18
AXS18895.1|2012562_2012781_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.7e-09
AXS18896.1|2012780_2013053_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	4.4e-09
AXS18897.1|2013081_2013318_+	excisionase	NA	NA	NA	NA	NA
AXS18898.1|2013307_2014450_+|integrase	integrase	integrase	Q77Z02	Phage_21	81.9	5.9e-172
AXS18899.1|2014561_2015812_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
2016152:2016166	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
>prophage 10
CP031800	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 chromosome, complete genome	5509899	2191448	2315024	5509899	terminase,portal,integrase,tRNA,tail,plate,head,protease,capsid,lysis,holin	Escherichia_phage(46.38%)	120	2202793:2202809	2296448:2296464
AXS19062.1|2191448_2193206_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AXS19063.1|2193275_2193794_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AXS19064.1|2193862_2194030_-	ribosome modulation factor	NA	NA	NA	NA	NA
AXS22173.1|2193991_2194210_+	hypothetical protein	NA	NA	NA	NA	NA
AXS19065.1|2194283_2194847_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AXS19066.1|2194846_2196484_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AXS19067.1|2196473_2197742_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AXS19068.1|2197756_2199664_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.2e-49
AXS19069.1|2199676_2201782_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AXS19070.1|2201881_2202991_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
2202793:2202809	attL	CCAGCAGGTGCTGCTGG	NA	NA	NA	NA
AXS19071.1|2202987_2203530_-	cell division protein ZapC	NA	NA	NA	NA	NA
AXS19072.1|2203699_2204710_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AXS19073.1|2204959_2205535_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AXS19074.1|2205527_2206490_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXS19075.1|2206486_2207632_+	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AXS19076.1|2207642_2208434_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
AXS19077.1|2208430_2209204_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
AXS19078.1|2209408_2212024_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
AXS19079.1|2212350_2213553_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
AXS19080.1|2213595_2214762_-	amidohydrolase	NA	NA	NA	NA	NA
AXS19081.1|2214780_2216019_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AXS19082.1|2216043_2217333_-	septum formation initiator	NA	NA	NA	NA	NA
AXS19083.1|2217455_2218667_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
AXS22174.1|2218978_2219440_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXS19084.1|2219615_2221016_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
AXS19085.1|2221607_2222687_+	porin OmpK35	NA	Q1MVN1	Enterobacteria_phage	53.0	1.9e-100
AXS19086.1|2222874_2224065_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AXS19087.1|2224133_2224781_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXS22175.1|2224794_2225346_-	DUF882 domain-containing protein	NA	NA	NA	NA	NA
AXS19088.1|2225496_2225712_+	hypothetical protein	NA	NA	NA	NA	NA
AXS19089.1|2225648_2227439_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AXS19090.1|2227639_2232088_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
AXS19091.1|2232087_2232792_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
AXS19092.1|2232772_2234095_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AXS19093.1|2234091_2234892_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AXS19094.1|2235013_2235793_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AXS19095.1|2235769_2236663_-	hypothetical protein	NA	NA	NA	NA	NA
AXS19096.1|2236800_2237547_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AXS19097.1|2237543_2237726_-	protein YcaR	NA	NA	NA	NA	NA
AXS19098.1|2237789_2239019_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXS19099.1|2239073_2240054_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AXS19100.1|2240050_2241799_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
AXS19101.1|2241835_2244094_-	ComEC family protein	NA	NA	NA	NA	NA
AXS19102.1|2244299_2244587_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
AXS19103.1|2244738_2246412_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AXS19104.1|2246545_2247229_-	cytidylate kinase	NA	NA	NA	NA	NA
AXS19105.1|2247403_2248687_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AXS19106.1|2248760_2249849_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
AXS19107.1|2250037_2250730_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AXS22176.1|2250845_2252606_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AXS19108.1|2252991_2253849_+	formate transporter FocA	NA	NA	NA	NA	NA
AXS19109.1|2253900_2256183_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
AXS19110.1|2256502_2256757_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AXS19111.1|2256802_2257966_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	6.3e-206
AXS19112.1|2257965_2258445_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
AXS19113.1|2258459_2260907_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.6	0.0e+00
AXS22177.1|2260899_2261019_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AXS19114.1|2261051_2261327_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AXS19115.1|2261382_2261901_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AXS19116.1|2261913_2263104_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
AXS19117.1|2263163_2263757_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	4.6e-104
AXS22178.1|2263787_2264330_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	61.4	8.7e-49
AXS19118.1|2264329_2264932_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	87.5	1.1e-95
AXS19119.1|2264903_2265344_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	67.3	1.7e-50
AXS19120.1|2265346_2266531_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	80.3	4.0e-163
AXS19121.1|2266527_2267139_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.4e-116
AXS19122.1|2267131_2268040_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
AXS19123.1|2268044_2268392_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AXS19124.1|2268388_2269024_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	3.0e-109
AXS19125.1|2269090_2269543_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
AXS19126.1|2269535_2270003_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
AXS19127.1|2269965_2270139_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AXS19128.1|2270110_2270536_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	95.0	3.0e-65
AXS19129.1|2270520_2270949_-	protein lysA	NA	A0A0F7LDU9	Escherichia_phage	96.5	1.5e-59
AXS19130.1|2270963_2271461_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
AXS19131.1|2271460_2271742_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AXS19132.1|2271745_2271949_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	98.5	8.8e-31
AXS19133.1|2271948_2272458_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AXS19134.1|2272557_2273301_-|terminase	terminase	terminase	U5N091	Enterobacteria_phage	98.4	1.7e-124
AXS19135.1|2273304_2274378_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
AXS19136.1|2274436_2275291_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
AXS19137.1|2275464_2277237_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AXS19138.1|2277236_2278271_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
AXS19139.1|2278483_2278753_+	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
AXS19140.1|2278976_2279414_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
AXS19141.1|2279538_2280489_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
AXS19142.1|2280466_2280775_-	XRE family transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
AXS19143.1|2280811_2281105_-	hypothetical protein	NA	NA	NA	NA	NA
AXS19144.1|2281375_2283664_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
AXS19145.1|2283653_2283929_-	hypothetical protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
AXS19146.1|2283925_2284150_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
AXS19147.1|2284149_2284452_-	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	99.0	5.9e-47
AXS19148.1|2284451_2284676_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AXS19149.1|2284740_2285241_-	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AXS19150.1|2285237_2285435_-	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	100.0	2.8e-29
AXS19151.1|2285418_2285775_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
AXS22179.1|2285879_2286191_+	XRE family transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
AXS19152.1|2286284_2287280_+|integrase	site-specific integrase	integrase	A0A0F7LA05	Escherichia_phage	100.0	7.1e-190
AXS19153.1|2287311_2288109_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	2.3e-21
AXS19154.1|2288271_2289420_-	MFS transporter	NA	NA	NA	NA	NA
AXS19155.1|2289536_2289683_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AXS19156.1|2289694_2290558_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AXS19157.1|2290559_2291177_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
AXS19158.1|2291187_2293626_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
AXS19159.1|2293826_2295119_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AXS19160.1|2295209_2296553_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
2296448:2296464	attR	CCAGCAGGTGCTGCTGG	NA	NA	NA	NA
AXS19161.1|2296561_2297173_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXS19162.1|2297295_2301549_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AXS19163.1|2301684_2302179_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AXS19164.1|2302684_2303680_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
AXS19165.1|2303794_2305561_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	26.2	1.0e-21
AXS19166.1|2305561_2307283_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	9.0e-15
AXS19167.1|2307327_2308029_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXS19168.1|2308382_2308601_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXS19169.1|2308720_2311000_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXS19170.1|2311030_2311348_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXS19171.1|2311673_2311895_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXS19172.1|2311828_2312032_-	hypothetical protein	NA	NA	NA	NA	NA
AXS19173.1|2311971_2313912_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AXS19174.1|2313908_2315024_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 11
CP031800	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 chromosome, complete genome	5509899	3978392	4065066	5509899	terminase,portal,integrase,tRNA,tail,plate,capsid,protease	Enterobacteria_phage(35.9%)	88	3972016:3972034	4066737:4066755
3972016:3972034	attL	CCAGCAGCGCTTCGCGCTG	NA	NA	NA	NA
AXS20626.1|3978392_3979913_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXS20627.1|3979937_3980276_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
AXS20628.1|3980394_3981216_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
AXS20629.1|3987068_3987920_-	glutamate racemase	NA	NA	NA	NA	NA
AXS20630.1|3987864_3989703_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	2.3e-08
AXS20631.1|3990069_3991170_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AXS20632.1|3991221_3991581_-	YijD family membrane protein	NA	NA	NA	NA	NA
AXS20633.1|3991596_3992232_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AXS20634.1|3992428_3993829_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AXS20635.1|3993811_3994729_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
AXS20636.1|3994988_3996362_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AXS22254.1|3996320_3996503_+	hypothetical protein	NA	NA	NA	NA	NA
AXS20637.1|3996461_3997238_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AXS20638.1|3997244_3998249_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AXS20639.1|3998362_3999514_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AXS20640.1|3999772_4002424_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AXS20641.1|4002467_4003118_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AXS20642.1|4003265_4004129_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXS20643.1|4004334_4004997_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	4.6e-28
AXS20644.1|4005051_4006155_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AXS20645.1|4006218_4007100_-	DMT family transporter	NA	NA	NA	NA	NA
AXS20646.1|4007243_4008131_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AXS20647.1|4008359_4009268_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXS20648.1|4009360_4009732_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AXS20649.1|4009769_4011326_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AXS20650.1|4011464_4012601_+	cytoplasmic protein	NA	NA	NA	NA	NA
AXS20651.1|4012575_4015008_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AXS20652.1|4015010_4016171_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AXS20653.1|4016438_4016756_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
AXS20654.1|4016857_4017070_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AXS20655.1|4017322_4019518_+	primosomal protein N'	NA	NA	NA	NA	NA
AXS20656.1|4019668_4020697_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
AXS20657.1|4020790_4021759_+	cell division protein FtsN	NA	NA	NA	NA	NA
AXS20658.1|4021850_4022381_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AXS20659.1|4022390_4023725_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
AXS20660.1|4023794_4024715_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AXS20661.1|4024807_4025293_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AXS20662.1|4025354_4026317_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AXS20663.1|4026513_4027416_-	cation-efflux pump FieF	NA	NA	NA	NA	NA
AXS20664.1|4027669_4028566_-	type VI secretion protein	NA	NA	NA	NA	NA
AXS22255.1|4028570_4028903_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AXS20665.1|4029014_4029263_-	hypothetical protein	NA	NA	NA	NA	NA
AXS20666.1|4029308_4030463_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	74.9	3.2e-165
AXS20667.1|4030614_4031796_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.4	8.0e-156
AXS20668.1|4031796_4032312_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
AXS20669.1|4032363_4032663_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	72.7	2.9e-30
AXS20670.1|4032683_4032836_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	1.5e-11
AXS20671.1|4032825_4035561_+|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	79.4	5.1e-238
AXS20672.1|4035572_4036061_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	60.5	1.7e-51
AXS20673.1|4036157_4037240_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	46.3	8.7e-32
AXS20674.1|4037251_4037980_-	hypothetical protein	NA	NA	NA	NA	NA
AXS20675.1|4037985_4040250_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	41.2	8.2e-109
AXS20676.1|4040251_4040854_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	44.8	1.8e-42
AXS20677.1|4040846_4041746_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.2	6.2e-92
AXS20678.1|4041732_4042101_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	57.4	2.3e-29
AXS20679.1|4042097_4042682_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.4	8.7e-63
AXS20680.1|4042681_4043323_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.3	3.1e-45
AXS20681.1|4043319_4043778_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.8	3.1e-31
AXS20682.1|4043774_4044038_-	peptidase	NA	NA	NA	NA	NA
AXS20683.1|4043922_4044318_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AXS20684.1|4044314_4044866_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	8.9e-33
AXS20685.1|4044862_4045144_-	hypothetical protein	NA	NA	NA	NA	NA
AXS20686.1|4045134_4045335_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	64.6	3.0e-15
AXS20687.1|4045334_4045832_-|capsid	capsid assembly protein	capsid	B9A7B7	Serratia_phage	69.7	2.2e-59
AXS20688.1|4045934_4046795_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	68.4	1.0e-83
AXS20689.1|4046841_4047891_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.9	2.3e-106
AXS20690.1|4047914_4048748_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	8.5e-96
AXS20691.1|4048908_4050630_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	66.5	4.3e-227
AXS20692.1|4050650_4051685_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.9	3.1e-140
AXS20693.1|4052117_4052951_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	83.4	6.7e-133
AXS20694.1|4052947_4053163_-	multidrug ABC transporter ATPase	NA	A0A1J0I2F3	Salmonella_phage	86.2	1.1e-18
AXS22256.1|4053417_4054113_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	70.3	3.4e-90
AXS20695.1|4054216_4054432_-	hypothetical protein	NA	NA	NA	NA	NA
AXS20696.1|4054428_4057056_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.4	3.3e-194
AXS20697.1|4057101_4057329_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	40.6	3.2e-05
AXS20698.1|4057337_4057886_-	3'-5' exoribonuclease	NA	NA	NA	NA	NA
AXS20699.1|4057882_4058107_-	hypothetical protein	NA	NA	NA	NA	NA
AXS20700.1|4058176_4058449_-	hypothetical protein	NA	NA	NA	NA	NA
AXS20701.1|4058463_4058694_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	68.6	1.5e-23
AXS20702.1|4058709_4058928_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	9.6e-07
AXS20703.1|4058954_4059227_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	84.4	1.1e-39
AXS20704.1|4059380_4059674_+	XRE family transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	58.8	7.3e-26
AXS20705.1|4059743_4060724_+|integrase	integrase	integrase	U5N0A8	Enterobacteria_phage	83.6	2.8e-154
AXS20706.1|4060909_4061413_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
AXS20707.1|4061562_4062261_+	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
AXS20708.1|4062257_4063631_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
AXS20709.1|4063698_4064373_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AXS20710.1|4064445_4065066_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
4066737:4066755	attR	CCAGCAGCGCTTCGCGCTG	NA	NA	NA	NA
>prophage 12
CP031800	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 chromosome, complete genome	5509899	4831712	4873452	5509899	transposase,portal,integrase,head,tail,plate,tRNA,capsid,lysis	Salmonella_phage(82.5%)	52	4831608:4831667	4862380:4862445
4831608:4831667	attL	TGATTTTAAAGCTAAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTA	NA	NA	NA	NA
AXS21430.1|4831712_4832798_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	61.3	2.4e-122
AXS21431.1|4832797_4833049_-	hypothetical protein	NA	NA	NA	NA	NA
AXS21432.1|4833051_4833666_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	41.0	1.7e-37
AXS21433.1|4833766_4834003_+	regulator	NA	NA	NA	NA	NA
AXS21434.1|4834037_4834547_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	84.6	5.4e-77
AXS22283.1|4834554_4834755_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	87.7	1.5e-27
AXS21435.1|4834718_4835060_+	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	86.7	1.1e-49
AXS21436.1|4835127_4835361_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	89.6	5.0e-30
AXS21437.1|4835360_4836473_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	71.1	4.3e-111
AXS21438.1|4836453_4838859_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	89.7	0.0e+00
AXS21439.1|4839044_4839233_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	7.9e-26
AXS22284.1|4839246_4839480_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	85.7	2.0e-31
AXS21440.1|4839555_4839813_+	hypothetical protein	NA	NA	NA	NA	NA
AXS21441.1|4840112_4841150_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.6	1.0e-175
AXS21442.1|4841149_4842913_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	93.7	0.0e+00
AXS21443.1|4843053_4843887_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	1.2e-102
AXS21444.1|4843903_4844956_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	88.8	2.7e-171
AXS21445.1|4844959_4845610_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	86.6	9.6e-103
AXS21446.1|4845706_4846171_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.0	2.1e-75
AXS21447.1|4846170_4846374_+|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AXS21448.1|4846377_4846593_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
AXS21449.1|4846573_4847083_+	lysozyme	NA	E5G6N1	Salmonella_phage	84.0	1.2e-81
AXS21450.1|4847087_4847471_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	44.5	9.5e-18
AXS21451.1|4847467_4847896_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	72.8	4.6e-45
AXS21452.1|4847991_4848423_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	5.8e-64
AXS21453.1|4848415_4848862_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.6	1.8e-55
AXS21454.1|4848930_4849503_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	2.7e-77
AXS21455.1|4849499_4849862_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	2.9e-48
AXS21456.1|4849848_4850757_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.5	9.0e-107
AXS21457.1|4850749_4851352_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	60.5	2.5e-57
AXS21458.1|4851353_4853618_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	40.5	4.5e-107
AXS21459.1|4853623_4854367_+	hypothetical protein	NA	NA	NA	NA	NA
AXS21460.1|4854378_4855455_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	48.2	2.5e-31
AXS21461.1|4855593_4856766_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	3.3e-210
AXS21462.1|4856775_4857291_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.6e-81
AXS21463.1|4857343_4857643_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
AXS21464.1|4857657_4857777_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AXS21465.1|4857769_4860397_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.9	1.6e-119
AXS21466.1|4860393_4860879_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
AXS21467.1|4860875_4861973_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.7	2.1e-174
AXS21468.1|4862043_4862262_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AXS21469.1|4862598_4863105_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
4862380:4862445	attR	TGATTTTAAAGCTAAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGTC	NA	NA	NA	NA
AXS21470.1|4863204_4865046_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AXS21471.1|4865264_4867010_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
AXS21472.1|4867121_4867337_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXS21473.1|4867335_4867566_+	hypothetical protein	NA	NA	NA	NA	NA
AXS21474.1|4867574_4868588_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.1e-108
AXS21475.1|4868632_4870240_-	allantoin permease	NA	NA	NA	NA	NA
AXS21476.1|4870393_4871011_-	urease accessory protein UreG	NA	NA	NA	NA	NA
AXS21477.1|4871019_4871694_-	urease accessory protein UreF	NA	NA	NA	NA	NA
AXS21478.1|4871695_4872172_-	urease accessory protein	NA	NA	NA	NA	NA
AXS21479.1|4872447_4873452_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP031801	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence	161308	1707	33742	161308	transposase,integrase,protease	Shigella_phage(18.18%)	30	NA	NA
AXS22304.1|1707_2448_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AXS22305.1|2568_2766_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXS22306.1|3019_3286_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AXS22307.1|3790_4243_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22308.1|4314_7176_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22309.1|7159_7630_+	response regulator	NA	NA	NA	NA	NA
AXS22310.1|7626_8811_+	response regulator	NA	NA	NA	NA	NA
AXS22311.1|9721_10645_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	3.9e-166
AXS22312.1|10937_11480_-	ATPase	NA	A0A219VHB7	Ochrobactrum_phage	55.8	1.2e-21
AXS22313.1|12255_12540_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	47.1	4.7e-14
AXS22314.1|12536_13391_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	53.8	5.7e-79
AXS22315.1|14036_15005_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	8.5e-172
AXS22316.1|15481_16480_+	acyltransferase	NA	M1HUK8	Acanthocystis_turfacea_Chlorella_virus	37.0	2.3e-15
AXS22317.1|16567_16966_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22318.1|17343_17943_-	LysE family translocator	NA	NA	NA	NA	NA
AXS22319.1|18136_18745_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	38.0	4.0e-26
AXS22320.1|18870_19287_-	DoxX family protein	NA	NA	NA	NA	NA
AXS22321.1|19438_20755_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	23.4	3.5e-11
AXS22322.1|21485_22517_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXS22449.1|22561_22774_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22323.1|23101_25237_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22324.1|25711_26122_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22325.1|26200_27205_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXS22326.1|27821_28247_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22327.1|28367_28718_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22328.1|28881_29406_-	AAA family ATPase	NA	A0A097BYE2	Leuconostoc_phage	36.3	5.3e-27
AXS22329.1|29475_30873_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXS22450.1|31144_31759_+	DJ-1 family protein	NA	NA	NA	NA	NA
AXS22330.1|31770_32289_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	37.6	2.4e-24
AXS22331.1|32332_33742_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP031802	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence	128238	18015	49280	128238	integrase,transposase	Salmonella_phage(40.0%)	32	17964:18023	50225:51044
17964:18023	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AXS22495.1|18015_18720_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXS22496.1|19117_19678_-	trimethoprim-resistant dihydrofolate reductase DfrA23	NA	A0A076FMI9	Aureococcus_anophage	29.0	1.6e-05
AXS22610.1|19677_20025_-	hypothetical protein	NA	A0A1V0SB21	Catovirus	39.4	2.6e-06
AXS22497.1|20399_20579_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22498.1|20760_21765_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXS22499.1|21843_24816_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AXS22500.1|24818_25376_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AXS22501.1|25413_25734_-|transposase	transposase	transposase	NA	NA	NA	NA
AXS22502.1|25672_26686_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXS22503.1|26810_28061_-|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	4.2e-171
AXS22504.1|28194_29094_+	class A extended-spectrum beta-lactamase VEB-1	NA	NA	NA	NA	NA
AXS22505.1|29238_29772_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AXS22506.1|29856_30309_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
AXS22611.1|30629_31889_+	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
AXS22507.1|32153_32954_+	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
AXS22612.1|32970_33762_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AXS22508.1|33925_34273_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXS22509.1|34266_35238_+	dihydropteroate synthase	NA	NA	NA	NA	NA
AXS22510.1|35454_36669_+	chloramphenicol/florfenicol efflux MFS transporter FloR2	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
AXS22511.1|36696_36879_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AXS22512.1|36875_37502_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXS22513.1|37605_38781_+	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
AXS22514.1|38801_39593_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXS22515.1|39684_41217_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXS22516.1|41443_41836_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.5e-22
AXS22517.1|41850_43053_-|transposase	ISL3-like element ISAeme19 family transposase	transposase	A9YX10	Burkholderia_phage	53.2	1.0e-102
AXS22518.1|43168_43717_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AXS22519.1|43797_44553_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AXS22520.1|44722_45583_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXS22521.1|45765_46323_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AXS22522.1|46886_48149_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AXS22523.1|48404_49280_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
50225:51044	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGCGCGACGAGCAGCAGCACCAGGAGCAGAAGCACGTCGAGAAAAAGCAACAGCAGATCGAGCAGCGCCCACGGCGGGCCGCTCGCATCGGATAAGTCGAAAAATCCGGCTAAAGTGGCCGAGCTGCACATCAGGCCGCGCGGTTTTCCTCCCTGATCGCCGGCGCGGTTTCTTCCTCCCTGAACCGCATGCAGACTTGCCGCCTCGGACACCCCGAGGCGGTTTTTTTTCGCCTCGCTCGAGCATCGCCGCATCCGACGATGCCGAGACGACCAGGCCGCGCACGTCGAGCTGCAGCATCGCCATTGCCGACGATGGCACCAGGTCGCCGGCGGTGGCCACCGACCTCGAGCTCGCATCGCCACATCCGACGATGCGCGCCGGCGTCGACCATCGCCAGGTCTGACGATGGCGGCCGCCCTGCCCTGGATCTCGCATCGCCATTTCTGGCGATGAGATCCACGGAGCGGCCATTTAGACCCGCCAATAACGACCCGGCCAAGATAAATCGCATGACGGCCTTTTTGGCCGGGGGTAGCATGACCGGACACTTTGCGTATGCCCAAAGGAGCCCGCAAGTATGCGCAGGACGAAGCCAGTAGCCGCGCCGATGGTGGCGCGGGTCTATCTGCGCGTCAGCACCGACGCGCAGGACTTGGAACGCCAAGAGGCGATCACTACGGCCGCGAAGGCCGCCGGCTACTACGTCGCCGGCATCTACCGTGAGAAGGCATCCGGCGCACGCGCCGACCGGCCTGAGC	NA	NA	NA	NA
>prophage 1
CP031803	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed3, complete sequence	111123	0	110803	111123	integrase,tail,capsid,terminase	Salmonella_phage(88.24%)	118	15410:15428	98303:98321
AXS22616.1|0_1098_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.2e-73
AXS22617.1|1549_1762_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
AXS22618.1|1761_2097_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.1e-37
AXS22619.1|2093_2273_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22620.1|2806_3883_-	recombinase	NA	J9Q736	Salmonella_phage	96.4	3.8e-197
AXS22621.1|3885_4152_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
AXS22622.1|4151_5096_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.3	4.9e-172
AXS22623.1|5156_6164_-	regulator	NA	J9Q7Z3	Salmonella_phage	88.3	2.1e-144
AXS22624.1|6283_6715_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.4e-65
AXS22625.1|6870_7170_-	lipoprotein	NA	NA	NA	NA	NA
AXS22730.1|7181_7562_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	64.3	1.0e-43
AXS22626.1|7801_8245_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.7	8.9e-60
AXS22627.1|8241_9411_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	92.3	4.4e-207
AXS22628.1|9432_10134_-	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	37.1	4.9e-20
AXS22629.1|10130_12494_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	86.9	0.0e+00
AXS22630.1|12468_12672_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	7.2e-25
AXS22631.1|12674_13907_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	86.4	2.2e-212
AXS22632.1|14003_16289_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	63.3	6.1e-245
15410:15428	attL	TAGGTATGTACTTACTTAT	NA	NA	NA	NA
AXS22633.1|16891_17272_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXS22634.1|17266_18367_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	30.0	9.4e-18
AXS22635.1|18716_19076_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22636.1|19140_19551_-	toxin YafO	NA	NA	NA	NA	NA
AXS22637.1|19560_20178_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22638.1|20272_20518_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	9.1e-14
AXS22639.1|20514_20901_-	hypothetical protein	NA	Q716B1	Shigella_phage	72.0	4.9e-46
AXS22640.1|20910_21723_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.8	1.4e-90
AXS22641.1|21846_22026_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22642.1|22130_22760_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22643.1|24166_24583_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22644.1|24730_24946_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	78.6	8.5e-24
AXS22645.1|25048_26371_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	86.1	1.8e-228
AXS22646.1|26370_26838_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	1.3e-48
AXS22647.1|26917_27706_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.5	3.6e-72
AXS22648.1|27994_29161_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22731.1|29203_30322_-	DNA primase	NA	J9Q720	Salmonella_phage	91.3	1.4e-202
AXS22649.1|30475_31816_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	95.7	7.0e-241
AXS22650.1|31880_32606_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.0	3.7e-127
AXS22651.1|32788_33199_-	hypothetical protein	NA	J9Q6F2	Salmonella_phage	38.6	9.2e-19
AXS22732.1|33191_33626_-	hypothetical protein	NA	J9Q719	Salmonella_phage	42.9	3.7e-18
AXS22652.1|34031_34394_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
AXS22653.1|34393_35059_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
AXS22654.1|35351_35936_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	42.6	3.8e-34
AXS22655.1|36132_36384_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	72.3	5.8e-24
AXS22656.1|36386_37079_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	89.6	4.1e-120
AXS22657.1|37092_37416_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
AXS22658.1|37506_38952_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.6	8.0e-41
AXS22659.1|39004_51175_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	57.5	2.4e-29
AXS22660.1|51191_51803_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
AXS22661.1|51790_52588_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
AXS22662.1|52580_53279_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
AXS22663.1|53365_53701_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	3.4e-51
AXS22664.1|53744_58280_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	70.0	0.0e+00
AXS22665.1|58287_58521_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
AXS22666.1|58637_58955_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
AXS22667.1|59016_59763_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	82.6	8.1e-106
AXS22668.1|59830_60223_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	68.3	2.0e-47
AXS22669.1|60224_60698_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
AXS22670.1|60688_61033_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
AXS22671.1|61130_61964_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	2.4e-130
AXS22672.1|61963_62398_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
AXS22673.1|62445_62874_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	70.6	1.8e-28
AXS22674.1|62952_63831_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.2	4.7e-153
AXS22675.1|63857_64757_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
AXS22676.1|64779_66369_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.7	1.8e-275
AXS22677.1|66386_67643_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
AXS22678.1|67645_68287_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
AXS22679.1|68462_68729_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
AXS22680.1|68738_69629_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
AXS22681.1|69625_70177_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22682.1|70166_70808_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.2	2.3e-109
AXS22683.1|70804_71473_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	91.4	1.9e-106
AXS22684.1|71472_72153_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	88.8	3.0e-107
AXS22685.1|72236_73796_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	93.1	3.1e-280
AXS22686.1|73798_74074_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	3.1e-26
AXS22687.1|74124_74562_-	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
AXS22688.1|74717_75248_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
AXS22689.1|75881_76532_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
AXS22690.1|76582_76786_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
AXS22691.1|77377_77860_-	hypothetical protein	NA	J9Q805	Salmonella_phage	70.6	1.3e-64
AXS22692.1|78065_78347_-	ABC transporter	NA	J9Q753	Salmonella_phage	84.9	1.1e-42
AXS22693.1|78473_78881_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22694.1|79000_79312_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	66.0	8.8e-30
AXS22695.1|79448_79661_-	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
AXS22733.1|79673_79892_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
AXS22696.1|80668_80983_+	hypothetical protein	NA	J9Q7T6	Salmonella_phage	66.7	6.4e-12
AXS22697.1|81443_82670_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.2	1.6e-119
AXS22698.1|82840_83158_-	hypothetical protein	NA	J9Q750	Salmonella_phage	74.3	9.2e-43
AXS22699.1|83772_84519_+	NYN domain-containing protein	NA	NA	NA	NA	NA
AXS22700.1|84663_85092_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
AXS22701.1|85365_85725_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22702.1|85971_86235_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	1.7e-29
AXS22703.1|86386_87088_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	69.7	4.0e-78
AXS22704.1|87176_88862_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	91.1	0.0e+00
AXS22705.1|88990_89569_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	5.1e-55
AXS22706.1|89696_89852_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
AXS22707.1|89851_90277_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
AXS22708.1|90379_90568_-	hypothetical protein	NA	J9Q800	Salmonella_phage	52.5	3.3e-08
AXS22709.1|90564_90843_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22710.1|91274_91862_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
AXS22711.1|92434_92668_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.7e-31
AXS22712.1|92865_93459_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	84.3	6.5e-98
AXS22713.1|93643_94477_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.1	1.2e-62
AXS22714.1|94602_95160_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
AXS22715.1|95169_95589_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
AXS22716.1|95652_96297_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	76.2	1.5e-92
AXS22717.1|96296_96773_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.0	1.9e-71
AXS22718.1|96769_97183_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	76.6	2.3e-54
AXS22719.1|97184_98288_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
AXS22720.1|98481_99357_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	84.7	4.5e-140
98303:98321	attR	ATAAGTAAGTACATACCTA	NA	NA	NA	NA
AXS22721.1|99434_100577_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
AXS22722.1|100707_103011_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
AXS22723.1|103086_103656_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	90.5	3.8e-95
AXS22724.1|103665_104412_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.7	1.2e-77
AXS22725.1|104401_106318_-	exonuclease	NA	J9Q741	Salmonella_phage	84.8	3.3e-300
AXS22734.1|106314_106509_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	2.8e-18
AXS22726.1|106547_107633_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	84.2	2.0e-182
AXS22727.1|108285_109845_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	52.3	6.6e-57
AXS22728.1|110158_110803_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	8.3e-99
>prophage 1
CP031806	Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed6, complete sequence	53943	0	53488	53943	terminase,head,capsid,portal,tail	Klebsiella_phage(86.27%)	56	NA	NA
AXS22903.1|169_502_-	hypothetical protein	NA	Q6UAU1	Klebsiella_phage	80.0	4.8e-42
AXS22904.1|629_1238_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.6	1.3e-98
AXS22905.1|1649_2387_-	phage antitermination protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.2e-119
AXS22957.1|2376_2586_-	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
AXS22906.1|2666_3275_+	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	92.6	9.6e-105
AXS22907.1|3525_7530_+	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.3	0.0e+00
AXS22908.1|7522_7729_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22909.1|7715_8042_+	hypothetical protein	NA	O64345	Escherichia_phage	70.1	2.0e-40
AXS22910.1|8044_8425_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22911.1|8796_9789_+	hypothetical protein	NA	A0A2H5BFZ4	Vibrio_phage	40.8	1.8e-23
AXS22912.1|9927_10353_-	hypothetical protein	NA	NA	NA	NA	NA
AXS22913.1|10714_10882_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22914.1|10933_11098_+	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	94.4	3.7e-19
AXS22915.1|11094_11325_+	hypothetical protein	NA	NA	NA	NA	NA
AXS22916.1|11321_12104_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	90.0	7.7e-131
AXS22917.1|12158_14081_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	93.4	0.0e+00
AXS22918.1|14788_15952_+	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
AXS22919.1|15954_16920_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	86.9	1.5e-155
AXS22920.1|16998_18498_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	73.8	1.7e-147
AXS22921.1|18566_31283_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	48.6	0.0e+00
AXS22922.1|31345_31939_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.2	6.1e-80
AXS22923.1|31965_32388_-	hypothetical protein	NA	A0A1B0VMH3	Pseudomonas_phage	36.9	1.1e-14
AXS22924.1|32429_33140_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	91.1	3.8e-137
AXS22925.1|33141_33897_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	81.3	1.2e-125
AXS22926.1|33893_34232_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	8.3e-58
AXS22927.1|34231_37567_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.5	0.0e+00
AXS22928.1|37566_37779_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
AXS22929.1|37799_38165_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AXS22930.1|38222_38684_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AXS22931.1|38715_39117_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	93.2	1.1e-61
AXS22932.1|39113_39503_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	84.5	4.0e-56
AXS22933.1|39483_39822_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AXS22934.1|39818_40136_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AXS22935.1|40116_40404_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.6	2.5e-18
AXS22936.1|40463_41750_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	84.1	5.9e-205
AXS22937.1|41827_42748_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
AXS22938.1|42784_44044_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.5	1.2e-221
AXS22939.1|44043_44223_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	80.7	2.4e-16
AXS22940.1|44216_45926_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
AXS22941.1|45960_46395_-|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
AXS22958.1|46525_46726_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	90.9	3.4e-11
AXS22942.1|46811_47243_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.9	7.6e-40
AXS22943.1|47239_47524_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	3.1e-05
AXS22944.1|47520_47883_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	94.2	2.4e-63
AXS22945.1|48052_48352_-	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
AXS22946.1|48605_49082_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	1.7e-61
AXS22947.1|49098_49590_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.8	1.9e-82
AXS22948.1|49586_49898_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
AXS22949.1|49956_51018_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	93.2	1.6e-171
AXS22950.1|51335_51563_-	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
AXS22959.1|51574_51796_-	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
AXS22951.1|51966_52275_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
AXS22952.1|52274_52562_+	XRE family transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
AXS22953.1|52606_52810_-	hypothetical protein	NA	Q6UAT5	Klebsiella_phage	76.6	3.5e-19
AXS22954.1|52913_53141_-	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
AXS22955.1|53161_53488_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	3.9e-52
