The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031682	Haemophilus influenzae strain P665-7858 chromosome, complete genome	1908143	168821	177802	1908143	transposase	Vibrio_phage(16.67%)	10	NA	NA
AXP60547.1|168821_169838_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	45.2	1.7e-74
AXP60548.1|169903_170317_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXP60549.1|170370_171054_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	40.5	2.0e-34
AXP60550.1|171530_172502_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L3L6	Tupanvirus	27.1	1.2e-27
AXP60551.1|172712_174512_+	fumarate reductase (quinol) flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	24.9	6.5e-16
AXP60552.1|174504_175275_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AXP60553.1|175285_175696_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
AXP60554.1|175707_176052_+	fumarate reductase subunit D	NA	NA	NA	NA	NA
AXP60555.1|176203_177340_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.0	1.6e-121
AXP62151.1|177385_177802_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	66.4	1.2e-50
>prophage 2
CP031682	Haemophilus influenzae strain P665-7858 chromosome, complete genome	1908143	650865	705123	1908143	head,tRNA,tail,integrase,plate,terminase,holin	Haemophilus_phage(15.22%)	75	645747:645763	681840:681856
645747:645763	attL	AAGTGCGGTAAAAATTT	NA	NA	NA	NA
AXP60988.1|650865_651891_-|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	35.4	9.6e-57
AXP60989.1|651788_652103_-	DNA-binding protein	NA	NA	NA	NA	NA
AXP60990.1|652229_652517_-	hypothetical protein	NA	NA	NA	NA	NA
AXP60991.1|652520_653003_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	46.1	1.5e-31
AXP60992.1|653051_654326_-	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7QRH3	Vibrio_phage	46.9	7.7e-96
AXP60993.1|654333_654693_-	hypothetical protein	NA	NA	NA	NA	NA
AXP60994.1|654689_654926_-	hypothetical protein	NA	NA	NA	NA	NA
AXP60995.1|654922_655492_-	hypothetical protein	NA	NA	NA	NA	NA
AXP60996.1|655661_656630_-	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	61.5	1.4e-33
AXP60997.1|657287_657905_-	exonuclease	NA	A0A0M3LPU0	Mannheimia_phage	76.7	1.8e-87
AXP60998.1|657898_658681_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	61.9	1.0e-87
AXP60999.1|658682_659588_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	43.8	2.8e-52
AXP61000.1|659601_659895_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61001.1|659891_660236_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61002.1|660323_661355_-	endonuclease	NA	D0UIK6	Aggregatibacter_phage	79.8	4.1e-39
AXP61003.1|661344_661596_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61004.1|661715_662027_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61005.1|662411_662597_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61006.1|662747_663896_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	36.2	1.7e-30
AXP61007.1|663906_664767_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61008.1|664829_665195_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AXP61009.1|665196_665784_-	recombinase NinG	NA	A0A2I7RAC0	Vibrio_phage	48.5	3.7e-37
AXP61010.1|665872_666292_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	74.6	3.7e-55
AXP61011.1|666366_666933_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	78.3	1.9e-83
AXP61012.1|666929_667565_-	replication P	NA	A0A1P8DTF3	Proteus_phage	33.3	1.6e-17
AXP61013.1|667549_668308_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	68.8	6.2e-61
AXP61014.1|668304_668979_-	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	55.6	5.0e-62
AXP61015.1|669025_669478_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61016.1|669521_669728_-	transcriptional regulator	NA	NA	NA	NA	NA
AXP61017.1|669853_670624_+	XRE family transcriptional regulator	NA	Q76H56	Enterobacteria_phage	26.3	1.1e-15
AXP61018.1|670852_671365_+	kinase	NA	NA	NA	NA	NA
AXP61019.1|671543_671903_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AXP61020.1|671868_672471_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	55.4	3.9e-58
AXP61021.1|672463_672787_+	DUF2570 domain-containing protein	NA	Q7Y5U9	Haemophilus_phage	56.1	9.2e-22
AXP61022.1|672698_672980_+	hypothetical protein	NA	Q776X1	Haemophilus_phage	71.1	1.4e-29
AXP61023.1|672981_673329_-	XRE family transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	57.0	5.2e-23
AXP61024.1|673312_673564_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	52.9	9.9e-16
AXP61025.1|673641_674160_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	39.2	1.6e-20
AXP61026.1|674140_675499_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	52.9	5.1e-122
AXP61027.1|675500_676817_+	DUF1073 domain-containing protein	NA	A0A2K9V3H1	Faecalibacterium_phage	32.0	1.8e-47
AXP61028.1|676797_678015_+|head	phage head morphogenesis protein	head	I3PGT9	Xanthomonas_phage	36.4	6.1e-34
AXP61029.1|678140_679214_+	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	40.2	9.4e-55
AXP61030.1|679224_679644_+	hypothetical protein	NA	NA	NA	NA	NA
AXP61031.1|679651_680653_+	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	36.6	3.8e-50
AXP61032.1|680655_680844_+	hypothetical protein	NA	NA	NA	NA	NA
AXP61033.1|680847_681198_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
AXP61034.1|681190_681649_+	hypothetical protein	NA	A0A2I7R754	Vibrio_phage	35.2	2.8e-16
AXP61035.1|681648_682008_+	hypothetical protein	NA	NA	NA	NA	NA
681840:681856	attR	AAGTGCGGTAAAAATTT	NA	NA	NA	NA
AXP61036.1|682009_682519_+	hypothetical protein	NA	NA	NA	NA	NA
AXP61037.1|682505_683579_+	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	36.0	2.2e-64
AXP61038.1|683624_684050_+	DUF3277 family protein	NA	A0A2K9V3K6	Faecalibacterium_phage	45.9	4.0e-25
AXP61039.1|684049_684532_+	hypothetical protein	NA	NA	NA	NA	NA
AXP61040.1|684716_687098_+|tail	phage tail protein	tail	K7RVL7	Vibrio_phage	28.1	9.1e-34
AXP61041.1|687172_687784_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	43.7	9.9e-17
AXP61042.1|688091_688673_+	hypothetical protein	NA	NA	NA	NA	NA
AXP61043.1|688669_688984_+	hypothetical protein	NA	NA	NA	NA	NA
AXP61044.1|688980_689937_+	hypothetical protein	NA	A0A2K9V3M6	Faecalibacterium_phage	30.0	1.7e-31
AXP61045.1|689939_690611_+|plate	phage baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	35.4	3.7e-17
AXP61046.1|690607_690973_+	hypothetical protein	NA	K4RI30	Pseudomonas_phage	32.6	4.1e-10
AXP61047.1|690965_692402_+	hypothetical protein	NA	E5AGC3	Erwinia_phage	29.2	3.1e-45
AXP61048.1|692410_693037_+	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	37.4	1.4e-21
AXP61049.1|693033_695355_+|tail	phage tail protein	tail	Q94MY0	Haemophilus_virus	76.9	3.7e-290
AXP61050.1|695366_695975_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	82.5	1.3e-82
AXP61051.1|695967_696456_+	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	56.1	8.1e-46
AXP61052.1|696630_696750_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXP61053.1|696811_697657_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	73.2	5.6e-119
AXP61054.1|697696_697960_-	hypothetical protein	NA	F6MIM3	Haemophilus_phage	79.1	1.4e-33
AXP61055.1|698639_699365_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AXP61056.1|699417_699870_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AXP61057.1|699936_701151_+	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.5	1.5e-32
AXP61058.1|701174_701591_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	80.6	2.0e-53
AXP61059.1|701647_701971_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	4.4e-24
AXP61060.1|701983_702508_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
AXP61061.1|702558_703245_+	DUF2625 domain-containing protein	NA	NA	NA	NA	NA
AXP61062.1|703263_705123_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.5	1.8e-109
>prophage 3
CP031682	Haemophilus influenzae strain P665-7858 chromosome, complete genome	1908143	975043	1068855	1908143	tRNA,head,integrase,tail,portal,terminase,holin,capsid	Haemophilus_virus(58.82%)	90	968527:968586	1047171:1047252
968527:968586	attL	AATTGGAGCGGGAAACGAGGCTCGAACTCGCGACCCCGACCTTGGCAAGGTCGTGCTCTA	NA	NA	NA	NA
AXP61299.1|975043_975829_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	A0A291ATS8	Pandoravirus	28.9	1.5e-17
AXP61300.1|975813_976923_-	murein transglycosylase A	NA	NA	NA	NA	NA
AXP61301.1|977317_979453_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	29.9	9.7e-19
AXP61302.1|986243_988475_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
AXP61303.1|988835_989465_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AXP61304.1|989799_991089_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.1	2.5e-94
AXP61305.1|991442_991673_+	heat-shock protein	NA	NA	NA	NA	NA
AXP61306.1|991626_992370_-	threonine/serine exporter	NA	NA	NA	NA	NA
AXP61307.1|992497_993760_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AXP61308.1|994040_995429_+	signal recognition particle protein	NA	NA	NA	NA	NA
AXP61309.1|995485_996241_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AXP61310.1|996541_998437_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	4.9e-115
AXP61311.1|998515_998860_+	ArsC family reductase	NA	NA	NA	NA	NA
AXP61312.1|998887_1000021_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AXP61313.1|1000022_1000703_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
AXP62165.1|1000737_1001793_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	2.0e-25
AXP61314.1|1001794_1003315_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXP61315.1|1003432_1004431_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXP61316.1|1005064_1005820_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXP61317.1|1005908_1006028_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AXP61318.1|1006349_1007609_+	GntP family permease	NA	NA	NA	NA	NA
AXP61319.1|1007617_1008754_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.1	3.8e-54
AXP61320.1|1008793_1009507_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AXP61321.1|1009830_1012278_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
AXP61322.1|1012290_1013235_+	homoserine kinase	NA	NA	NA	NA	NA
AXP61323.1|1013277_1014555_+	threonine synthase	NA	NA	NA	NA	NA
AXP61324.1|1015119_1016133_-|integrase	site-specific integrase	integrase	Q94N03	Haemophilus_virus	99.4	3.1e-193
AXP61325.1|1016135_1016435_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXP61326.1|1016427_1016658_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61327.1|1016694_1016901_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
AXP61328.1|1016901_1017135_-	DUF4177 domain-containing protein	NA	A0A0A7NPW2	Enterobacteria_phage	56.6	4.1e-16
AXP61329.1|1017154_1017577_-	hypothetical protein	NA	NA	NA	NA	NA
AXP62166.1|1017622_1017997_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
AXP61330.1|1018165_1018357_+	hypothetical protein	NA	NA	NA	NA	NA
AXP61331.1|1018353_1018593_+	DNA-binding protein	NA	P79674	Haemophilus_phage	36.5	4.4e-05
AXP61332.1|1018647_1019151_+	hypothetical protein	NA	P79675	Haemophilus_phage	89.2	4.8e-78
AXP61333.1|1019169_1019538_+	hypothetical protein	NA	P79676	Haemophilus_phage	100.0	3.7e-67
AXP61334.1|1019537_1019723_+	hypothetical protein	NA	Q775F8	Haemophilus_virus	100.0	8.0e-31
AXP61335.1|1019734_1020016_+	hypothetical protein	NA	Q775F7	Haemophilus_virus	98.9	1.8e-45
AXP61336.1|1020066_1020327_+	hypothetical protein	NA	Q775F6	Haemophilus_virus	100.0	3.6e-45
AXP61337.1|1020329_1022657_+	replication endonuclease	NA	Q94N00	Haemophilus_virus	99.4	0.0e+00
AXP61338.1|1022668_1022980_+	hypothetical protein	NA	Q94MZ9	Haemophilus_virus	100.0	2.9e-49
AXP61339.1|1022989_1023508_+	phage N-6-adenine-methyltransferase	NA	Q94MZ8	Haemophilus_virus	99.4	2.3e-99
AXP61340.1|1023605_1023782_+	addiction module toxin, HicA family	NA	D6R431	Bacillus_phage	67.8	4.5e-15
AXP61341.1|1023810_1024212_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	100.0	2.3e-70
AXP62167.1|1024239_1024500_-	transcriptional regulator	NA	Q1I103	Pasteurella_virus	53.6	1.6e-21
AXP61342.1|1024580_1025618_-|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	99.7	3.9e-199
AXP61343.1|1025607_1027431_-|terminase	terminase	terminase	Q94MZ6	Haemophilus_virus	100.0	0.0e+00
AXP61344.1|1027634_1028528_+|capsid	phage capsid protein	capsid	Q94MZ5	Haemophilus_virus	99.7	4.5e-151
AXP61345.1|1028530_1029541_+|capsid	phage major capsid protein, P2 family	capsid	Q94MZ4	Haemophilus_virus	95.8	1.4e-180
AXP61346.1|1029554_1030400_+|terminase	terminase	terminase	Q94MZ3	Haemophilus_virus	95.3	4.4e-148
AXP61347.1|1030392_1030845_+|head	head stabilization protein	head	Q94MZ2	Haemophilus_virus	93.3	9.4e-73
AXP61348.1|1030832_1031315_+|tail	phage tail protein	tail	Q94MZ1	Haemophilus_virus	64.8	1.3e-56
AXP61349.1|1031311_1032037_+	phage virion morphogenesis protein	NA	Q1I0Z5	Pasteurella_virus	33.2	1.9e-19
AXP61350.1|1032316_1033447_+	DUF2586 domain-containing protein	NA	Q94MY9	Haemophilus_virus	98.7	4.5e-217
AXP61351.1|1033450_1033903_+	DUF2597 family protein	NA	Q94MY8	Haemophilus_virus	97.9	1.4e-73
AXP61352.1|1033989_1034226_+|holin	holin	holin	Q94MY7	Haemophilus_virus	98.7	1.4e-35
AXP61353.1|1034218_1034779_+	lysozyme	NA	Q94MY6	Haemophilus_virus	88.8	4.4e-88
AXP61354.1|1034763_1035111_+	hypothetical protein	NA	Q94MY5	Haemophilus_virus	97.4	5.7e-54
AXP61355.1|1035070_1035301_+	hypothetical protein	NA	NA	NA	NA	NA
AXP61356.1|1035302_1035611_+	hypothetical protein	NA	Q775G2	Haemophilus_virus	99.0	3.5e-47
AXP61357.1|1035799_1037929_+|tail	phage tail tape measure protein	tail	Q94MY4	Haemophilus_virus	99.4	0.0e+00
AXP61358.1|1037932_1038268_+	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	99.1	2.3e-52
AXP61359.1|1038260_1039430_+	hypothetical protein	NA	Q94MY2	Haemophilus_virus	97.9	6.8e-216
AXP61360.1|1039439_1039964_+|tail	phage tail protein	tail	Q94MY1	Haemophilus_virus	100.0	4.8e-97
AXP61361.1|1039993_1042738_+|tail	phage tail protein	tail	Q94MY0	Haemophilus_virus	93.3	0.0e+00
AXP61362.1|1042749_1043349_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	95.5	2.3e-98
AXP61363.1|1043390_1044158_+	hypothetical protein	NA	Q94MX8	Haemophilus_virus	97.3	3.1e-132
AXP61364.1|1044144_1044708_+	hypothetical protein	NA	Q94MX7	Haemophilus_virus	93.0	2.1e-77
AXP61365.1|1044704_1046306_+	hypothetical protein	NA	Q94MX6	Haemophilus_virus	97.9	1.3e-281
AXP62168.1|1047459_1048605_+	methionine biosynthesis PLP-dependent protein	NA	A0A141ZJM2	Faustovirus	26.5	1.6e-12
1047171:1047252	attR	AATTGGAGCGGGAAACGAGGCTCGAACTCGCGACCCCGACCTTGGCAAGGTCGTGCTCTACCAACTGAGCTATTCCCGCATT	NA	NA	NA	NA
AXP61366.1|1048617_1049613_+	2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	39.9	6.4e-66
AXP61367.1|1049732_1050056_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.4	9.8e-16
AXP61368.1|1050011_1050380_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61369.1|1050390_1050648_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61370.1|1050709_1051498_-	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
AXP61371.1|1051552_1052062_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	32.4	1.6e-12
AXP61372.1|1052164_1053544_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	29.7	8.7e-53
AXP61373.1|1053702_1054566_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AXP61374.1|1054683_1056807_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	62.5	2.0e-258
AXP61375.1|1057088_1057529_+	hypothetical protein	NA	NA	NA	NA	NA
AXP61376.1|1057521_1057866_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
AXP61377.1|1057878_1058505_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXP62169.1|1058575_1059466_+	NAD(+) kinase	NA	NA	NA	NA	NA
AXP61378.1|1059578_1061255_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AXP61379.1|1061275_1064221_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
AXP61380.1|1064227_1065163_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AXP61381.1|1065170_1067072_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.0	1.4e-69
AXP61382.1|1067072_1068371_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N6W8I1	Bacillus_phage	24.5	2.8e-13
AXP61383.1|1068378_1068855_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
>prophage 4
CP031682	Haemophilus influenzae strain P665-7858 chromosome, complete genome	1908143	1116610	1188924	1908143	tRNA,head,transposase,tail,plate	Haemophilus_phage(43.18%)	76	NA	NA
AXP61426.1|1116610_1118035_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AXP61427.1|1118104_1118764_-	uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	47.2	3.5e-52
AXP61428.1|1119021_1119405_+	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	67.0	4.9e-30
AXP61429.1|1119572_1121369_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	42.6	6.5e-24
AXP61430.1|1121377_1122427_+	signal peptidase I	NA	NA	NA	NA	NA
AXP61431.1|1122428_1123112_+	ribonuclease 3	NA	M4QMG4	Micromonas_pusilla_virus	35.6	1.2e-23
AXP61432.1|1123108_1124017_+	GTPase Era	NA	NA	NA	NA	NA
AXP61433.1|1124079_1125072_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
AXP61434.1|1125177_1125582_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
AXP61435.1|1125584_1126025_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AXP61436.1|1126063_1126972_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AXP61437.1|1127041_1127758_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
AXP61438.1|1127750_1128689_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
AXP61439.1|1128690_1131117_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
AXP61440.1|1131165_1131777_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXP61441.1|1132047_1132860_+	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AXP61442.1|1133117_1133582_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AXP61443.1|1133597_1134386_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AXP61444.1|1134422_1136246_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.7	1.8e-45
AXP61445.1|1136415_1137435_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AXP61446.1|1137685_1138312_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.2	2.6e-20
AXP61447.1|1138374_1138641_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AXP61448.1|1138713_1140828_+	guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	38.8	2.5e-11
AXP61449.1|1140824_1142906_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AXP61450.1|1142935_1143745_+	glutamate racemase	NA	NA	NA	NA	NA
AXP61451.1|1143956_1145102_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AXP61452.1|1151733_1151997_+	hypothetical protein	NA	F6MIM3	Haemophilus_phage	76.7	1.2e-32
AXP61453.1|1152035_1152881_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	72.5	4.3e-119
AXP61454.1|1152942_1153062_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXP61455.1|1153237_1153738_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	62.9	7.7e-52
AXP61456.1|1153734_1154337_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	93.0	2.1e-96
AXP62172.1|1154348_1155905_-|tail	phage tail protein	tail	Q94MY0	Haemophilus_virus	68.3	8.3e-153
AXP62173.1|1156160_1156754_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	63.5	3.5e-67
AXP61457.1|1156753_1157818_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	64.3	2.8e-123
AXP61458.1|1157832_1158183_-	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	74.1	3.2e-44
AXP61459.1|1158252_1158888_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	57.8	4.7e-62
AXP61460.1|1158897_1160022_-|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	71.8	4.6e-145
AXP61461.1|1160011_1161346_-	phage morphogenesis protein	NA	F6MIL2	Haemophilus_phage	45.1	5.4e-108
AXP61462.1|1161348_1163637_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	33.6	3.7e-93
AXP61463.1|1163683_1163890_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61464.1|1163904_1164246_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	50.5	1.8e-20
AXP61465.1|1164245_1164617_-|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	65.0	4.0e-37
AXP61466.1|1164626_1166042_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	62.4	1.9e-156
AXP61467.1|1166034_1166217_-	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	63.0	1.8e-11
AXP61468.1|1166188_1166851_-	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	45.0	1.2e-44
AXP61469.1|1166834_1167266_-	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	61.6	1.6e-37
AXP61470.1|1167275_1167611_-	hypothetical protein	NA	B7SDP3	Haemophilus_phage	54.9	5.8e-19
AXP61471.1|1167646_1168567_-|head	head protein	head	A0A0M3LQ11	Mannheimia_phage	62.6	2.3e-110
AXP61472.1|1168566_1169613_-	I protein	NA	B7SDN9	Haemophilus_phage	45.7	3.8e-69
AXP61473.1|1169894_1170320_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	48.2	3.9e-28
AXP61474.1|1170526_1171876_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	30.0	2.1e-43
AXP61475.1|1171862_1173473_-	DUF935 domain-containing protein	NA	B7SDN1	Haemophilus_phage	63.9	1.3e-185
AXP61476.1|1173484_1175131_-	hypothetical protein	NA	B7SDN0	Haemophilus_phage	77.8	3.8e-249
AXP61477.1|1175266_1175770_-	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	51.8	4.1e-45
AXP61478.1|1175771_1176038_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61479.1|1176037_1176295_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61480.1|1176418_1176676_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
AXP61481.1|1176675_1176966_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	61.3	1.4e-16
AXP61482.1|1177119_1177626_-	hypothetical protein	NA	A0A0M3LSH2	Mannheimia_phage	65.4	9.9e-55
AXP61483.1|1177705_1178134_-	mor transcription activator family protein	NA	F6MIJ8	Haemophilus_phage	42.3	4.3e-27
AXP61484.1|1178220_1179120_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61485.1|1179173_1179575_-	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	43.8	2.4e-19
AXP61486.1|1179834_1180074_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61487.1|1180183_1180432_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61488.1|1180435_1180996_-	hypothetical protein	NA	A0A0M3LP85	Mannheimia_phage	25.9	2.5e-14
AXP61489.1|1181098_1181329_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AXP61490.1|1182500_1182674_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AXP61491.1|1182827_1183037_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AXP61492.1|1183221_1183839_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	59.6	3.6e-67
AXP61493.1|1183839_1184031_-	HTH domain-containing protein	NA	F6MII8	Haemophilus_phage	57.6	9.5e-11
AXP61494.1|1184039_1184336_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61495.1|1184346_1185228_-	helix-turn-helix domain-containing protein	NA	A0A0M3LP72	Mannheimia_phage	75.8	9.9e-119
AXP61496.1|1185279_1185696_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61497.1|1185688_1187671_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	54.8	7.8e-188
AXP61498.1|1187714_1187993_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	5.8e-17
AXP61499.1|1188219_1188924_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	37.9	2.7e-18
>prophage 5
CP031682	Haemophilus influenzae strain P665-7858 chromosome, complete genome	1908143	1461868	1476268	1908143	terminase,holin	Haemophilus_phage(43.75%)	23	NA	NA
AXP61716.1|1461868_1462291_-	HD domain-containing protein	NA	D0UIJ3	Aggregatibacter_phage	76.4	5.3e-54
AXP61717.1|1462293_1462512_-	hypothetical protein	NA	Q776X0	Haemophilus_phage	97.2	9.2e-34
AXP61718.1|1463838_1465170_-	DUF1073 domain-containing protein	NA	Q7Y5U6	Haemophilus_phage	84.0	1.7e-210
AXP61719.1|1465171_1466515_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	53.5	4.1e-124
AXP61720.1|1466501_1467014_-|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	39.2	1.0e-19
AXP61721.1|1467080_1467338_+	XRE family transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	66.2	6.0e-16
AXP61722.1|1467531_1467855_-	DUF2570 domain-containing protein	NA	Q7Y5U9	Haemophilus_phage	54.2	5.9e-21
AXP61723.1|1467847_1468450_-	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	54.4	2.5e-57
AXP61724.1|1468418_1468775_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AXP61725.1|1468967_1469495_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61726.1|1469505_1470099_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61727.1|1470275_1470644_-	antitermination protein	NA	Q7Y5V5	Haemophilus_phage	63.4	1.0e-37
AXP61728.1|1470883_1471606_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	68.3	2.7e-61
AXP61729.1|1471602_1472268_-	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	52.1	3.2e-53
AXP61730.1|1472316_1472613_-	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	70.4	2.0e-31
AXP61731.1|1472633_1472840_-	XRE family transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	67.7	1.5e-17
AXP61732.1|1472970_1473627_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	58.4	2.1e-65
AXP61733.1|1473681_1474029_+	hypothetical protein	NA	NA	NA	NA	NA
AXP61734.1|1474013_1474541_+	hypothetical protein	NA	NA	NA	NA	NA
AXP61735.1|1474556_1474991_+	hypothetical protein	NA	Q7Y5W7	Haemophilus_phage	53.8	4.0e-28
AXP61736.1|1475325_1475496_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AXP61737.1|1475510_1475732_+	hypothetical protein	NA	NA	NA	NA	NA
AXP62179.1|1476058_1476268_+	hypothetical protein	NA	D0UIM2	Aggregatibacter_phage	70.1	3.2e-20
>prophage 6
CP031682	Haemophilus influenzae strain P665-7858 chromosome, complete genome	1908143	1593807	1604839	1908143	integrase	Mannheimia_phage(42.86%)	16	1586746:1586765	1610795:1610814
1586746:1586765	attL	AAAGTGCGGTCAAATTTTCC	NA	NA	NA	NA
AXP61860.1|1593807_1594890_-	peptide chain release factor 1	NA	G0YKC3	Acinetobacter_phage	52.8	6.2e-06
AXP61861.1|1595004_1596027_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AXP61862.1|1596524_1597061_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AXP61863.1|1597093_1597231_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61864.1|1597277_1597472_-	hypothetical protein	NA	NA	NA	NA	NA
AXP61865.1|1597434_1597569_-	G protein	NA	NA	NA	NA	NA
AXP61866.1|1597692_1598352_-	hypothetical protein	NA	B7SDN5	Haemophilus_phage	57.7	2.1e-60
AXP62181.1|1598411_1598573_-	DUF935 family protein	NA	B7SDN1	Haemophilus_phage	68.6	1.7e-13
AXP61867.1|1598571_1599042_+	pyruvate kinase	NA	NA	NA	NA	NA
AXP61868.1|1599060_1599252_+	hypothetical protein	NA	NA	NA	NA	NA
AXP61869.1|1599262_1599472_+	hypothetical protein	NA	NA	NA	NA	NA
AXP61870.1|1599484_1600006_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	41.8	1.6e-28
AXP61871.1|1600005_1600290_+	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	51.1	1.1e-18
AXP61872.1|1600320_1601322_-|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	62.5	9.2e-113
AXP61873.1|1601854_1603291_+	pyruvate kinase	NA	NA	NA	NA	NA
AXP61874.1|1603324_1604839_+	replicative DNA helicase	NA	O80281	Escherichia_phage	68.3	4.7e-169
1610795:1610814	attR	AAAGTGCGGTCAAATTTTCC	NA	NA	NA	NA
>prophage 7
CP031682	Haemophilus influenzae strain P665-7858 chromosome, complete genome	1908143	1710988	1719502	1908143		uncultured_Caudovirales_phage(16.67%)	9	NA	NA
AXP61968.1|1710988_1711672_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	49.8	1.1e-53
AXP61969.1|1711664_1712090_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.7	7.8e-21
AXP61970.1|1712090_1712726_+	7-carboxy-7-deazaguanine synthase	NA	S4TZT1	uncultured_phage	30.3	8.7e-16
AXP61971.1|1713120_1713354_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AXP61972.1|1713337_1715521_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	3.0e-116
AXP61973.1|1715640_1716612_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXP61974.1|1716626_1717514_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXP61975.1|1717523_1718516_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.9	6.7e-15
AXP61976.1|1718518_1719502_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	1.8e-20
>prophage 8
CP031682	Haemophilus influenzae strain P665-7858 chromosome, complete genome	1908143	1848612	1860714	1908143		Escherichia_phage(71.43%)	10	NA	NA
AXP62095.1|1848612_1850457_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.6	1.6e-22
AXP62096.1|1850581_1850860_-	copper chaperone	NA	NA	NA	NA	NA
AXP62187.1|1850868_1851186_-	hypothetical protein	NA	NA	NA	NA	NA
AXP62097.1|1851205_1852315_-	transglutaminase family protein	NA	NA	NA	NA	NA
AXP62098.1|1852568_1854989_+	twin-arginine translocation signal domain-containing protein	NA	A0A077SK27	Escherichia_phage	50.3	7.0e-223
AXP62099.1|1854999_1855617_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.3	2.0e-73
AXP62100.1|1855618_1856458_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	31.1	1.1e-18
AXP62101.1|1856569_1857181_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	32.5	1.7e-21
AXP62102.1|1857180_1857681_+	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	30.3	3.9e-11
AXP62103.1|1859712_1860714_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	30.9	2.3e-26
