The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031691	Haemophilus influenzae strain P615-8618 chromosome, complete genome	1840062	156334	166514	1840062		Bacillus_phage(33.33%)	12	NA	NA
AXP65747.1|156334_157351_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	44.9	3.9e-74
AXP65748.1|157416_157830_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXP65749.1|157880_158564_+	response regulator	NA	W8CYM9	Bacillus_phage	38.8	5.8e-34
AXP67264.1|158658_159006_+	hypothetical protein	NA	W8CYF6	Bacillus_phage	36.1	1.1e-09
AXP65750.1|159038_160010_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L3L6	Tupanvirus	27.4	3.6e-29
AXP65751.1|160220_162020_+	fumarate reductase (quinol) flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	24.9	3.8e-16
AXP65752.1|162012_162783_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AXP65753.1|162793_163204_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
AXP65754.1|163216_163561_+	fumarate reductase subunit D	NA	NA	NA	NA	NA
AXP65755.1|163667_164408_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AXP65756.1|164394_164700_-	trp operon repressor	NA	NA	NA	NA	NA
AXP65757.1|164732_166514_-	lytic murein transglycosylase	NA	K4NWI2	Pseudomonas_phage	39.5	4.5e-17
>prophage 2
CP031691	Haemophilus influenzae strain P615-8618 chromosome, complete genome	1840062	744214	805998	1840062	tail,tRNA,head,transposase	Burkholderia_virus(23.08%)	60	NA	NA
AXP66291.1|744214_745657_+|tRNA	glutamate--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	35.2	1.7e-11
AXP66292.1|745957_746674_+	ribonuclease PH	NA	NA	NA	NA	NA
AXP66293.1|746697_747339_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AXP66294.1|747417_748284_+	co-chaperone DjlA	NA	NA	NA	NA	NA
AXP66295.1|748283_749216_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
AXP66296.1|749255_750101_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	2.1e-41
AXP66297.1|750226_751252_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
AXP66298.1|751261_752965_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
AXP66299.1|753006_753606_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AXP66300.1|753688_754045_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXP66301.1|754140_756903_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
AXP66302.1|756914_758612_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
AXP66303.1|758687_760847_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
AXP66304.1|761169_762213_-	ADP-heptose--LPS heptosyltransferase I	NA	NA	NA	NA	NA
AXP66305.1|762289_763015_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
AXP66306.1|763026_763614_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	31.8	9.8e-14
AXP66307.1|763763_764660_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
AXP66308.1|765096_765420_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AXP66309.1|765592_766240_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AXP66310.1|766350_767247_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AXP66311.1|767347_767815_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
AXP66312.1|767982_768435_+	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AXP66313.1|768438_768882_+	TonB system transport protein ExbD	NA	NA	NA	NA	NA
AXP66314.1|768891_769686_+	energy transducer TonB	NA	NA	NA	NA	NA
AXP66315.1|769863_770370_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	57.5	8.7e-43
AXP66316.1|770523_773355_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
AXP66317.1|773695_777847_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	35.0	1.9e-87
AXP66318.1|778239_778734_-	ci repressor-like protein	NA	NA	NA	NA	NA
AXP66319.1|779115_781017_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	34.0	4.4e-79
AXP66320.1|781043_781961_+	DNA transposition protein	NA	A0A2I7S9C3	Vibrio_phage	43.4	4.0e-62
AXP66321.1|781960_782161_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66322.1|783267_783804_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	42.8	3.0e-33
AXP66323.1|784475_784832_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXP66324.1|784831_785365_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AXP66325.1|785790_785976_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66326.1|785996_786353_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66327.1|786436_786988_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	68.2	4.2e-75
AXP66328.1|786990_787215_+	hypothetical protein	NA	NA	NA	NA	NA
AXP67275.1|787351_787588_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	74.6	1.8e-19
AXP66329.1|787544_787832_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
AXP66330.1|788269_788575_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	57.6	1.1e-24
AXP67276.1|789233_790721_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	61.5	1.6e-161
AXP66331.1|792141_793419_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	47.6	1.6e-53
AXP66332.1|793605_793794_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66333.1|793996_794497_+	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	34.6	4.3e-18
AXP66334.1|794739_795843_+	peptidase	NA	A4JWJ9	Burkholderia_virus	39.2	1.2e-65
AXP66335.1|795861_796788_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	47.9	3.0e-73
AXP66336.1|796853_797117_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66337.1|797116_797551_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	36.4	4.4e-19
AXP66338.1|797562_798060_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66339.1|798069_799455_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	44.1	1.3e-96
AXP66340.1|799465_799984_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	45.6	6.6e-38
AXP66341.1|800078_800354_+|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	36.8	1.0e-05
AXP66342.1|800374_800515_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXP66343.1|800530_800764_-	hypothetical protein	NA	NA	NA	NA	NA
AXP66344.1|800800_803014_+|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	44.4	4.8e-69
AXP66345.1|803013_803946_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	29.9	1.6e-18
AXP66346.1|803926_804157_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	46.3	4.7e-12
AXP67277.1|805046_805466_-	hypothetical protein	NA	A0A0R6PHZ9	Moraxella_phage	33.6	6.3e-07
AXP66347.1|805512_805998_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	32.8	3.3e-07
>prophage 3
CP031691	Haemophilus influenzae strain P615-8618 chromosome, complete genome	1840062	1354027	1359552	1840062		Mannheimia_phage(50.0%)	8	NA	NA
AXP66813.1|1354027_1354279_-	phage antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	72.7	2.3e-28
AXP66814.1|1354928_1355099_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AXP66815.1|1355448_1356420_-	SppA protein	NA	NA	NA	NA	NA
AXP66816.1|1356474_1357131_-	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	57.9	2.1e-65
AXP66817.1|1357261_1357468_+	XRE family transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	67.7	1.9e-17
AXP66818.1|1357488_1357785_+	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	70.4	3.4e-31
AXP66819.1|1357832_1358501_+	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	52.1	2.0e-55
AXP66820.1|1359375_1359552_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	93.1	8.5e-22
>prophage 4
CP031691	Haemophilus influenzae strain P615-8618 chromosome, complete genome	1840062	1427071	1522015	1840062	portal,terminase,tRNA,integrase,holin,tail	Haemophilus_phage(12.07%)	110	1439187:1439209	1481752:1481774
AXP66869.1|1427071_1428037_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AXP66870.1|1428079_1428958_-	cytidine deaminase	NA	NA	NA	NA	NA
AXP66871.1|1429231_1429714_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AXP66872.1|1430182_1431421_-	peptidase T	NA	NA	NA	NA	NA
AXP66873.1|1431686_1432835_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	37.1	1.9e-29
AXP66874.1|1432818_1433679_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.2	7.6e-15
AXP66875.1|1433678_1434449_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
AXP66876.1|1434521_1435661_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AXP66877.1|1437241_1437598_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66878.1|1437707_1437902_-	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
AXP66879.1|1437837_1438077_-	DNA cytosine methyltransferase	NA	A0A2H4PAK4	Aphanizomenon_phage	44.1	1.0e-06
AXP66880.1|1438070_1438289_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66881.1|1438269_1439700_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	E3SJ88	Synechococcus_phage	44.6	4.1e-21
1439187:1439209	attL	CATTCGCTTTACGTGCAATTTGA	NA	NA	NA	NA
AXP66882.1|1439796_1440732_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.0	2.6e-53
AXP66883.1|1440805_1442704_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.9	2.1e-97
AXP66884.1|1442771_1445015_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.6	3.7e-85
AXP66885.1|1445056_1446271_+	sodium/glutamate symport carrier protein	NA	NA	NA	NA	NA
AXP66886.1|1446309_1447218_-	RimK family alpha-L-glutamate ligase	NA	A0A1D7SA11	Synechococcus_phage	34.0	1.0e-33
AXP66887.1|1447334_1447598_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.1	9.4e-25
AXP66888.1|1447664_1448885_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AXP66889.1|1449033_1451046_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AXP67290.1|1451128_1452124_+	protein licA	NA	NA	NA	NA	NA
AXP66890.1|1452123_1453002_+	DMT family transporter	NA	NA	NA	NA	NA
AXP66891.1|1452998_1453700_+|holin	CTP--phosphocholine cytidylyltransferase	holin	NA	NA	NA	NA
AXP66892.1|1453699_1454497_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	51.1	2.1e-06
AXP66893.1|1454534_1456382_-	signal peptide peptidase SppA	NA	A0A2I6UG67	Salinibacter_virus	28.0	3.0e-16
AXP66894.1|1456479_1457034_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AXP66895.1|1457631_1458240_-	flavodoxin family protein	NA	NA	NA	NA	NA
AXP66896.1|1458359_1459604_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
AXP66897.1|1459888_1460329_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
AXP66898.1|1460398_1461487_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LYN9	Serratia_phage	47.0	7.8e-81
AXP67291.1|1461704_1462955_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AXP66899.1|1462954_1463638_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.1	5.6e-37
AXP66900.1|1463719_1464361_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AXP66901.1|1464370_1465153_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AXP66902.1|1465140_1465788_-	DUF452 family protein	NA	NA	NA	NA	NA
AXP66903.1|1465797_1466940_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AXP66904.1|1466926_1468234_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
AXP66905.1|1468252_1469434_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
AXP66906.1|1469433_1470381_-	2-hydroxyacid dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	31.4	3.9e-28
AXP66907.1|1470440_1471295_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.9	2.9e-46
AXP66908.1|1471309_1472113_-	hypothetical protein	NA	NA	NA	NA	NA
AXP66909.1|1472112_1472991_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXP66910.1|1472990_1473461_-	RDD family protein	NA	NA	NA	NA	NA
AXP66911.1|1473483_1474569_-	peptide chain release factor 1	NA	G0YKC3	Acinetobacter_phage	52.8	6.3e-06
AXP66912.1|1474655_1475192_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AXP66913.1|1475465_1476167_-	hypothetical protein	NA	B7SDN5	Haemophilus_phage	62.1	5.7e-77
AXP67292.1|1476178_1476340_-	DUF935 family protein	NA	B7SDN1	Haemophilus_phage	66.7	1.5e-12
AXP66914.1|1476338_1476815_+	pyruvate kinase	NA	NA	NA	NA	NA
AXP66915.1|1476828_1477131_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66916.1|1477141_1477642_+	hypothetical protein	NA	B3GVZ0	Streptococcus_phage	40.2	1.7e-22
AXP66917.1|1477641_1477926_+	hypothetical protein	NA	A0A0M3LP12	Mannheimia_phage	51.1	1.1e-18
AXP66918.1|1477956_1478958_-|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	62.2	1.0e-111
AXP66919.1|1479407_1479830_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	65.5	6.1e-50
AXP66920.1|1479896_1480499_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	71.5	1.3e-72
AXP67293.1|1480510_1482121_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	61.4	4.2e-200
1481752:1481774	attR	CATTCGCTTTACGTGCAATTTGA	NA	NA	NA	NA
AXP66921.1|1482317_1485968_-|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	37.2	3.8e-140
AXP66922.1|1485971_1486691_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	39.7	1.0e-33
AXP66923.1|1486629_1487337_-	hypothetical protein	NA	A0A1B1IV85	uncultured_Mediterranean_phage	43.2	2.6e-53
AXP66924.1|1487338_1487989_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	39.6	3.3e-34
AXP66925.1|1488725_1489259_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AXP66926.1|1489320_1489665_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	41.3	8.6e-18
AXP66927.1|1489665_1492044_-	hypothetical protein	NA	H6WRV7	Salmonella_phage	32.0	1.5e-28
AXP66928.1|1491985_1492291_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXP66929.1|1492353_1492737_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXP66930.1|1492742_1493243_-|tail	phage tail protein	tail	O64327	Escherichia_phage	56.1	7.5e-39
AXP66931.1|1493235_1493640_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	31.3	6.3e-12
AXP66932.1|1493636_1494182_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	40.6	1.9e-27
AXP66933.1|1494181_1494487_-	hypothetical protein	NA	NA	NA	NA	NA
AXP66934.1|1494467_1494791_-	DUF2190 family protein	NA	NA	NA	NA	NA
AXP66935.1|1496848_1498372_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	58.3	4.9e-158
AXP66936.1|1498375_1498594_-	hypothetical protein	NA	NA	NA	NA	NA
AXP66937.1|1498590_1500711_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	66.7	1.1e-272
AXP66938.1|1500713_1501187_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	52.3	7.1e-39
AXP66939.1|1501463_1501853_-	hypothetical protein	NA	NA	NA	NA	NA
AXP66940.1|1501894_1502176_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	72.2	1.4e-29
AXP66941.1|1502087_1502411_-	DUF2570 domain-containing protein	NA	Q7Y5U9	Haemophilus_phage	55.1	3.5e-21
AXP66942.1|1502403_1503006_-	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	55.4	3.9e-58
AXP66943.1|1502971_1503331_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AXP66944.1|1503570_1504089_-	antitermination protein	NA	G8C7V7	Escherichia_phage	34.0	3.4e-18
AXP66945.1|1504089_1504635_-	recombination protein NinG	NA	D0UIK8	Aggregatibacter_phage	71.9	8.1e-63
AXP66946.1|1504723_1505143_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	83.3	3.1e-62
AXP66947.1|1505179_1505398_-	hypothetical protein	NA	A0A0M3LPX7	Mannheimia_phage	59.7	1.3e-16
AXP66948.1|1505397_1506321_-	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	58.5	1.7e-97
AXP66949.1|1506317_1506899_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	56.0	7.6e-51
AXP66950.1|1506895_1507531_-	replication P	NA	A0A1P8DTF3	Proteus_phage	35.5	3.5e-17
AXP66951.1|1507515_1508274_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	68.3	3.6e-61
AXP66952.1|1508270_1508939_-	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	54.3	5.7e-58
AXP66953.1|1508984_1509209_-	transcriptional regulator	NA	D0UIL8	Aggregatibacter_phage	53.2	2.7e-12
AXP66954.1|1509345_1510257_+	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	40.5	8.0e-39
AXP66955.1|1510267_1511965_+	hypothetical protein	NA	D0UIM0	Aggregatibacter_phage	86.5	2.2e-287
AXP66956.1|1511955_1512156_-	hypothetical protein	NA	NA	NA	NA	NA
AXP66957.1|1512239_1512410_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AXP66958.1|1512424_1512646_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66959.1|1513498_1513750_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66960.1|1513739_1514765_+	endonuclease	NA	A0A0M3LQ72	Mannheimia_phage	47.0	1.7e-24
AXP66961.1|1514815_1515157_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66962.1|1515156_1515345_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AXP66963.1|1515675_1516176_+	hypothetical protein	NA	B4XYS3	Lactobacillus_phage	36.6	4.7e-17
AXP66964.1|1516186_1516840_+	hypothetical protein	NA	A0A077KCB6	Edwardsiella_phage	51.6	3.9e-27
AXP66965.1|1516849_1517284_+	single-stranded DNA-binding protein	NA	A0A059WRL7	Vibrio_phage	36.2	9.8e-19
AXP66966.1|1517343_1517523_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	62.1	1.8e-11
AXP66967.1|1517842_1518079_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66968.1|1518075_1518435_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66969.1|1518442_1519612_+	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7R2G4	Vibrio_phage	46.9	3.0e-94
AXP66970.1|1519608_1519851_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66971.1|1519847_1520126_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AXP66972.1|1520129_1520441_+	hypothetical protein	NA	NA	NA	NA	NA
AXP66973.1|1520570_1520771_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXP66974.1|1520767_1522015_-	DUF4102 domain-containing protein	NA	A0A1V0E8G8	Vibrio_phage	37.4	2.1e-74
>prophage 5
CP031691	Haemophilus influenzae strain P615-8618 chromosome, complete genome	1840062	1650101	1658610	1840062		uncultured_Caudovirales_phage(16.67%)	9	NA	NA
AXP67086.1|1650101_1650785_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	51.2	1.0e-54
AXP67087.1|1650777_1651203_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.7	1.3e-20
AXP67088.1|1651203_1651839_+	7-carboxy-7-deazaguanine synthase	NA	S4TZT1	uncultured_phage	30.3	8.7e-16
AXP67297.1|1652228_1652462_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AXP67089.1|1652445_1654629_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.7	3.9e-116
AXP67090.1|1654748_1655720_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXP67091.1|1655734_1656622_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AXP67092.1|1656631_1657624_+	dipeptide transport ATP-binding protein DppD	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-14
AXP67093.1|1657626_1658610_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	1.4e-20
>prophage 6
CP031691	Haemophilus influenzae strain P615-8618 chromosome, complete genome	1840062	1789325	1798346	1840062		Escherichia_phage(83.33%)	9	NA	NA
AXP67217.1|1789325_1791170_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.3	1.1e-21
AXP67218.1|1791247_1791526_-	copper chaperone	NA	NA	NA	NA	NA
AXP67300.1|1791534_1791852_-	hypothetical protein	NA	NA	NA	NA	NA
AXP67219.1|1791871_1792981_-	transglutaminase family protein	NA	NA	NA	NA	NA
AXP67220.1|1793233_1795654_+	twin-arginine translocation signal domain-containing protein	NA	A0A077SK27	Escherichia_phage	50.4	3.1e-223
AXP67221.1|1795664_1796282_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	56.8	4.9e-72
AXP67222.1|1796283_1797123_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	31.9	1.9e-18
AXP67223.1|1797234_1797846_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	32.5	1.7e-21
AXP67224.1|1797845_1798346_+	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	32.0	3.2e-13
