The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031680	Haemophilus influenzae strain P672-7661 chromosome, complete genome	1833305	747949	810323	1833305	head,tail,transposase,tRNA	Burkholderia_virus(22.22%)	62	NA	NA
AXP56035.1|747949_749392_+|tRNA	glutamate--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	35.2	1.7e-11
AXP56036.1|749692_750409_+	ribonuclease PH	NA	NA	NA	NA	NA
AXP56037.1|750432_751074_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AXP56038.1|751152_752019_+	co-chaperone DjlA	NA	NA	NA	NA	NA
AXP56039.1|752018_752951_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
AXP56040.1|752990_753836_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	2.7e-41
AXP56041.1|753984_754296_-	DUF2322 family protein	NA	NA	NA	NA	NA
AXP56042.1|754319_755345_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
AXP56043.1|755354_757058_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
AXP56044.1|757099_757699_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AXP56045.1|757781_758138_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXP56046.1|758233_760948_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
AXP56047.1|760959_762654_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
AXP56048.1|762735_764895_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
AXP56049.1|765217_766261_-	ADP-heptose--LPS heptosyltransferase I	NA	NA	NA	NA	NA
AXP56050.1|766337_767063_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
AXP56051.1|767074_767662_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	31.2	3.4e-14
AXP56991.1|767758_768655_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
AXP56052.1|769367_769691_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AXP56053.1|769880_770510_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AXP56054.1|770620_771517_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AXP56055.1|771617_772085_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
AXP56056.1|772253_772706_+	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AXP56057.1|772709_773153_+	TonB system transport protein ExbD	NA	NA	NA	NA	NA
AXP56058.1|773162_773957_+	energy transducer TonB	NA	NA	NA	NA	NA
AXP56059.1|774134_774641_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	57.5	1.9e-42
AXP56060.1|774794_777626_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
AXP56061.1|777944_782117_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	35.0	1.9e-87
AXP56062.1|782509_783004_-	ci repressor-like protein	NA	NA	NA	NA	NA
AXP56063.1|783385_785287_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	34.0	4.4e-79
AXP56064.1|785313_786231_+	DNA transposition protein	NA	A0A2I7S9C3	Vibrio_phage	43.4	4.0e-62
AXP56065.1|786230_786431_+	hypothetical protein	NA	NA	NA	NA	NA
AXP56066.1|787537_788074_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	42.8	3.0e-33
AXP56067.1|788745_789102_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXP56068.1|789101_789635_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AXP56069.1|790060_790246_+	hypothetical protein	NA	NA	NA	NA	NA
AXP56070.1|790266_790623_+	hypothetical protein	NA	NA	NA	NA	NA
AXP56071.1|790706_791258_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	68.2	4.2e-75
AXP56072.1|791260_791485_+	hypothetical protein	NA	NA	NA	NA	NA
AXP56992.1|791621_791858_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	74.6	1.8e-19
AXP56073.1|791814_792102_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
AXP56074.1|792539_792845_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	57.6	1.1e-24
AXP56993.1|793503_794991_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	61.5	1.6e-161
AXP56075.1|794993_796412_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	45.8	2.0e-113
AXP56076.1|796412_797690_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	47.6	1.6e-53
AXP56077.1|797876_798065_+	hypothetical protein	NA	NA	NA	NA	NA
AXP56078.1|798267_798768_+	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	34.6	4.3e-18
AXP56079.1|799010_800114_+	peptidase	NA	A4JWJ9	Burkholderia_virus	39.2	1.2e-65
AXP56080.1|800132_801059_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	47.9	3.0e-73
AXP56081.1|801124_801442_+	hypothetical protein	NA	NA	NA	NA	NA
AXP56082.1|801441_801876_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	36.4	4.4e-19
AXP56083.1|801887_802385_+	hypothetical protein	NA	NA	NA	NA	NA
AXP56084.1|802394_803780_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	44.3	1.8e-98
AXP56085.1|803790_804309_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	45.6	6.6e-38
AXP56086.1|804403_804679_+|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	36.8	1.0e-05
AXP56087.1|804699_804840_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXP56088.1|804855_805089_-	hypothetical protein	NA	NA	NA	NA	NA
AXP56089.1|805125_807339_+|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	44.4	4.8e-69
AXP56090.1|807338_808271_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	29.9	1.6e-18
AXP56091.1|808251_808482_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	46.3	4.7e-12
AXP56994.1|809371_809791_-	hypothetical protein	NA	A0A0R6PHZ9	Moraxella_phage	33.6	6.3e-07
AXP56092.1|809837_810323_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	32.8	3.3e-07
>prophage 2
CP031680	Haemophilus influenzae strain P672-7661 chromosome, complete genome	1833305	923151	1003056	1833305	head,portal,protease,holin,capsid,integrase,tRNA,terminase,tail	Haemophilus_virus(59.57%)	72	918113:918130	960764:960781
918113:918130	attL	AATTGACCGCACTTTTTG	NA	NA	NA	NA
AXP56190.1|923151_924384_+|protease	FtsH protease activity modulator HflK	protease	K4F6D5	Cronobacter_phage	23.8	3.2e-06
AXP56191.1|924383_925271_+|protease	protease modulator HflC	protease	A0A2I7S9Z3	Vibrio_phage	26.6	1.8e-06
AXP56192.1|925313_925748_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
AXP56193.1|925814_927278_-	PTS glucose transporter subunit IIBC	NA	A0A2I7SAJ6	Vibrio_phage	48.7	3.9e-11
AXP56194.1|927365_928505_-	YjhT family mutarotase	NA	NA	NA	NA	NA
AXP56195.1|928668_930519_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
AXP56196.1|930583_931573_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
AXP56197.1|931928_932615_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AXP56198.1|932659_933562_+	ROK family protein	NA	NA	NA	NA	NA
AXP56199.1|933554_934421_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AXP56200.1|934431_935313_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AXP56201.1|936614_937763_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AXP56202.1|938036_939158_-	porin	NA	NA	NA	NA	NA
AXP56203.1|939460_939925_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.5	2.9e-45
AXP56204.1|939985_940756_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.1	3.4e-38
AXP56205.1|941436_942948_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AXP56206.1|943008_944217_-	sugar transporter	NA	NA	NA	NA	NA
AXP56207.1|944216_945392_-	hypothetical protein	NA	NA	NA	NA	NA
AXP56208.1|945395_945983_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.5	2.8e-24
AXP56209.1|945991_946633_-	uridine kinase	NA	A0A1V0SD85	Indivirus	35.7	1.5e-28
AXP56210.1|946853_948170_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	80.7	3.1e-185
AXP56211.1|948403_948934_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	36.9	3.7e-20
AXP56212.1|949393_950407_-|integrase	site-specific integrase	integrase	Q94N03	Haemophilus_virus	98.5	7.7e-192
AXP56213.1|950406_951285_-	hypothetical protein	NA	NA	NA	NA	NA
AXP56998.1|951284_951851_-	phage repressor protein CI	NA	P79673	Haemophilus_phage	98.4	4.0e-105
AXP56214.1|951978_952191_+	DNA-binding protein	NA	P79674	Haemophilus_phage	100.0	1.2e-30
AXP56215.1|952248_952752_+	hypothetical protein	NA	P79675	Haemophilus_phage	91.0	3.0e-80
AXP56216.1|952770_953139_+	hypothetical protein	NA	P79676	Haemophilus_phage	100.0	3.7e-67
AXP56217.1|953138_953324_+	hypothetical protein	NA	Q775F8	Haemophilus_virus	100.0	8.0e-31
AXP56218.1|953335_953617_+	hypothetical protein	NA	Q775F7	Haemophilus_virus	100.0	6.1e-46
AXP56219.1|953694_956025_+	replication endonuclease	NA	Q94N00	Haemophilus_virus	98.3	0.0e+00
AXP56220.1|956036_956339_+	hypothetical protein	NA	Q94MZ9	Haemophilus_virus	85.1	2.3e-35
AXP56221.1|956348_956846_+	pyrophosphatase	NA	A0A0M3LTD8	Mannheimia_phage	46.7	4.5e-28
AXP56222.1|956856_957375_+	phage N-6-adenine-methyltransferase	NA	Q94MZ8	Haemophilus_virus	96.4	1.0e-94
AXP56223.1|957413_957632_-	hypothetical protein	NA	NA	NA	NA	NA
AXP56224.1|957926_958187_-	transcriptional regulator	NA	Q1I103	Pasteurella_virus	59.3	1.4e-25
AXP56225.1|958267_959305_-|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	98.6	2.2e-197
AXP56226.1|959294_961118_-|terminase	terminase	terminase	Q94MZ6	Haemophilus_virus	97.0	0.0e+00
960764:960781	attR	AATTGACCGCACTTTTTG	NA	NA	NA	NA
AXP56999.1|961320_962214_+|capsid	phage capsid protein	capsid	Q94MZ5	Haemophilus_virus	92.3	2.2e-142
AXP56227.1|962217_963228_+|capsid	phage major capsid protein, P2 family	capsid	Q94MZ4	Haemophilus_virus	95.8	2.7e-181
AXP56228.1|963241_964087_+|terminase	terminase	terminase	Q94MZ3	Haemophilus_virus	95.7	1.5e-148
AXP56229.1|964079_964532_+|head	head stabilization protein	head	Q94MZ2	Haemophilus_virus	91.3	1.1e-70
AXP56230.1|964519_965020_+|tail	phage tail protein	tail	Q94MZ1	Haemophilus_virus	64.2	6.8e-56
AXP56231.1|964997_965681_+	hypothetical protein	NA	Q1I0Z5	Pasteurella_virus	51.1	5.8e-50
AXP56232.1|965695_966826_+	DUF2586 domain-containing protein	NA	Q94MY9	Haemophilus_virus	98.4	2.3e-216
AXP56233.1|966829_967282_+	DUF2597 family protein	NA	Q94MY8	Haemophilus_virus	97.9	1.4e-73
AXP56234.1|967368_967605_+|holin	holin	holin	Q94MY7	Haemophilus_virus	98.7	1.4e-35
AXP56235.1|967597_968158_+	lysozyme	NA	Q94MY6	Haemophilus_virus	88.8	4.4e-88
AXP56236.1|968142_968490_+	hypothetical protein	NA	Q94MY5	Haemophilus_virus	97.4	5.7e-54
AXP56237.1|968449_968680_+	hypothetical protein	NA	NA	NA	NA	NA
AXP56238.1|968681_968990_+	hypothetical protein	NA	Q775G2	Haemophilus_virus	99.0	3.5e-47
AXP56239.1|969178_971248_+|tail	phage tail tape measure protein	tail	Q94MY4	Haemophilus_virus	73.8	1.7e-278
AXP56240.1|971251_971587_+	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	99.1	2.3e-52
AXP56241.1|971579_972749_+	hypothetical protein	NA	Q94MY2	Haemophilus_virus	97.6	8.9e-216
AXP56242.1|972758_973283_+|tail	phage tail protein	tail	Q94MY1	Haemophilus_virus	100.0	4.8e-97
AXP56243.1|973312_976081_+|tail	phage tail protein	tail	Q94MY0	Haemophilus_virus	79.0	0.0e+00
AXP56244.1|976089_976692_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	82.5	3.4e-86
AXP56245.1|976733_977501_+	hypothetical protein	NA	Q94MX8	Haemophilus_virus	97.3	3.1e-132
AXP56246.1|977487_978051_+	hypothetical protein	NA	Q94MX7	Haemophilus_virus	93.0	2.1e-77
AXP56247.1|978047_979649_+	hypothetical protein	NA	Q94MX6	Haemophilus_virus	97.9	1.3e-281
AXP56248.1|980646_981204_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AXP56249.1|981304_981907_-	peroxiredoxin C	NA	NA	NA	NA	NA
AXP56250.1|982043_983231_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
AXP56251.1|983708_985070_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AXP56252.1|985166_985673_+	hypothetical protein	NA	NA	NA	NA	NA
AXP56253.1|985725_986781_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AXP56254.1|986958_987744_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	A0A291ATS8	Pandoravirus	29.5	1.4e-18
AXP56255.1|987728_988838_-	murein transglycosylase A	NA	NA	NA	NA	NA
AXP56256.1|989232_991368_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	29.9	9.7e-19
AXP56257.1|998210_1000448_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
AXP56258.1|1000802_1001432_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AXP56259.1|1001766_1003056_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.1	1.9e-94
>prophage 3
CP031680	Haemophilus influenzae strain P672-7661 chromosome, complete genome	1833305	1390307	1395832	1833305		Mannheimia_phage(50.0%)	8	NA	NA
AXP56590.1|1390307_1390559_-	phage antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	72.7	2.3e-28
AXP56591.1|1391208_1391379_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AXP56592.1|1391728_1392700_-	SppA protein	NA	NA	NA	NA	NA
AXP56593.1|1392754_1393411_-	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	57.9	2.1e-65
AXP56594.1|1393541_1393748_+	XRE family transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	67.7	1.9e-17
AXP56595.1|1393768_1394065_+	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	70.4	3.4e-31
AXP56596.1|1394112_1394781_+	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	52.1	3.4e-55
AXP56597.1|1395655_1395832_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	93.1	8.5e-22
>prophage 4
CP031680	Haemophilus influenzae strain P672-7661 chromosome, complete genome	1833305	1509847	1518837	1833305	integrase	Haemophilus_phage(28.57%)	11	1502794:1502813	1524791:1524810
1502794:1502813	attL	AAAGTGCGGTCAAATTTTCC	NA	NA	NA	NA
AXP56691.1|1509847_1510933_-	peptide chain release factor 1	NA	G0YKC3	Acinetobacter_phage	52.8	6.3e-06
AXP56692.1|1511019_1511556_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AXP56693.1|1511829_1512531_-	hypothetical protein	NA	B7SDN5	Haemophilus_phage	62.1	5.7e-77
AXP57011.1|1512542_1512704_-	DUF935 family protein	NA	B7SDN1	Haemophilus_phage	66.7	1.5e-12
AXP56694.1|1512702_1513179_+	pyruvate kinase	NA	NA	NA	NA	NA
AXP56695.1|1513192_1513495_+	hypothetical protein	NA	NA	NA	NA	NA
AXP56696.1|1513505_1514006_+	hypothetical protein	NA	B3GVZ0	Streptococcus_phage	40.2	1.7e-22
AXP56697.1|1514005_1514290_+	hypothetical protein	NA	A0A0M3LP12	Mannheimia_phage	51.1	1.1e-18
AXP56698.1|1514320_1515322_-|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	62.2	1.0e-111
AXP56699.1|1515852_1517289_+	pyruvate kinase	NA	NA	NA	NA	NA
AXP56700.1|1517322_1518837_+	replicative DNA helicase	NA	O80281	Escherichia_phage	68.5	6.2e-169
1524791:1524810	attR	AAAGTGCGGTCAAATTTTCC	NA	NA	NA	NA
>prophage 5
CP031680	Haemophilus influenzae strain P672-7661 chromosome, complete genome	1833305	1643246	1651760	1833305		uncultured_Caudovirales_phage(16.67%)	9	NA	NA
AXP56806.1|1643246_1643930_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.2	6.6e-54
AXP56807.1|1643922_1644348_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.7	1.3e-20
AXP56808.1|1644348_1644984_+	7-carboxy-7-deazaguanine synthase	NA	S4TZT1	uncultured_phage	30.3	8.7e-16
AXP56809.1|1645378_1645612_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AXP56810.1|1645595_1647779_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	4.8e-114
AXP56811.1|1647898_1648870_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXP56812.1|1648884_1649772_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AXP56813.1|1649781_1650774_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-14
AXP56814.1|1650776_1651760_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	1.8e-20
>prophage 6
CP031680	Haemophilus influenzae strain P672-7661 chromosome, complete genome	1833305	1782493	1791561	1833305		Escherichia_phage(83.33%)	9	NA	NA
AXP56937.1|1782493_1784338_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.6	1.6e-22
AXP56938.1|1784461_1784740_-	copper chaperone	NA	NA	NA	NA	NA
AXP57019.1|1784748_1785066_-	hypothetical protein	NA	NA	NA	NA	NA
AXP56939.1|1785085_1786195_-	transglutaminase family protein	NA	NA	NA	NA	NA
AXP56940.1|1786448_1788869_+	twin-arginine translocation signal domain-containing protein	NA	A0A077SK27	Escherichia_phage	50.3	2.4e-223
AXP56941.1|1788879_1789497_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.3	7.5e-73
AXP56942.1|1789498_1790338_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	31.7	3.2e-18
AXP56943.1|1790449_1791061_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	32.5	1.0e-21
AXP56944.1|1791060_1791561_+	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	32.0	3.2e-13
