The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	22158	30876	3937399	tRNA	uncultured_Mediterranean_phage(16.67%)	8	NA	NA
AVM22354.1|22158_23433_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.6	2.4e-97
AVM22355.1|23535_24366_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.1	2.1e-09
AVM22356.1|24676_25336_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.6	1.3e-22
AVM22357.1|25332_25956_-	deoxynucleoside kinase	NA	S5MMC6	Bacillus_phage	28.9	5.3e-18
AVM22358.1|26035_27337_-	spore gernimation protein	NA	A0A2P1CIG4	Microbacterium_phage	33.7	3.0e-07
AVM22359.1|27382_27937_-	cysteine hydrolase	NA	NA	NA	NA	NA
AVM22360.1|28016_28493_+|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
AVM22361.1|29163_30876_+	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	34.7	6.8e-55
>prophage 2
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	632082	641974	3937399		Synechococcus_phage(50.0%)	9	NA	NA
AVM22887.1|632082_633378_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.6	5.0e-18
AVM22888.1|633450_634173_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.8	1.0e-44
AVM22889.1|634165_634420_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	33.3	1.2e-05
AVM22890.1|634416_635100_+	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
AVM22891.1|635083_637315_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.7	4.2e-158
AVM26102.1|637290_638721_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	7.6e-52
AVM22892.1|638813_639854_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.2	5.7e-65
AVM22893.1|639850_640420_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.5	1.1e-30
AVM22894.1|640435_641974_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.1	9.6e-77
>prophage 3
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	1032256	1075560	3937399	coat,terminase,tail,integrase,head,holin,portal	uncultured_Caudovirales_phage(45.45%)	64	1033922:1033939	1075863:1075880
AVM23225.1|1032256_1033117_+	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.9	1.3e-54
AVM23226.1|1033173_1033410_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AVM23227.1|1033699_1033966_+	competence protein ComK	NA	NA	NA	NA	NA
1033922:1033939	attL	ATTTCCCACAAGCCTCCA	NA	NA	NA	NA
AVM23228.1|1034020_1035214_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	42.6	4.4e-85
AVM23229.1|1035227_1035731_-|portal	phage portal protein	portal	A0A2H4JA43	uncultured_Caudovirales_phage	94.6	8.8e-88
AVM23230.1|1036125_1036704_-	hypothetical protein	NA	NA	NA	NA	NA
AVM23231.1|1036913_1037264_-	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	79.8	1.3e-42
AVM23232.1|1037320_1037698_-	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	42.6	8.8e-16
AVM23233.1|1037877_1038087_+	XRE family transcriptional regulator	NA	A8ATX6	Listeria_phage	56.5	4.1e-15
AVM23234.1|1038275_1038587_-	hypothetical protein	NA	NA	NA	NA	NA
AVM23235.1|1038653_1038959_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	50.0	3.3e-21
AVM23236.1|1038955_1039717_+	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	69.6	1.2e-99
AVM23237.1|1039811_1040381_+	transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	89.9	9.3e-94
AVM23238.1|1040377_1040656_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	73.9	4.3e-28
AVM23239.1|1040865_1041150_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23240.1|1041142_1041322_+	hypothetical protein	NA	A0A2H4JCC7	uncultured_Caudovirales_phage	91.5	3.2e-24
AVM23241.1|1041321_1042215_+	hypothetical protein	NA	A0A0A7RUE9	Clostridium_phage	62.9	6.4e-89
AVM23242.1|1042186_1042984_+	hypothetical protein	NA	A0A0A7RUC1	Clostridium_phage	46.9	1.1e-63
AVM23243.1|1042983_1043172_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23244.1|1043172_1043877_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	86.8	2.0e-114
AVM23245.1|1043740_1044652_+	ATP-binding protein IstB	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	90.6	9.9e-130
AVM23246.1|1044917_1045277_+	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	43.5	2.7e-14
AVM23247.1|1045395_1045851_+	hypothetical protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	93.4	6.1e-72
AVM23248.1|1046186_1046396_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	97.0	1.0e-29
AVM23249.1|1046411_1046756_+	hypothetical protein	NA	A0A2H4JCD8	uncultured_Caudovirales_phage	74.6	7.2e-41
AVM23250.1|1046752_1047010_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	85.2	1.5e-30
AVM23251.1|1047251_1047671_+	hypothetical protein	NA	O64129	Bacillus_phage	74.1	4.8e-55
AVM23252.1|1047698_1047923_+	hypothetical protein	NA	A0A143FIB4	Bacillus_phage	48.6	1.8e-13
AVM23253.1|1047919_1048570_+	dUTPase	NA	A0A0K2CNV1	Brevibacillus_phage	40.3	1.2e-31
AVM23254.1|1048569_1048953_+	hypothetical protein	NA	A0A2H4J4Q6	uncultured_Caudovirales_phage	93.4	3.0e-64
AVM23255.1|1049112_1049385_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23256.1|1049381_1049795_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23257.1|1049839_1050514_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23258.1|1050744_1051209_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23259.1|1051361_1051625_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23260.1|1051759_1051987_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23261.1|1052030_1052786_+	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	87.9	6.5e-119
AVM23262.1|1052772_1053975_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	93.6	3.0e-219
AVM23263.1|1053995_1055453_+|portal	phage portal protein	portal	A0A1Q1PVT0	Bacillus_phage	48.6	4.6e-121
AVM23264.1|1055433_1056348_+|head	phage head morphogenesis protein	head	A0A1Q1PVS4	Bacillus_phage	47.5	3.2e-72
AVM23265.1|1056470_1057136_+	scaffolding protein	NA	A0A1Z1LZK8	Bacillus_phage	37.3	1.2e-15
AVM23266.1|1057148_1058135_+|coat	coat protein	coat	D2J006	Enterococcus_phage	38.1	2.2e-50
AVM23267.1|1058094_1058397_+	alkaline phosphatase	NA	Q0PDK9	Bacillus_phage	65.4	3.5e-23
AVM23268.1|1058397_1058589_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23269.1|1058593_1058890_+	hypothetical protein	NA	Q4ZC67	Staphylococcus_virus	38.0	2.1e-12
AVM23270.1|1058883_1059225_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AVM23271.1|1059217_1059637_+	hypothetical protein	NA	O48447	Bacillus_phage	53.7	6.7e-33
AVM23272.1|1059652_1060051_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	43.1	1.4e-24
AVM23273.1|1060064_1060589_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
AVM23274.1|1060554_1060851_+	alkaline phosphatase	NA	Q0PDK9	Bacillus_phage	70.5	3.9e-27
AVM23275.1|1060919_1061426_+	hypothetical protein	NA	A0A1W6JQN4	Staphylococcus_phage	34.5	2.2e-14
AVM23276.1|1061446_1061755_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23277.1|1061759_1066409_+	hypothetical protein	NA	M9NRJ5	Staphylococcus_phage	25.7	5.9e-37
AVM23278.1|1066405_1067173_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVM23279.1|1067189_1070516_+	hypothetical protein	NA	Q5YA57	Bacillus_phage	46.7	1.2e-129
AVM23280.1|1070533_1070947_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23281.1|1071046_1071256_+	hypothetical protein	NA	NA	NA	NA	NA
AVM26116.1|1071314_1071527_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	56.1	1.5e-12
AVM23282.1|1071543_1071807_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	2.5e-25
AVM23283.1|1071818_1072673_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	90.5	3.3e-26
AVM23284.1|1072859_1073324_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23285.1|1073980_1074223_+	DNA-binding protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	91.2	1.7e-33
AVM23286.1|1074368_1075223_-	Abi family protein	NA	A3QSC6	Clostridium_virus	39.2	7.0e-45
AVM23287.1|1075365_1075560_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	87.1	5.9e-24
1075863:1075880	attR	ATTTCCCACAAGCCTCCA	NA	NA	NA	NA
>prophage 4
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	1082617	1092688	3937399	integrase	Streptococcus_phage(33.33%)	14	1074473:1074486	1090473:1090486
1074473:1074486	attL	TCATCCATTCTTCG	NA	NA	NA	NA
AVM23294.1|1082617_1082980_-	hypothetical protein	NA	A0A2H4J238	uncultured_Caudovirales_phage	33.9	1.6e-11
AVM23295.1|1083136_1083754_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
AVM23296.1|1083753_1084266_+	signal peptidase I	NA	NA	NA	NA	NA
AVM23297.1|1084301_1085447_-	hypothetical protein	NA	NA	NA	NA	NA
AVM23298.1|1085860_1086991_-|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	30.4	1.1e-26
AVM23299.1|1087006_1087522_-	peptidase	NA	Q0H245	Geobacillus_phage	32.6	5.8e-10
AVM23300.1|1087518_1087890_-	XRE family transcriptional regulator	NA	A0A090D830	Clostridium_phage	32.5	1.0e-08
AVM23301.1|1088051_1088246_+	ICEBs1 excisionase	NA	A0A0A8WI91	Clostridium_phage	42.3	6.1e-05
AVM23302.1|1088245_1088488_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23303.1|1088545_1088830_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23304.1|1089188_1089572_+	hypothetical protein	NA	A0A1S5SF38	Streptococcus_phage	39.0	2.8e-09
AVM23305.1|1089587_1091003_+	ATP-binding protein	NA	A0A1S5SFB5	Streptococcus_phage	47.8	3.7e-115
1090473:1090486	attR	CGAAGAATGGATGA	NA	NA	NA	NA
AVM23306.1|1091012_1092065_+	DNA relaxase NicK	NA	A0A1S5SEX3	Streptococcus_phage	38.1	2.6e-57
AVM23307.1|1092388_1092688_+	RNA-binding protein	NA	C9E2N9	Enterococcus_phage	55.0	8.8e-19
>prophage 5
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	1196046	1230832	3937399	coat,tRNA	Planktothrix_phage(16.67%)	39	NA	NA
AVM26120.1|1196046_1197042_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AVM23403.1|1197796_1199434_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVM23404.1|1199550_1200495_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AVM23405.1|1200498_1201416_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVM23406.1|1201419_1202508_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.7e-14
AVM23407.1|1202509_1203430_+	peptide ABC transporter ATP-binding protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	26.1	2.2e-07
AVM23408.1|1203528_1203816_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23409.1|1203951_1204530_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVM23410.1|1204723_1205119_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AVM23411.1|1205157_1205823_-	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	37.5	4.2e-29
AVM23412.1|1206086_1206752_+	adaptor protein MecA	NA	NA	NA	NA	NA
AVM23413.1|1206838_1208359_+	cardiolipin synthase	NA	NA	NA	NA	NA
AVM23414.1|1208521_1209682_+	competence protein	NA	NA	NA	NA	NA
AVM26121.1|1209719_1211723_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	25.3	2.0e-58
AVM23415.1|1211825_1211999_-	hypothetical protein	NA	NA	NA	NA	NA
AVM23416.1|1212294_1213206_-	dithiol-disulfide isomerase	NA	NA	NA	NA	NA
AVM23417.1|1213202_1213601_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
AVM23418.1|1213877_1214645_-	ABC transporter ATP-binding protein	NA	A0A0H3V0Q1	Geobacillus_virus	59.8	8.3e-37
AVM23419.1|1214666_1215245_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AVM23420.1|1215481_1215847_+	hypothetical protein	NA	NA	NA	NA	NA
AVM23421.1|1215880_1216510_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AVM23422.1|1216575_1217376_+	NAD kinase	NA	NA	NA	NA	NA
AVM23423.1|1217420_1218287_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AVM23424.1|1218329_1219073_-	hypothetical protein	NA	M4Q4T6	Vibrio_phage	23.8	7.3e-06
AVM23425.1|1219235_1221077_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AVM23426.1|1221324_1222035_+	thiaminase II	NA	NA	NA	NA	NA
AVM23427.1|1222009_1222627_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AVM23428.1|1222610_1223723_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AVM23429.1|1223719_1223923_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AVM23430.1|1223927_1224695_+	thiazole synthase	NA	NA	NA	NA	NA
AVM23431.1|1224691_1225705_+	thiamine biosynthesis protein MoeB	NA	NA	NA	NA	NA
AVM23432.1|1225721_1226528_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AVM23433.1|1226678_1227455_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AVM23434.1|1227568_1228171_+|coat	spore coat protein	coat	NA	NA	NA	NA
AVM23435.1|1228205_1228649_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVM23436.1|1228856_1229348_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVM23437.1|1229494_1229977_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVM23438.1|1230065_1230401_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVM23439.1|1230445_1230832_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 6
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	1725349	1731611	3937399		Bacillus_phage(66.67%)	6	NA	NA
AVM23923.1|1725349_1725748_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S5MA49	Bacillus_phage	54.2	8.1e-28
AVM23924.1|1725707_1727810_+	ribonucleotide-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	83.0	0.0e+00
AVM23925.1|1727827_1728808_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	81.2	1.9e-150
AVM23926.1|1728892_1729510_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	44.3	2.5e-44
AVM23927.1|1729572_1730331_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	6.9e-52
AVM23928.1|1730651_1731611_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	39.9	2.3e-52
>prophage 7
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	2018924	2046239	3937399		Bacillus_phage(62.5%)	48	NA	NA
AVM26149.1|2018924_2020421_-	recombinase family protein	NA	A0A0U4IB69	Exiguobacterium_phage	27.9	2.5e-37
AVM24199.1|2020469_2021111_-	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	74.4	2.5e-71
AVM24200.1|2021097_2021367_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24201.1|2021394_2021787_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24202.1|2021779_2021971_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24203.1|2021985_2022510_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	43.9	5.3e-27
AVM24204.1|2022724_2023201_-	Appr-1-p processing protein	NA	A0A0H3V0V8	Geobacillus_virus	50.0	8.2e-35
AVM24205.1|2023312_2023651_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24206.1|2023653_2023866_-	hypothetical protein	NA	F8WPN9	Bacillus_phage	39.4	2.9e-08
AVM24207.1|2023866_2024385_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24208.1|2024432_2025191_-	hypothetical protein	NA	X2JMW4	Bacillus_phage	61.6	2.5e-86
AVM24209.1|2025347_2025830_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24210.1|2026089_2026578_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24211.1|2026651_2027071_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24212.1|2027079_2027418_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24213.1|2027421_2027616_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24214.1|2027677_2027896_-	hypothetical protein	NA	A0A0H3UYX0	Geobacillus_virus	48.0	3.9e-08
AVM24215.1|2027980_2028496_-	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	37.6	5.4e-24
AVM24216.1|2028492_2029305_-	thymidylate synthase	NA	B5TRA0	Bacteroides_phage	50.4	5.1e-69
AVM24217.1|2029287_2029941_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24218.1|2029957_2030197_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24219.1|2030329_2030776_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24220.1|2030852_2031281_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1P8CX51	Bacillus_phage	85.9	7.8e-69
AVM24221.1|2031314_2031707_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24222.1|2031845_2032193_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24223.1|2032245_2032983_-	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	52.3	2.1e-69
AVM24224.1|2032975_2033962_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	80.3	5.1e-148
AVM26150.1|2034235_2036338_-	ribonucleotide-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	78.8	0.0e+00
AVM24225.1|2036315_2036702_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	57.9	1.5e-34
AVM24226.1|2036701_2037061_-	antitoxin endoai	NA	NA	NA	NA	NA
AVM26151.1|2037100_2037367_-	hypothetical protein	NA	O64167	Bacillus_phage	64.0	1.9e-25
AVM24227.1|2037727_2037952_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	71.8	3.0e-24
AVM24228.1|2038340_2038532_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24229.1|2038553_2038916_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24230.1|2038959_2039250_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24231.1|2039282_2039648_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24232.1|2039794_2040091_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24233.1|2040083_2040362_-	hypothetical protein	NA	A0A1P8CX20	Bacillus_phage	48.5	8.2e-19
AVM24234.1|2040708_2040891_-	hypothetical protein	NA	O64161	Bacillus_phage	70.0	4.7e-15
AVM24235.1|2040908_2041136_-	hypothetical protein	NA	O64159	Bacillus_phage	38.8	3.7e-09
AVM24236.1|2041594_2041912_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24237.1|2041926_2042298_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24238.1|2042294_2042504_-	hypothetical protein	NA	NA	NA	NA	NA
AVM26152.1|2042541_2043273_-	cytosine methyltransferase	NA	A0A1D8KTH4	Synechococcus_phage	52.2	2.4e-70
AVM26153.1|2043361_2044108_-	cytosine methyltransferase	NA	W8EBG5	Geobacillus_phage	55.2	8.5e-71
AVM24239.1|2044201_2044723_-	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	66.1	3.3e-61
AVM24240.1|2044719_2045226_-	hypothetical protein	NA	A0A1P8CX28	Bacillus_phage	50.6	9.6e-42
AVM24241.1|2045558_2046239_-	hypothetical protein	NA	A0A0H3UZG2	Geobacillus_virus	46.3	1.9e-13
>prophage 8
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	2050162	2076831	3937399	integrase	Bacillus_phage(73.08%)	38	2046191:2046211	2079221:2079241
2046191:2046211	attL	AATATATGTTATTTGTATTTT	NA	NA	NA	NA
AVM24242.1|2050162_2051887_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	65.0	8.8e-212
AVM24243.1|2051887_2053015_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	68.3	2.9e-155
AVM24244.1|2053029_2054553_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	64.1	7.8e-188
AVM24245.1|2055080_2056052_-	hypothetical protein	NA	A0A1P8CX29	Bacillus_phage	79.9	1.2e-144
AVM24246.1|2056103_2057030_-	hypothetical protein	NA	O64140	Bacillus_phage	55.1	1.4e-75
AVM24247.1|2057058_2057370_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24248.1|2057501_2058044_-	hypothetical protein	NA	A0A218KC48	Bacillus_phage	38.4	4.2e-27
AVM24249.1|2058036_2058429_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	50.4	1.7e-33
AVM24250.1|2058439_2059153_-	serine/threonine protein phosphatase	NA	A0A059T829	Listeria_phage	37.4	1.4e-41
AVM24251.1|2059315_2060137_-	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	35.0	2.0e-28
AVM24252.1|2060307_2061090_-	hypothetical protein	NA	NA	NA	NA	NA
AVM26154.1|2061150_2061540_-	hypothetical protein	NA	A0A076G7Y2	Bacillus_phage	87.0	3.6e-57
AVM24253.1|2061542_2061839_-	hypothetical protein	NA	A0A2H4J4P5	uncultured_Caudovirales_phage	80.0	1.9e-37
AVM24254.1|2061838_2062144_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24255.1|2062140_2062674_-	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	50.8	4.7e-39
AVM24256.1|2062670_2062856_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24257.1|2062837_2063248_-	hypothetical protein	NA	O64129	Bacillus_phage	76.7	7.5e-53
AVM24258.1|2063284_2063662_-	hypothetical protein	NA	S0A5I0	Cellulophaga_phage	34.4	2.2e-11
AVM24259.1|2063698_2064013_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24260.1|2064033_2064249_-	hypothetical protein	NA	NA	NA	NA	NA
AVM26155.1|2064253_2064436_-	hypothetical protein	NA	A0A0S2MV96	Bacillus_phage	55.3	5.2e-06
AVM24261.1|2064647_2064962_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24262.1|2065205_2065397_-	hypothetical protein	NA	A0A142F1P8	Bacillus_phage	61.3	5.8e-16
AVM24263.1|2065562_2065757_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24264.1|2065790_2066183_-	hypothetical protein	NA	A0A0A8WEI8	Clostridium_phage	46.2	2.8e-25
AVM24265.1|2066211_2066886_-	DUF1273 domain-containing protein	NA	A0A1P8CWY2	Bacillus_phage	64.7	7.4e-82
AVM24266.1|2066927_2067182_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24267.1|2067393_2069592_-	phosphatase	NA	Q4Z932	Staphylococcus_phage	42.0	3.3e-155
AVM24268.1|2069641_2069902_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24269.1|2069944_2070394_-	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	66.9	3.4e-51
AVM26156.1|2070411_2071563_-	hypothetical protein	NA	A0A172JHS6	Bacillus_phage	41.1	5.5e-69
AVM24270.1|2071582_2071840_-	hypothetical protein	NA	O64118	Bacillus_phage	44.4	5.4e-09
AVM24271.1|2072236_2072434_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24272.1|2072507_2072726_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24273.1|2072912_2073131_+	XRE family transcriptional regulator	NA	O64102	Bacillus_phage	44.6	6.0e-09
AVM24274.1|2073285_2074275_-	hypothetical protein	NA	O64101	Bacillus_phage	37.5	5.8e-51
AVM24275.1|2074277_2075666_-	hypothetical protein	NA	O64100	Bacillus_phage	37.4	5.3e-74
AVM24276.1|2075763_2076831_-|integrase	integrase	integrase	O64099	Bacillus_phage	45.0	1.4e-71
2079221:2079241	attR	AATATATGTTATTTGTATTTT	NA	NA	NA	NA
>prophage 9
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	2085130	2092533	3937399		Bacillus_phage(66.67%)	10	NA	NA
AVM24287.1|2085130_2085343_-	hypothetical protein	NA	A0A0A0PKZ9	Bacillus_phage	61.4	7.1e-15
AVM24288.1|2085342_2085528_-	hypothetical protein	NA	NA	NA	NA	NA
AVM26157.1|2085530_2085749_-	hypothetical protein	NA	L0L975	Bacillus_phage	66.7	9.2e-18
AVM26158.1|2086126_2086318_-	hypothetical protein	NA	A0A1P8CX54	Bacillus_phage	87.3	4.6e-29
AVM24289.1|2086396_2086621_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24290.1|2086866_2087079_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24291.1|2087090_2087351_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24292.1|2087450_2089064_-	DNA methyltransferase	NA	A0A0U4JGM1	Vibrio_phage	37.6	1.3e-12
AVM24293.1|2089118_2090981_-	hypothetical protein	NA	A0A0H3UZM4	Geobacillus_virus	31.7	2.2e-06
AVM24294.1|2091300_2092533_-	hypothetical protein	NA	O64082	Bacillus_phage	74.3	8.8e-182
>prophage 10
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	2095849	2156833	3937399	terminase,holin,tail,coat	Bacillus_phage(82.5%)	65	NA	NA
AVM24298.1|2095849_2096029_+	hypothetical protein	NA	O64077	Bacillus_phage	53.5	7.3e-05
AVM24299.1|2096041_2098573_+	hypothetical protein	NA	O64076	Bacillus_phage	67.6	0.0e+00
AVM24300.1|2098796_2099072_+	DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	66.7	5.4e-23
AVM24301.1|2100223_2100415_+	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	73.0	2.1e-18
AVM24302.1|2100429_2101629_+	hypothetical protein	NA	W5RV85	Staphylococcus_phage	39.5	3.2e-67
AVM24303.1|2101785_2102373_+	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	34.3	8.3e-05
AVM24304.1|2102452_2103280_+	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	37.7	1.5e-47
AVM24305.1|2103279_2105052_+|terminase	terminase	terminase	O64069	Bacillus_phage	42.6	3.1e-127
AVM26159.1|2105121_2106597_+	hypothetical protein	NA	O64068	Bacillus_phage	71.3	4.0e-205
AVM24306.1|2106634_2108056_+	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	62.9	1.3e-160
AVM24307.1|2108073_2108610_+	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	83.7	1.6e-79
AVM24308.1|2108651_2109665_+	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	77.3	1.8e-148
AVM24309.1|2109701_2110172_+	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	73.7	2.9e-61
AVM24310.1|2110182_2110584_+	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	50.4	1.7e-33
AVM24311.1|2110580_2110817_+	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	60.3	3.1e-11
AVM24312.1|2110803_2111448_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	53.3	9.0e-61
AVM24313.1|2111444_2111960_+	hypothetical protein	NA	O64060	Bacillus_phage	51.8	1.4e-43
AVM24314.1|2111953_2112682_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	39.7	1.1e-35
AVM24315.1|2112724_2113516_+	hypothetical protein	NA	A0A0N7GFG4	Staphylococcus_phage	35.3	5.0e-29
AVM24316.1|2113535_2114111_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24317.1|2114152_2114521_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24318.1|2114520_2115603_+	hypothetical protein	NA	M4ZRP1	Bacillus_phage	35.2	1.2e-12
AVM24319.1|2115617_2115890_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	37.5	1.8e-10
AVM24320.1|2115890_2116040_+	XkdX family protein	NA	M4ZS22	Bacillus_phage	53.3	5.0e-07
AVM24321.1|2116075_2116258_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24322.1|2116309_2116789_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24323.1|2116788_2117211_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	51.1	9.5e-35
AVM24324.1|2117230_2118232_+	recombinase	NA	A0A1P8CWP6	Bacillus_phage	84.0	3.2e-166
AVM24325.1|2118376_2118724_+	XRE family transcriptional regulator	NA	A0A139ZPJ2	Marinitoga_camini_virus	46.2	1.7e-05
AVM24326.1|2118847_2119063_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24327.1|2119092_2119608_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24328.1|2119910_2120213_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24329.1|2120315_2120840_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24330.1|2121162_2121792_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24331.1|2121955_2122195_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24332.1|2122243_2122453_-	Cro/Cl family transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	44.9	6.8e-10
AVM24333.1|2122651_2122882_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24334.1|2122874_2123576_+	hypothetical protein	NA	A0A2P1JTZ2	Anoxybacillus_phage	58.9	9.6e-32
AVM24335.1|2123572_2123785_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24336.1|2123853_2124546_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24337.1|2124644_2126276_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	48.5	3.6e-98
AVM24338.1|2126422_2131717_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	51.4	0.0e+00
AVM24339.1|2131762_2132554_+|tail	phage tail protein	tail	O64045	Bacillus_phage	51.9	2.1e-80
AVM24340.1|2132564_2135255_+	hypothetical protein	NA	O64044	Bacillus_phage	55.9	1.3e-270
AVM24341.1|2135272_2136091_+	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	68.3	2.1e-94
AVM24342.1|2136115_2138233_+	hypothetical protein	NA	A0A1S5R3Z4	Pseudomonas_phage	45.1	3.9e-28
AVM24343.1|2138284_2139724_+	hypothetical protein	NA	A0A1P8CWN6	Bacillus_phage	78.0	1.9e-55
AVM24344.1|2139832_2140222_+	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	66.4	1.6e-33
AVM24345.1|2140235_2140487_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	74.1	1.3e-26
AVM24346.1|2140486_2140753_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24347.1|2140938_2141244_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24348.1|2141602_2142868_-	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	74.1	4.1e-182
AVM24349.1|2142860_2143190_-	YolD-like family protein	NA	O64030	Bacillus_phage	46.8	2.4e-25
AVM24350.1|2143336_2144347_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24351.1|2144447_2145017_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	38.2	9.8e-27
AVM24352.1|2147007_2148120_-	hypothetical protein	NA	A0A1P8CWN8	Bacillus_phage	29.0	4.1e-37
AVM24353.1|2148331_2148577_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24354.1|2149024_2149609_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AVM24355.1|2149962_2151468_-	carboxypeptidase M32	NA	NA	NA	NA	NA
AVM24356.1|2151598_2153536_-	ATP-dependent helicase	NA	NA	NA	NA	NA
AVM24357.1|2153611_2153809_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24358.1|2153915_2155070_-	RNA methyltransferase	NA	NA	NA	NA	NA
AVM24359.1|2155623_2155929_-	cell division regulator GpsB	NA	NA	NA	NA	NA
AVM26160.1|2156004_2156637_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24360.1|2156596_2156833_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 11
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	2201608	2209317	3937399		Ostreococcus_lucimarinus_virus(16.67%)	10	NA	NA
AVM24407.1|2201608_2202700_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	27.3	1.1e-21
AVM24408.1|2202699_2203872_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.4	3.4e-42
AVM24409.1|2203945_2204725_-	chemotaxis protein	NA	NA	NA	NA	NA
AVM24410.1|2204870_2205317_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.1	6.9e-28
AVM24411.1|2205446_2206409_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	26.0	1.7e-07
AVM24412.1|2206433_2207138_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase	NA	NA	NA	NA	NA
AVM24413.1|2207141_2207909_-	heptaprenyl diphosphate synthase	NA	NA	NA	NA	NA
AVM24414.1|2208023_2208254_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
AVM24415.1|2208278_2208848_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	56.7	7.0e-49
AVM24416.1|2209038_2209317_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	74.2	5.6e-28
>prophage 12
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	2247240	2253614	3937399		Staphylococcus_phage(50.0%)	10	NA	NA
AVM24455.1|2247240_2248392_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	38.1	2.4e-24
AVM24456.1|2248493_2248973_-	DUF3907 domain-containing protein	NA	NA	NA	NA	NA
AVM24457.1|2249086_2249680_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	5.8e-14
AVM24458.1|2249669_2250428_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	39.2	1.3e-10
AVM24459.1|2250638_2250731_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AVM24460.1|2250818_2251343_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AVM24461.1|2251367_2251721_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVM24462.1|2251834_2252299_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	66.0	9.4e-44
AVM24463.1|2252325_2252952_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	55.9	7.2e-55
AVM24464.1|2252963_2253614_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.8	4.4e-39
>prophage 13
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	2633168	2716870	3937399	coat,terminase,capsid,tail,integrase,tRNA,head,holin,protease,portal	Bacillus_phage(25.53%)	98	2655337:2655352	2714896:2714911
AVM24831.1|2633168_2634200_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
AVM24832.1|2634237_2635497_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVM24833.1|2635630_2636923_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AVM24834.1|2636950_2637922_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AVM24835.1|2637918_2638710_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AVM24836.1|2638706_2639642_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AVM24837.1|2639683_2640514_-	cytochrome C assembly protein	NA	NA	NA	NA	NA
AVM24838.1|2640521_2641889_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AVM24839.1|2642131_2642617_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24840.1|2642660_2643248_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AVM24841.1|2643244_2645569_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.4	1.3e-178
AVM24842.1|2645740_2647402_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	36.8	4.6e-16
AVM24843.1|2647539_2648805_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.4	5.9e-149
AVM24844.1|2649056_2650331_-	trigger factor	NA	NA	NA	NA	NA
AVM24845.1|2650571_2651579_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24846.1|2651704_2652304_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AVM24847.1|2652317_2653733_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AVM24848.1|2653773_2654871_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AVM24849.1|2654889_2656443_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.6	1.9e-11
2655337:2655352	attL	GATCTCTTTCTTCTTC	NA	NA	NA	NA
AVM24850.1|2656429_2657458_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AVM24851.1|2657476_2657995_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AVM24852.1|2657991_2659716_-	acetolactate synthase, large subunit, biosynthetic type	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	29.9	6.3e-61
AVM24853.1|2660094_2661009_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AVM24854.1|2661442_2662486_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AVM24855.1|2662455_2662662_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24856.1|2662715_2663135_-	hypothetical protein	NA	A0A2I7S9Z5	Vibrio_phage	31.4	6.8e-09
AVM24857.1|2663230_2664397_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
AVM24858.1|2664396_2664633_-	D-alanine--poly(phosphoribitol) ligase subunit 2	NA	NA	NA	NA	NA
AVM24859.1|2664654_2665839_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.9	1.1e-16
AVM24860.1|2665835_2667341_-	D-alanine--poly(phosphoribitol) ligase subunit 1	NA	A0A2K9L3I8	Tupanvirus	25.8	3.4e-34
AVM24861.1|2667355_2667499_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
AVM24862.1|2667757_2669014_-	DUF1668 domain-containing protein	NA	NA	NA	NA	NA
AVM24863.1|2669421_2669619_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24864.1|2669572_2669713_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24865.1|2670306_2670708_-	DUF1878 domain-containing protein	NA	NA	NA	NA	NA
AVM24866.1|2670727_2671189_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24867.1|2672373_2673411_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24868.1|2673374_2673647_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVM24869.1|2673785_2674838_+	DNA (cytosine-5-)-methyltransferase	NA	A7XXH6	Thermus_virus	42.4	9.8e-65
AVM24870.1|2675404_2675929_-	metallophosphoesterase	NA	NA	NA	NA	NA
AVM24871.1|2675943_2676537_-	non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	31.2	1.9e-09
AVM24872.1|2676556_2677285_-	ribonuclease PH	NA	NA	NA	NA	NA
AVM24873.1|2677437_2678499_-	sporulation protein	NA	NA	NA	NA	NA
AVM24874.1|2678600_2679419_-	glutamate racemase	NA	NA	NA	NA	NA
AVM24875.1|2679426_2679867_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVM24876.1|2680136_2681660_-	recombinase family protein	NA	A0A290FZV2	Caldibacillus_phage	51.0	5.9e-143
AVM24877.1|2681777_2681966_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	79.0	6.9e-22
AVM24878.1|2682033_2682189_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24879.1|2682261_2682762_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24880.1|2682845_2683049_+	hypothetical protein	NA	NA	NA	NA	NA
AVM24881.1|2683071_2683893_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	67.9	1.0e-61
AVM24882.1|2683946_2684210_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	5.1e-31
AVM24883.1|2684230_2684443_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	54.5	1.1e-12
AVM24884.1|2684482_2684629_-	XkdX family protein	NA	NA	NA	NA	NA
AVM24885.1|2684625_2684901_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	41.9	6.0e-14
AVM24886.1|2684913_2686485_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	38.2	5.8e-45
AVM24887.1|2686496_2688365_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24888.1|2688382_2690128_-	hypothetical protein	NA	A0A0S2SXL1	Bacillus_phage	27.8	8.5e-37
AVM24889.1|2690142_2690943_-|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	40.9	1.4e-47
AVM24890.1|2690948_2693768_-	hypothetical protein	NA	A0A2H4J228	uncultured_Caudovirales_phage	54.8	1.0e-169
AVM24891.1|2694005_2694350_-	hypothetical protein	NA	A0A2H4J224	uncultured_Caudovirales_phage	62.3	2.2e-37
AVM24892.1|2694349_2694952_-|tail	phage tail protein	tail	A0A2H4J534	uncultured_Caudovirales_phage	69.2	7.1e-76
AVM24893.1|2694952_2695282_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	48.6	3.8e-23
AVM24894.1|2695278_2695635_-	hypothetical protein	NA	A0A2H4JAN0	uncultured_Caudovirales_phage	53.5	3.0e-26
AVM24895.1|2695631_2695931_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AVM24896.1|2695920_2696196_-	DNA-packaging protein	NA	A0A1L2BY95	Clostridium_phage	51.6	3.1e-18
AVM24897.1|2696188_2696449_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24898.1|2696477_2697734_-|capsid	phage major capsid protein	capsid	R9TQG7	Paenibacillus_phage	51.7	9.6e-91
AVM24899.1|2697754_2698435_-	peptidase	NA	A0A0A8WFM9	Clostridium_phage	59.0	3.6e-68
AVM24900.1|2698373_2699624_-|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	57.9	4.7e-122
AVM24901.1|2699642_2701328_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	73.3	3.9e-249
AVM24902.1|2701324_2701696_-	hypothetical protein	NA	R9TQ46	Paenibacillus_phage	53.6	4.0e-21
AVM24903.1|2701802_2702111_-	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	61.5	6.7e-30
AVM24904.1|2702111_2702297_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24905.1|2702427_2703201_-	hypothetical protein	NA	NA	NA	NA	NA
AVM26180.1|2703269_2703509_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24906.1|2703655_2704009_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24907.1|2704336_2704879_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	3.9e-57
AVM26181.1|2704875_2705313_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	52.9	2.0e-35
AVM24908.1|2705588_2705777_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24909.1|2705964_2706156_-	hypothetical protein	NA	A0A1P8CWV4	Bacillus_phage	69.8	5.6e-19
AVM24910.1|2706168_2706594_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	91.5	1.0e-68
AVM24911.1|2706590_2706773_-	hypothetical protein	NA	A0A2I6UHR5	Bacillus_phage	61.8	3.1e-11
AVM24912.1|2706769_2707129_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24913.1|2707298_2707682_-	hypothetical protein	NA	Q5YA89	Bacillus_phage	36.4	2.1e-12
AVM24914.1|2707681_2708338_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	45.1	1.2e-36
AVM24915.1|2708334_2708559_-	hypothetical protein	NA	A0A143FIB4	Bacillus_phage	50.0	4.4e-15
AVM24916.1|2708555_2708774_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24917.1|2710056_2710305_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	81.5	1.0e-28
AVM24918.1|2710301_2710646_-	hypothetical protein	NA	A0A2H4JCD8	uncultured_Caudovirales_phage	75.4	1.9e-41
AVM24919.1|2710681_2710891_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.2	1.5e-09
AVM24920.1|2711399_2711930_-	hypothetical protein	NA	NA	NA	NA	NA
AVM24921.1|2712292_2713114_-	hypothetical protein	NA	A0A0U3U1U1	Bacillus_phage	40.4	8.2e-51
AVM24922.1|2713097_2713958_-	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	54.8	5.4e-69
AVM24923.1|2714301_2714502_-	transcriptional regulator	NA	NA	NA	NA	NA
AVM24924.1|2714661_2715081_+	XRE family transcriptional regulator	NA	A5GZ65	Lactococcus_phage	28.5	2.0e-05
2714896:2714911	attR	GAAGAAGAAAGAGATC	NA	NA	NA	NA
AVM24925.1|2715442_2716531_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	27.5	1.6e-14
AVM24926.1|2716681_2716870_-	helix-turn-helix transcriptional regulator	NA	A0A290GJH9	Caldibacillus_phage	81.0	9.7e-16
>prophage 14
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	2920438	2992224	3937399	transposase,terminase,capsid,tail,holin,protease,portal	Clostridium_phage(21.43%)	83	NA	NA
AVM25118.1|2920438_2921564_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	59.7	2.9e-38
AVM25119.1|2921625_2922102_-	nucleoside triphosphatase YtkD	NA	NA	NA	NA	NA
AVM25120.1|2922349_2923003_+	stress protein	NA	NA	NA	NA	NA
AVM25121.1|2923025_2923817_+	tryptophan RNA-binding attenuation protein	NA	NA	NA	NA	NA
AVM25122.1|2923847_2924156_-	hydrolase	NA	NA	NA	NA	NA
AVM25123.1|2924200_2924605_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25124.1|2924759_2924951_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25125.1|2925075_2925513_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	64.8	3.1e-49
AVM25126.1|2925644_2925791_+	YtzI protein	NA	NA	NA	NA	NA
AVM25127.1|2925799_2926237_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25128.1|2926355_2926829_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AVM25129.1|2926955_2927180_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	1.6e-25
AVM25130.1|2927181_2927748_-	carbonic anhydrase	NA	NA	NA	NA	NA
AVM25131.1|2927963_2928953_+	adhesin	NA	NA	NA	NA	NA
AVM25132.1|2929226_2929469_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AVM25133.1|2929451_2929649_+	hypothetical protein	NA	NA	NA	NA	NA
AVM25134.1|2929645_2930977_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AVM25135.1|2930992_2932045_+	hypothetical protein	NA	NA	NA	NA	NA
AVM26188.1|2932113_2932272_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
AVM25136.1|2932297_2932489_+	hypothetical protein	NA	NA	NA	NA	NA
AVM25137.1|2932603_2933728_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
AVM25138.1|2933724_2935176_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	35.8	1.5e-79
AVM25139.1|2935246_2936065_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AVM25140.1|2936079_2936904_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVM25141.1|2936888_2938631_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
AVM25142.1|2938623_2940042_-	isochorismate synthase	NA	NA	NA	NA	NA
AVM25143.1|2940423_2941362_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
AVM25144.1|2941486_2942221_+	hypothetical protein	NA	NA	NA	NA	NA
AVM25145.1|2942307_2942784_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
AVM25146.1|2950759_2951335_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
AVM25147.1|2951426_2951615_+	hypothetical protein	NA	NA	NA	NA	NA
AVM25148.1|2951574_2952129_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVM25149.1|2952331_2953879_-	flotillin	NA	A0A2I2L4B2	Orpheovirus	28.4	9.5e-08
AVM25150.1|2953890_2954421_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25151.1|2954596_2955106_+	DinB family protein	NA	NA	NA	NA	NA
AVM25152.1|2955146_2956355_-	NAD-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AVM25153.1|2956382_2957852_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVM25154.1|2958059_2958617_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVM25155.1|2958815_2959004_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25156.1|2959116_2959920_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	67.3	3.0e-61
AVM25157.1|2959939_2960203_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	70.1	5.9e-27
AVM25158.1|2960215_2960428_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	53.6	5.1e-13
AVM25159.1|2960464_2960605_-	XkdX family protein	NA	NA	NA	NA	NA
AVM25160.1|2960678_2960858_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25161.1|2961032_2962163_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25162.1|2962170_2962344_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	44.9	2.6e-07
AVM25163.1|2962340_2962670_-|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	33.7	2.2e-07
AVM25164.1|2962680_2963559_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25165.1|2963573_2963957_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25166.1|2963968_2964892_-	hypothetical protein	NA	A0A0A7RTT8	Clostridium_phage	29.2	9.4e-11
AVM25167.1|2964875_2965925_-|portal	phage portal protein	portal	S6AVU3	Thermus_phage	43.5	1.1e-68
AVM25168.1|2965917_2966340_-|portal	phage portal protein	portal	NA	NA	NA	NA
AVM25169.1|2966354_2966621_-|portal	phage portal protein	portal	S6C459	Thermus_phage	36.4	1.4e-07
AVM25170.1|2966617_2967628_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	29.2	1.2e-35
AVM25171.1|2967639_2968308_-|portal	phage portal protein	portal	A0A0K2SUI2	Clostridium_phage	30.1	5.9e-23
AVM26189.1|2968300_2972362_-	transglycosylase	NA	A0A1L2JY60	Aeribacillus_phage	48.4	7.5e-44
AVM26190.1|2972419_2972557_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25172.1|2972598_2973039_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.8	9.9e-11
AVM25173.1|2973568_2974012_-|portal	phage portal protein	portal	A0A0A7RVP1	Clostridium_phage	46.5	7.6e-27
AVM25174.1|2974013_2975360_-|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	39.3	2.1e-75
AVM25175.1|2975363_2975576_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25176.1|2975562_2976018_-|portal	phage portal protein	portal	NA	NA	NA	NA
AVM25177.1|2976022_2976520_-|portal	phage portal protein	portal	A0A249XXA4	Clostridium_phage	45.0	1.6e-36
AVM25178.1|2976516_2976873_-	DUF3599 domain-containing protein	NA	NA	NA	NA	NA
AVM25179.1|2976869_2977253_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25180.1|2977266_2978190_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.3	3.3e-109
AVM25181.1|2978212_2979301_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	42.1	1.2e-62
AVM25182.1|2979339_2980797_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	52.5	5.4e-138
AVM25183.1|2980793_2982107_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	61.8	1.3e-151
AVM25184.1|2982103_2982748_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	45.5	8.5e-43
AVM25185.1|2982900_2983419_-	Fis family transcriptional regulator	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	45.0	9.8e-34
AVM25186.1|2983545_2983752_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	68.5	2.6e-14
AVM26191.1|2984201_2984432_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25187.1|2984570_2984834_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVM25188.1|2984992_2985370_+	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.0	2.1e-17
AVM25189.1|2985573_2985924_+	hypothetical protein	NA	NA	NA	NA	NA
AVM25190.1|2986073_2987069_+	biotin synthase BioB	NA	NA	NA	NA	NA
AVM25191.1|2987225_2987699_-	stress protein	NA	NA	NA	NA	NA
AVM25192.1|2987869_2988703_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AVM25193.1|2988831_2989974_-	AI-2E family transporter	NA	NA	NA	NA	NA
AVM25194.1|2990038_2990431_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25195.1|2990632_2991637_+	oxidoreductase	NA	NA	NA	NA	NA
AVM25196.1|2991699_2992224_-|protease	protease	protease	NA	NA	NA	NA
>prophage 15
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	3296446	3305452	3937399		Streptococcus_phage(33.33%)	10	NA	NA
AVM25477.1|3296446_3297424_+	bifunctional glyoxylate/hydroxypyruvate reductase B	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	25.6	3.9e-23
AVM25478.1|3297608_3298097_+	ribonuclease	NA	NA	NA	NA	NA
AVM25479.1|3298146_3298890_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
AVM25480.1|3298929_3299187_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AVM25481.1|3299213_3300164_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	37.5	1.6e-50
AVM25482.1|3300181_3301141_-	hypothetical protein	NA	A1IMD5	Streptococcus_phage	39.8	2.1e-61
AVM25483.1|3301141_3302065_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	26.3	4.5e-05
AVM25484.1|3302068_3302533_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVM26208.1|3302890_3303841_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.8	6.3e-87
AVM25485.1|3304075_3305452_-	peptidase C40	NA	A0A0A0RVE6	Bacillus_phage	52.6	2.6e-25
>prophage 16
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	3327521	3389200	3937399	terminase,capsid,tail,head,holin,protease,portal	Bacillus_phage(38.89%)	71	NA	NA
AVM25508.1|3327521_3327908_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AVM25509.1|3327908_3328103_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25510.1|3328109_3329201_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
AVM25511.1|3329212_3329548_-	hypothetical protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	32.4	2.1e-05
AVM25512.1|3329745_3329976_+	hypothetical protein	NA	NA	NA	NA	NA
AVM25513.1|3330059_3332936_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
AVM25514.1|3332943_3334929_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AVM25515.1|3335231_3335477_-	DUF2198 domain-containing protein	NA	NA	NA	NA	NA
AVM25516.1|3335758_3338290_+	phosphotransferase	NA	A0A1V0SGR7	Hokovirus	32.2	3.7e-33
AVM25517.1|3338380_3338953_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVM25518.1|3338993_3340328_+	MFS transporter	NA	NA	NA	NA	NA
AVM25519.1|3340604_3341588_+	hypothetical protein	NA	NA	NA	NA	NA
AVM25520.1|3341584_3342271_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.4	4.2e-40
AVM25521.1|3342267_3343704_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.5	2.5e-42
AVM25522.1|3343837_3345946_+	mannosyltransferase	NA	NA	NA	NA	NA
AVM25523.1|3345977_3346970_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	40.7	2.0e-59
AVM25524.1|3347015_3348365_-	amino acid permease	NA	NA	NA	NA	NA
AVM25525.1|3348755_3349430_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
AVM25526.1|3350140_3350686_+	hypothetical protein	NA	NA	NA	NA	NA
AVM25527.1|3350705_3351023_+	hypothetical protein	NA	NA	NA	NA	NA
AVM25528.1|3351129_3351357_-	DNA-binding protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	51.4	3.2e-13
AVM26209.1|3351353_3351542_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25529.1|3351926_3352310_+	hypothetical protein	NA	NA	NA	NA	NA
AVM25530.1|3352336_3353137_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	55.0	5.4e-63
AVM25531.1|3353197_3353461_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	73.6	6.3e-29
AVM25532.1|3353484_3353697_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	54.5	1.1e-12
AVM25533.1|3353736_3353883_-	XkdX family protein	NA	NA	NA	NA	NA
AVM25534.1|3353879_3354155_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	41.9	6.0e-14
AVM25535.1|3354167_3355772_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	44.7	2.0e-45
AVM25536.1|3355783_3357649_-	hypothetical protein	NA	A0A2H4JFY2	uncultured_Caudovirales_phage	30.1	6.7e-08
AVM25537.1|3357661_3359539_-	autolysin	NA	D6R400	Bacillus_phage	30.3	7.4e-63
AVM25538.1|3359541_3360372_-|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	34.4	4.8e-30
AVM25539.1|3360365_3364589_-	hypothetical protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	49.1	8.5e-59
AVM25540.1|3364798_3365170_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25541.1|3365169_3365793_-	hypothetical protein	NA	A0A1J0MFV0	Staphylococcus_phage	31.9	1.6e-14
AVM25542.1|3365789_3366173_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25543.1|3366175_3366586_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25544.1|3366554_3366968_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25545.1|3366906_3367173_-	hypothetical protein	NA	A0A1B1P7M9	Bacillus_phage	47.6	6.2e-16
AVM25546.1|3367150_3368416_-|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	50.0	7.4e-83
AVM25547.1|3368412_3369003_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	60.3	8.8e-55
AVM25548.1|3368995_3370174_-|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	51.0	8.9e-107
AVM25549.1|3370185_3371940_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	55.3	3.0e-191
AVM25550.1|3371939_3372350_-|terminase	terminase small subunit	terminase	A0A1B0T688	Bacillus_phage	43.5	1.4e-22
AVM25551.1|3372353_3372797_-	endonuclease	NA	A0A1B0T6C5	Bacillus_phage	55.3	6.2e-29
AVM25552.1|3372793_3373072_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25553.1|3373058_3373259_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25554.1|3373400_3373640_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25555.1|3373815_3374391_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25556.1|3374455_3374890_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	47.8	3.5e-32
AVM25557.1|3374879_3375401_-	Fis family transcriptional regulator	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	47.5	1.4e-32
AVM25558.1|3375397_3375589_-	hypothetical protein	NA	NA	NA	NA	NA
AVM26210.1|3375687_3375882_-	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	37.3	6.1e-05
AVM25559.1|3376170_3376386_-	hypothetical protein	NA	A0A0U4B0C8	Bacillus_phage	50.0	2.2e-08
AVM25560.1|3376382_3377711_-	replicative DNA helicase	NA	W8EEZ1	Geobacillus_phage	54.4	2.0e-131
AVM25561.1|3377707_3378067_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25562.1|3378059_3378833_-	Replication protein O	NA	A0A2P1JTY8	Anoxybacillus_phage	52.4	4.4e-46
AVM25563.1|3378843_3379248_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25564.1|3379421_3380174_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25565.1|3380306_3380819_+	hypothetical protein	NA	NA	NA	NA	NA
AVM25566.1|3380960_3381311_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25567.1|3381682_3382387_-	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	64.9	6.6e-81
AVM25568.1|3382527_3382800_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25569.1|3382880_3383120_-	XRE family transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	72.1	2.2e-20
AVM25570.1|3383236_3383596_+	XRE family transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	55.6	8.7e-13
AVM25571.1|3383602_3384085_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	57.0	7.0e-42
AVM25572.1|3384129_3385287_+	recombinase XerC	NA	A0A1S5S7K9	Streptococcus_phage	31.2	1.3e-30
AVM25573.1|3385423_3385789_+	transcriptional regulator	NA	NA	NA	NA	NA
AVM25574.1|3385798_3386971_-	cell division protein	NA	NA	NA	NA	NA
AVM25575.1|3387054_3387408_-	Swarming motility protein SwrAA	NA	NA	NA	NA	NA
AVM25576.1|3387751_3389200_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	27.6	6.6e-19
>prophage 17
CP027116	Bacillus pumilus strain 145 chromosome, complete genome	3937399	3597843	3638236	3937399	coat,protease,transposase,tRNA	Escherichia_phage(33.33%)	46	NA	NA
AVM25770.1|3597843_3599517_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AVM25771.1|3599513_3599936_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AVM25772.1|3600060_3600408_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25773.1|3600477_3601350_-	agmatinase	NA	NA	NA	NA	NA
AVM25774.1|3601419_3602250_-	spermidine synthase	NA	NA	NA	NA	NA
AVM25775.1|3602475_3604545_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVM25776.1|3604670_3605189_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25777.1|3605201_3605864_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AVM25778.1|3605971_3606157_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AVM25779.1|3606207_3607020_-	peptidase M84	NA	NA	NA	NA	NA
AVM25780.1|3607244_3607745_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25781.1|3607775_3609077_-	hypothetical protein	NA	A0A1V0SGM3	Hokovirus	30.3	2.1e-24
AVM25782.1|3609246_3609468_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AVM25783.1|3609706_3610510_+	Prespore-specific transcriptional regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	49.3	1.6e-06
AVM25784.1|3610544_3610778_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25785.1|3610799_3611645_-	lipoyl-[GcvH]:protein N-lipoyltransferase	NA	NA	NA	NA	NA
AVM25786.1|3611815_3612208_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AVM25787.1|3612365_3612806_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25788.1|3613709_3614105_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25789.1|3614116_3615652_-|transposase	transposase	transposase	NA	NA	NA	NA
AVM25790.1|3615736_3616063_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25791.1|3616284_3616563_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25792.1|3616555_3616966_-	DUF5082 domain-containing protein	NA	NA	NA	NA	NA
AVM25793.1|3617141_3617408_-	hypothetical protein	NA	NA	NA	NA	NA
AVM25794.1|3617421_3618756_-	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AVM25795.1|3618800_3619676_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AVM25796.1|3619687_3620359_-	S-adenosylmethionine--2-demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
AVM25797.1|3620507_3621359_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVM25798.1|3621494_3622466_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AVM25799.1|3622706_3623477_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
AVM25800.1|3623544_3624705_+	MFS transporter	NA	NA	NA	NA	NA
AVM25801.1|3624718_3625198_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AVM25802.1|3625343_3626576_+	MFS transporter	NA	NA	NA	NA	NA
AVM25803.1|3626726_3627329_+	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AVM25804.1|3627330_3628038_+	cupin	NA	NA	NA	NA	NA
AVM25805.1|3628034_3628796_+	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	3.6e-24
AVM25806.1|3628811_3630233_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
AVM26221.1|3630268_3631441_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVM26222.1|3631454_3632252_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AVM25807.1|3632345_3632801_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVM25808.1|3632793_3633648_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	4.3e-34
AVM25809.1|3633651_3634617_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	45.6	3.9e-76
AVM25810.1|3634613_3635354_-	glucose-1-phosphate thymidylyltransferase	NA	G3MA50	Bacillus_virus	40.3	1.0e-44
AVM25811.1|3635356_3636385_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVM25812.1|3636381_3637122_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVM25813.1|3637111_3638236_-|coat	spore coat protein	coat	NA	NA	NA	NA
