The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031642	Bacillus anthracis strain MCCC 1A02161 chromosome, complete genome	5231857	270534	278484	5231857		uncultured_virus(33.33%)	6	NA	NA
AXO96514.1|270534_270819_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.2e-20
AXO96515.1|270857_272492_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	1.5e-157
AXO96516.1|272890_274438_+	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	31.2	3.4e-21
AXO96517.1|274822_276148_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	5.4e-44
AXO96518.1|276293_276995_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
AXO96519.1|276978_278484_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	2.7e-31
>prophage 2
CP031642	Bacillus anthracis strain MCCC 1A02161 chromosome, complete genome	5231857	317424	325801	5231857		Synechococcus_phage(33.33%)	8	NA	NA
AXO96532.1|317424_318732_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
AXO96533.1|318820_319540_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
AXO96534.1|319532_319787_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AXO96535.1|319783_320467_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AXO96536.1|320450_322670_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
AXO96537.1|322654_324070_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
AXO96538.1|324176_325217_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.4	9.4e-68
AXO96539.1|325213_325801_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	1.2e-27
>prophage 3
CP031642	Bacillus anthracis strain MCCC 1A02161 chromosome, complete genome	5231857	985884	1023216	5231857	portal,head,terminase,protease,integrase,capsid,tail	uncultured_Caudovirales_phage(36.96%)	57	985824:985843	1021276:1021295
985824:985843	attL	AATCGTTCGTTCTATAAACC	NA	NA	NA	NA
AXO97132.1|985884_987048_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	88.1	1.0e-200
AXO97133.1|987101_987527_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	90.8	3.7e-71
AXO97134.1|987545_987965_-	XRE family transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	71.2	8.2e-47
AXO97135.1|988233_988422_+	XRE family transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	62.7	2.2e-12
AXO97136.1|988421_988694_+	DUF771 domain-containing protein	NA	A0A1C8E9B3	Bacillus_phage	92.2	1.4e-42
AXO97137.1|988877_989645_+	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	80.4	2.7e-112
AXO97138.1|989656_989845_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	91.9	1.1e-24
AXO97139.1|989871_990306_+	replication terminator protein	NA	A0A1C8E9A2	Bacillus_phage	93.1	2.5e-70
AXO97140.1|990324_991038_+	hypothetical protein	NA	A0A2H4JC60	uncultured_Caudovirales_phage	97.0	8.0e-127
AXO97141.1|991037_991253_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	78.9	9.4e-23
AXO97142.1|991185_991524_+	hypothetical protein	NA	A0A2H4J6H7	uncultured_Caudovirales_phage	81.2	5.4e-41
AXO97143.1|991617_992529_+	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	88.5	6.0e-119
AXO97144.1|992540_993005_+	hypothetical protein	NA	A0A0A7AQW2	Bacillus_phage	58.4	1.0e-45
AXO97145.1|993043_993478_+	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	91.7	6.9e-73
AXO97146.1|993602_994139_+	dUTPase	NA	A0A2H4J4W9	uncultured_Caudovirales_phage	91.0	1.0e-89
AXO97147.1|994300_995092_+	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	97.0	5.4e-140
AXO97148.1|995158_995362_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97149.1|995404_995932_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	94.3	4.0e-91
AXO97150.1|995928_996252_+	hypothetical protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	84.1	1.5e-48
AXO97151.1|996389_996899_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J8J4	uncultured_Caudovirales_phage	81.7	1.5e-58
AXO97152.1|997462_997966_+	hypothetical protein	NA	A0A288WFY4	Bacillus_phage	63.5	5.2e-56
AXO97153.1|998040_998220_-	hypothetical protein	NA	NA	NA	NA	NA
AXO97154.1|998328_998577_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97155.1|998706_999009_+	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	50.5	2.1e-20
AXO97156.1|999014_999230_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97157.1|999350_999713_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.4	1.5e-17
AXO97158.1|999709_1001410_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	73.0	5.2e-249
AXO97159.1|1001423_1002647_+|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	62.1	8.9e-142
AXO97160.1|1002603_1003188_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	45.0	7.2e-33
AXO97161.1|1003201_1004362_+|capsid	phage major capsid protein	capsid	H7BUQ0	unidentified_phage	53.0	1.9e-77
AXO97162.1|1004374_1004629_+	hypothetical protein	NA	A6XMJ7	Bacillus_virus	37.0	2.7e-05
AXO97163.1|1004631_1004904_+	DNA-packaging protein	NA	A0A1L2BY95	Clostridium_phage	52.3	2.0e-17
AXO97164.1|1004900_1005200_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AXP01324.1|1005201_1005546_+	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	83.3	1.4e-47
AXO97165.1|1005542_1005872_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	87.2	9.6e-51
AXO97166.1|1005872_1006445_+|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	56.7	6.8e-52
AXO97167.1|1006449_1006812_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	57.5	8.1e-35
AXO97168.1|1007045_1009934_+	replication protein	NA	A6XMK6	Bacillus_virus	41.2	1.6e-03
AXO97169.1|1009939_1010749_+|tail	phage tail family protein	tail	A0A290FZP5	Caldibacillus_phage	44.2	4.4e-57
AXO97170.1|1010763_1012236_+	SGNH/GDSL hydrolase family protein	NA	A0A0S2SXG8	Bacillus_phage	37.3	9.7e-26
AXO97171.1|1012382_1013360_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97172.1|1013645_1013933_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97173.1|1013994_1014492_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97174.1|1014583_1016620_+	hypothetical protein	NA	A0A2H4JG80	uncultured_Caudovirales_phage	62.9	4.1e-176
AXO97175.1|1016621_1016804_+	hypothetical protein	NA	A0A2H4JAY5	uncultured_Caudovirales_phage	65.0	3.2e-16
AXO97176.1|1016790_1017294_+	hypothetical protein	NA	A0A2H4J980	uncultured_Caudovirales_phage	90.2	1.2e-55
AXP01325.1|1017323_1017575_+	peptidase	NA	A0A1B1P7E0	Bacillus_phage	70.0	3.6e-26
AXO97177.1|1017584_1017791_+	hypothetical protein	NA	D2XR32	Bacillus_phage	92.4	9.9e-30
AXO97178.1|1017790_1018630_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J966	uncultured_Caudovirales_phage	82.7	9.2e-98
AXO97179.1|1018669_1018888_-	hypothetical protein	NA	NA	NA	NA	NA
AXO97180.1|1018908_1019481_-	hypothetical protein	NA	A6XML2	Bacillus_virus	46.5	1.9e-25
AXO97181.1|1019556_1019814_-	hypothetical protein	NA	A0A1B2APX4	Phage_Wrath	85.9	1.7e-34
AXO97182.1|1019810_1020035_-	LexA repressor	NA	A0A1B1P7Q3	Bacillus_phage	89.2	6.8e-32
AXO97183.1|1020128_1020959_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY5	Phage_Wrath	94.6	1.1e-108
AXO97184.1|1021474_1021807_+	DUF2185 domain-containing protein	NA	NA	NA	NA	NA
1021276:1021295	attR	AATCGTTCGTTCTATAAACC	NA	NA	NA	NA
AXO97185.1|1021841_1022024_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97186.1|1022214_1023216_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	41.3	9.2e-20
>prophage 4
CP031642	Bacillus anthracis strain MCCC 1A02161 chromosome, complete genome	5231857	1232578	1288762	5231857	protease,transposase,integrase,bacteriocin	Bacillus_phage(50.0%)	58	1231839:1231855	1280383:1280399
1231839:1231855	attL	AAATGGTAATAAAGAAT	NA	NA	NA	NA
AXO97393.1|1232578_1234498_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
AXO97394.1|1234622_1235879_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AXO97395.1|1236012_1238880_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AXO97396.1|1239705_1239915_+	transcriptional regulator	NA	S5M643	Brevibacillus_phage	41.1	1.3e-05
AXO97397.1|1239917_1240295_+	permease	NA	NA	NA	NA	NA
AXO97398.1|1240323_1240506_+	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
AXO97399.1|1240640_1241000_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97400.1|1241018_1241288_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97401.1|1241369_1241915_+	hypothetical protein	NA	NA	NA	NA	NA
AXP01334.1|1242073_1242670_+	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
AXO97402.1|1242834_1243155_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXO97403.1|1246259_1247492_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97404.1|1247484_1248234_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97405.1|1248223_1249459_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AXO97406.1|1249455_1250385_+	peptidase M50	NA	NA	NA	NA	NA
AXO97407.1|1250381_1251098_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXO97408.1|1251130_1252030_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	27.0	4.7e-15
AXO97409.1|1252022_1253264_+	ABC transporter permease	NA	NA	NA	NA	NA
AXO97410.1|1256105_1256672_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXO97411.1|1256668_1256860_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97412.1|1256872_1257067_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97413.1|1257139_1257376_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97414.1|1257390_1257870_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97415.1|1258513_1258708_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97416.1|1258811_1259102_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97417.1|1259248_1260127_+	hypothetical protein	NA	M1IQB8	Bacillus_phage	53.2	2.1e-84
AXO97418.1|1260197_1260677_+	hypothetical protein	NA	A0A2P1JUI8	Bacillus_phage	54.0	3.8e-32
AXO97419.1|1260676_1261111_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97420.1|1261124_1261370_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97421.1|1261602_1261782_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97422.1|1262236_1262641_-	hypothetical protein	NA	NA	NA	NA	NA
AXO97423.1|1262904_1263093_-	hypothetical protein	NA	NA	NA	NA	NA
AXO97424.1|1263488_1264298_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	26.5	1.0e-16
AXO97425.1|1264435_1265356_-|integrase	integrase	integrase	A0A142F1N9	Bacillus_phage	27.6	9.3e-27
AXO97426.1|1265784_1266009_-	hypothetical protein	NA	NA	NA	NA	NA
AXO97427.1|1266309_1267065_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXO97428.1|1267430_1267658_+	hypothetical protein	NA	NA	NA	NA	NA
AXO97429.1|1267813_1269100_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AXO97430.1|1269294_1269864_+	signal peptidase I	NA	NA	NA	NA	NA
AXO97431.1|1269924_1270512_+	cell division protein FtsN	NA	NA	NA	NA	NA
AXO97432.1|1270622_1270943_+|transposase	transposase	transposase	NA	NA	NA	NA
AXO97433.1|1270912_1271818_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.6	1.2e-26
AXO97434.1|1271993_1272800_+	DUF4047 domain-containing protein	NA	NA	NA	NA	NA
AXO97435.1|1273224_1273818_+	cell division protein FtsN	NA	NA	NA	NA	NA
AXO97436.1|1273893_1274217_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXO97437.1|1274296_1274431_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
AXO97438.1|1274774_1277162_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
AXO97439.1|1277333_1278701_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AXO97440.1|1278939_1279923_+	spermidine/putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	9.3e-25
AXO97441.1|1279919_1280768_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	24.4	1.0e-11
1280383:1280399	attR	ATTCTTTATTACCATTT	NA	NA	NA	NA
AXO97442.1|1280774_1281575_+	ABC transporter permease	NA	NA	NA	NA	NA
AXO97443.1|1281613_1282663_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXO97444.1|1282722_1283370_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AXO97445.1|1283480_1285673_+	MMPL family transporter	NA	NA	NA	NA	NA
AXO97446.1|1285773_1286190_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
AXO97447.1|1286288_1287212_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AXO97448.1|1287303_1287909_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
AXO97449.1|1287949_1288762_-|protease	serine protease	protease	U5Q0C0	Bacillus_phage	67.7	3.7e-43
>prophage 5
CP031642	Bacillus anthracis strain MCCC 1A02161 chromosome, complete genome	5231857	1860712	1870030	5231857		Bacillus_phage(71.43%)	9	NA	NA
AXO98014.1|1860712_1861975_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	2.6e-11
AXO98015.1|1862073_1862838_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXO98016.1|1863078_1864839_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.3	4.1e-265
AXP01350.1|1864918_1865605_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	93.9	1.3e-118
AXO98017.1|1865601_1866675_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	89.1	2.1e-171
AXO98018.1|1866699_1867287_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
AXO98019.1|1867482_1868202_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
AXO98020.1|1868351_1869023_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	86.9	5.0e-62
AXO98021.1|1869157_1870030_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.5	5.1e-67
>prophage 6
CP031642	Bacillus anthracis strain MCCC 1A02161 chromosome, complete genome	5231857	2471771	2538220	5231857	tRNA,portal,head,terminase,protease,integrase,transposase,holin,capsid,tail	Bacillus_phage(70.73%)	75	2470193:2470209	2527520:2527536
2470193:2470209	attL	AACCTTTTACATTTGTT	NA	NA	NA	NA
AXO98590.1|2471771_2473325_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
AXO98591.1|2473385_2473814_-	cell wall hydrolase	NA	NA	NA	NA	NA
AXO98592.1|2473959_2474874_+	acetamidase	NA	NA	NA	NA	NA
AXO98593.1|2474999_2475707_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXO98594.1|2475703_2476687_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXO98595.1|2476988_2477615_-	hypothetical protein	NA	NA	NA	NA	NA
AXO98596.1|2478159_2479788_+	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	30.2	2.9e-55
AXO98597.1|2479808_2480402_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXO98598.1|2480786_2481323_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
AXO98599.1|2481636_2482407_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	5.6e-33
AXO98600.1|2482381_2484313_+	ABC transporter permease	NA	NA	NA	NA	NA
AXO98601.1|2484380_2485049_+	hypothetical protein	NA	NA	NA	NA	NA
AXO98602.1|2485125_2485467_-	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
AXO98603.1|2485720_2486962_+	lipase	NA	NA	NA	NA	NA
AXO98604.1|2487049_2488093_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AXO98605.1|2488214_2489663_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AXP01375.1|2489667_2490582_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AXO98606.1|2490883_2491573_+	thiaminase II	NA	NA	NA	NA	NA
AXO98607.1|2491766_2492219_+	hypothetical protein	NA	NA	NA	NA	NA
AXO98608.1|2492179_2492410_+	hypothetical protein	NA	NA	NA	NA	NA
AXO98609.1|2493035_2493248_+	hypothetical protein	NA	NA	NA	NA	NA
AXO98610.1|2493420_2493627_-	hypothetical protein	NA	NA	NA	NA	NA
AXO98611.1|2494330_2494651_+|transposase	transposase	transposase	NA	NA	NA	NA
AXO98612.1|2494620_2495526_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.6	1.2e-26
AXO98613.1|2495593_2496058_-	exosporium protein D	NA	NA	NA	NA	NA
AXO98614.1|2496638_2497310_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
AXO98615.1|2497378_2498488_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.4	6.1e-150
AXO98616.1|2498740_2498935_-	hypothetical protein	NA	NA	NA	NA	NA
AXO98617.1|2499032_2500184_+	hypothetical protein	NA	NA	NA	NA	NA
AXO98618.1|2500221_2500368_+	complement C1q protein	NA	NA	NA	NA	NA
AXO98619.1|2500686_2501040_-	XRE family transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	87.1	3.3e-49
AXO98620.1|2501239_2501431_+	XRE family transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	85.2	8.3e-23
AXO98621.1|2501472_2501739_+	DNA-binding protein	NA	A0A0U3ULL9	Bacillus_phage	90.6	3.2e-36
AXO98622.1|2502115_2502988_+	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	97.1	3.1e-48
AXO98623.1|2502956_2503760_+	AAA family ATPase	NA	A0A1B1P7U2	Bacillus_phage	99.2	1.1e-145
AXO98624.1|2503775_2503970_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	82.8	4.5e-24
AXO98625.1|2503995_2504169_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	98.2	2.8e-25
AXO98626.1|2504183_2504438_+	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	91.7	5.5e-38
AXO98627.1|2504449_2504875_+	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	40.7	9.3e-14
AXO98628.1|2504890_2505346_+	nucleotide pyrophosphohydrolase	NA	A0A0U4IBD0	Bacillus_phage	48.2	1.9e-20
AXO98629.1|2505418_2505949_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXP01376.1|2507736_2508009_+	DUF3947 family protein	NA	NA	NA	NA	NA
AXO98630.1|2508430_2509000_-	cupin domain-containing protein	NA	Q2Q459	Bacillus_phage	80.5	1.8e-84
AXO98631.1|2509459_2509678_+	hypothetical protein	NA	NA	NA	NA	NA
AXO98632.1|2509713_2510688_+	DNA (cytosine-5-)-methyltransferase	NA	D2IZY5	Enterococcus_phage	53.8	1.0e-92
AXP01377.1|2510858_2511044_+	hypothetical protein	NA	NA	NA	NA	NA
AXO98633.1|2511310_2511433_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
AXO98634.1|2511748_2512231_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	1.9e-71
AXO98635.1|2512230_2512773_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	1.5e-88
AXP01378.1|2513069_2513603_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AXO98636.1|2513941_2514877_+	hypothetical protein	NA	A0A1L2JY39	Aeribacillus_phage	25.5	4.0e-17
AXO98637.1|2514897_2515419_+	hypothetical protein	NA	NA	NA	NA	NA
AXO98638.1|2515879_2516518_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
AXO98639.1|2516742_2516955_+	hypothetical protein	NA	H0USV9	Bacillus_phage	88.6	5.6e-28
AXO98640.1|2517086_2517341_+	hypothetical protein	NA	A0A2H4J3B1	uncultured_Caudovirales_phage	94.0	3.1e-41
AXO98641.1|2517330_2517708_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	89.6	2.1e-62
AXP01379.1|2517846_2518341_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J8E3	uncultured_Caudovirales_phage	98.2	1.8e-85
AXO98642.1|2518342_2520037_+|terminase	terminase large subunit	terminase	A0A2H4JB98	uncultured_Caudovirales_phage	99.6	0.0e+00
AXO98643.1|2520225_2521479_+|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	97.4	1.7e-236
AXO98644.1|2521465_2522176_+|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.3	2.8e-124
AXO98645.1|2522213_2523386_+|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	89.0	1.9e-194
AXO98646.1|2523406_2523685_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	95.6	2.2e-40
AXO98647.1|2523681_2524005_+|head,tail	head-tail adaptor protein	head,tail	H0USW8	Bacillus_phage	93.5	5.3e-54
AXO98648.1|2523997_2524435_+	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	100.0	4.6e-77
AXO98649.1|2524431_2524791_+	DUF3168 domain-containing protein	NA	A0A288WFU0	Bacillus_phage	97.5	1.5e-60
AXO98650.1|2524791_2525400_+|tail	phage tail protein	tail	Q2I8F2	Bacillus_phage	96.5	3.1e-103
AXO98651.1|2525449_2525767_+	hypothetical protein	NA	A0A288WFU2	Bacillus_phage	94.3	1.6e-50
AXO98652.1|2525988_2527305_+|tail	phage tail tape measure protein	tail	A0A288WFV4	Bacillus_phage	97.5	5.0e-167
AXO98653.1|2527481_2530100_+|tail	phage tail tape measure protein	tail	Q2I8F0	Bacillus_phage	95.9	5.7e-279
2527520:2527536	attR	AACAAATGTAAAAGGTT	NA	NA	NA	NA
AXO98654.1|2530113_2531604_+|tail	phage tail family protein	tail	A0A288WFS2	Bacillus_phage	98.6	4.8e-291
AXO98655.1|2531600_2535467_+	peptidase S74	NA	Q2I8E8	Bacillus_phage	91.0	0.0e+00
AXO98656.1|2535560_2535797_+	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	79.5	3.2e-08
AXO98657.1|2535796_2536036_+|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	94.9	4.7e-31
AXO98658.1|2536032_2537097_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	92.4	7.3e-193
AXO98659.1|2537431_2538220_+	hypothetical protein	NA	A0A288WG17	Bacillus_phage	52.6	7.1e-68
