The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031577	Klebsiella pneumoniae strain S12 chromosome, complete genome	5242834	359783	375441	5242834		Enterobacteria_phage(30.0%)	17	NA	NA
AXO53597.1|359783_360059_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	60.9	1.9e-23
AXO53598.1|360032_360602_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	85.2	1.5e-83
AXO53599.1|360677_361697_+	hypothetical protein	NA	A0A0C5Q3X6	Klebsiella_phage	52.4	6.6e-82
AXO53600.1|361693_362191_+	hypothetical protein	NA	NA	NA	NA	NA
AXO53601.1|362199_362379_+	hypothetical protein	NA	NA	NA	NA	NA
AXO53602.1|362412_362604_-	hypothetical protein	NA	NA	NA	NA	NA
AXO57969.1|362613_364125_-	hypothetical protein	NA	H6X4Y6	Enterobacteria_phage	33.3	1.3e-57
AXO53603.1|365122_365275_-	DUF1378 family protein	NA	NA	NA	NA	NA
AXO53604.1|365271_365802_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.9	1.4e-35
AXO53605.1|365798_366338_-	lysozyme	NA	H6WRZ4	Salmonella_phage	78.7	4.5e-82
AXO53606.1|366339_366555_-	hypothetical protein	NA	A5LH82	Enterobacteria_phage	61.0	1.1e-12
AXO53607.1|366885_367038_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	81.6	1.2e-13
AXO53608.1|367182_367836_+	hypothetical protein	NA	NA	NA	NA	NA
AXO53609.1|367899_368112_+	hypothetical protein	NA	NA	NA	NA	NA
AXO53610.1|368112_371037_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	41.1	8.8e-196
AXO57970.1|371036_372419_-	hypothetical protein	NA	NA	NA	NA	NA
AXO53611.1|372726_375441_-	transglycosylase	NA	K4NWI2	Pseudomonas_phage	24.8	9.1e-30
>prophage 2
CP031577	Klebsiella pneumoniae strain S12 chromosome, complete genome	5242834	380000	405500	5242834	head,protease,tail,integrase	Pectobacterium_phage(29.17%)	37	394110:394123	408227:408240
AXO53616.1|380000_380474_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
AXO53617.1|380512_381508_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.6	1.9e-105
AXO53618.1|381518_382244_-	hypothetical protein	NA	NA	NA	NA	NA
AXO53619.1|382230_382554_-	GTP-binding protein	NA	NA	NA	NA	NA
AXO53620.1|382556_384221_-|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	2.0e-104
AXO53621.1|384220_385615_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	3.1e-58
AXO53622.1|385699_386152_-	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	67.2	8.5e-50
AXO53623.1|386158_386419_-	hypothetical protein	NA	NA	NA	NA	NA
AXO53624.1|386402_386636_-	hypothetical protein	NA	NA	NA	NA	NA
AXO53625.1|386697_387222_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.7	8.7e-46
AXO53626.1|387262_387703_-	hypothetical protein	NA	R9TRJ4	Aeromonas_phage	43.8	4.3e-14
AXO53627.1|387708_388056_-	enterotoxin	NA	NA	NA	NA	NA
AXO53628.1|388043_388367_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	1.8e-25
AXO53629.1|388356_388950_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	72.1	7.2e-81
AXO53630.1|389018_389210_-	hypothetical protein	NA	NA	NA	NA	NA
AXO53631.1|389390_389729_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.9	1.7e-47
AXO53632.1|389741_390359_-	hypothetical protein	NA	NA	NA	NA	NA
AXO53633.1|390355_390586_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	38.7	2.9e-06
AXO53634.1|390588_391179_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	84.7	4.3e-94
AXO57973.1|391306_392092_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	2.0e-62
AXO53635.1|392131_392365_-	hypothetical protein	NA	NA	NA	NA	NA
AXO53636.1|392368_393019_-	hypothetical protein	NA	NA	NA	NA	NA
AXO53637.1|393057_394446_-	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	47.3	1.5e-105
394110:394123	attL	CATCAGCGCCCTGC	NA	NA	NA	NA
AXO57974.1|395426_395585_-	adenylate cyclase	NA	NA	NA	NA	NA
AXO53638.1|395668_396115_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	5.7e-30
AXO53639.1|396175_396370_-	transcriptional regulator	NA	NA	NA	NA	NA
AXO53640.1|396450_396837_+	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	57.8	3.4e-15
AXO57975.1|397778_398012_+	hypothetical protein	NA	NA	NA	NA	NA
AXO53641.1|398019_398265_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	59.5	3.7e-15
AXO53642.1|398294_400424_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.6	4.7e-98
AXO53643.1|400423_400990_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
AXO53644.1|400991_401177_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	45.9	2.8e-07
AXO53645.1|401226_401421_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	66.1	4.4e-11
AXO53646.1|401386_401611_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
AXO53647.1|401614_402643_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	9.9e-94
AXO53648.1|402918_404571_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AXO53649.1|404840_405500_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
408227:408240	attR	CATCAGCGCCCTGC	NA	NA	NA	NA
>prophage 3
CP031577	Klebsiella pneumoniae strain S12 chromosome, complete genome	5242834	502003	511477	5242834	protease,tRNA	Brazilian_cedratvirus(16.67%)	9	NA	NA
AXO53725.1|502003_503725_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AXO53726.1|503769_504471_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXO53727.1|504824_505043_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXO53728.1|505173_507453_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXO53729.1|507483_507801_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXO53730.1|508126_508348_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXO53731.1|508281_508485_-	hypothetical protein	NA	NA	NA	NA	NA
AXO53732.1|508424_510365_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AXO53733.1|510361_511477_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.8	3.8e-06
>prophage 4
CP031577	Klebsiella pneumoniae strain S12 chromosome, complete genome	5242834	984363	1058653	5242834	coat,lysis,terminase,tail,tRNA,head,integrase	Enterobacteria_phage(20.69%)	96	1006104:1006150	1055724:1055770
AXO54139.1|984363_985881_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
AXO54140.1|986212_987688_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
AXO54141.1|987747_989895_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AXO54142.1|989977_991312_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
AXO54143.1|991677_993246_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
AXO54144.1|993325_993580_-	hypothetical protein	NA	NA	NA	NA	NA
AXO54145.1|993539_993812_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXO54146.1|993912_994833_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
AXO54147.1|995343_996210_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXO54148.1|996232_997258_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AXO54149.1|997259_999695_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AXO54150.1|999705_1000401_-	molecular chaperone	NA	NA	NA	NA	NA
AXO54151.1|1000458_1001019_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AXO54152.1|1001490_1002153_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AXO54153.1|1002130_1002436_+	hypothetical protein	NA	NA	NA	NA	NA
AXO54154.1|1002488_1003793_-	citrate synthase	NA	NA	NA	NA	NA
AXO54155.1|1004303_1004474_+	ATP-NAD kinase	NA	NA	NA	NA	NA
AXO54156.1|1004552_1004954_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AXO54157.1|1005349_1005643_-	hypothetical protein	NA	NA	NA	NA	NA
1006104:1006150	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AXO54158.1|1006317_1006635_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.4e-22
AXO54159.1|1006634_1006874_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	4.7e-15
AXO54160.1|1006951_1008436_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AXO54161.1|1008435_1008687_-	hypothetical protein	NA	NA	NA	NA	NA
AXO54162.1|1009331_1009754_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	46.1	4.3e-27
AXO54163.1|1009831_1010380_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	90.6	5.3e-86
AXO54164.1|1010470_1011982_+	hypothetical protein	NA	H6X4Y6	Enterobacteria_phage	33.2	2.4e-56
AXO54165.1|1011992_1012184_+	hypothetical protein	NA	NA	NA	NA	NA
AXO54166.1|1012357_1012555_-	hypothetical protein	NA	NA	NA	NA	NA
AXO54167.1|1012648_1012846_-	hypothetical protein	NA	NA	NA	NA	NA
AXO54168.1|1015106_1017584_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.2	2.0e-196
AXO54169.1|1017570_1017966_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	8.0e-36
AXO54170.1|1017962_1018433_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	39.7	3.6e-27
AXO58006.1|1018432_1018852_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.3	8.2e-31
AXO54171.1|1018951_1021564_-|tail	phage tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	39.8	1.2e-92
AXO54172.1|1021620_1022136_-	hypothetical protein	NA	NA	NA	NA	NA
AXO54173.1|1022323_1023079_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	59.3	5.6e-70
AXO54174.1|1023151_1023853_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	40.3	1.1e-38
AXO54175.1|1023842_1024013_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	7.9e-17
AXO58007.1|1024112_1024418_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.2	2.5e-13
AXO54176.1|1024623_1025202_-	HNH endonuclease	NA	K9L517	Pectobacterium_phage	33.1	1.1e-20
AXO54177.1|1025272_1025989_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	6.3e-63
AXO54178.1|1026056_1026821_-	hypothetical protein	NA	G0ZNE6	Cronobacter_phage	43.4	1.6e-40
AXO54179.1|1026879_1027263_-	hypothetical protein	NA	NA	NA	NA	NA
AXO54180.1|1027259_1027628_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	82.0	1.9e-47
AXO54181.1|1027630_1027993_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	45.0	4.8e-19
AXO54182.1|1027992_1028166_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	52.6	2.7e-12
AXO54183.1|1028165_1028546_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	2.4e-29
AXO54184.1|1028548_1028776_-	hypothetical protein	NA	NA	NA	NA	NA
AXO54185.1|1028808_1029864_-|coat	phage coat protein	coat	A0A1W6DYD5	Salmonella_phage	53.2	2.9e-101
AXO54186.1|1029860_1030322_-	hypothetical protein	NA	B1GS72	Salmonella_phage	49.7	1.9e-28
AXO54187.1|1030321_1031677_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.9	9.5e-129
AXO54188.1|1031700_1032045_+	hypothetical protein	NA	NA	NA	NA	NA
AXO54189.1|1032045_1033056_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.2	2.6e-115
AXO54190.1|1032982_1034452_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.6	3.1e-149
AXO54191.1|1034464_1035937_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.3	8.5e-248
AXO54192.1|1035936_1036452_-|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	75.3	3.3e-66
AXO54193.1|1036479_1036815_+	hypothetical protein	NA	NA	NA	NA	NA
AXO54194.1|1036817_1037015_-	hypothetical protein	NA	NA	NA	NA	NA
AXO54195.1|1037339_1037696_-	hypothetical protein	NA	NA	NA	NA	NA
AXO54196.1|1037819_1038281_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	62.7	4.6e-43
AXO54197.1|1038277_1038808_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	79.4	9.3e-80
AXO54198.1|1038810_1039059_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AXO54199.1|1039185_1039401_-	hypothetical protein	NA	NA	NA	NA	NA
AXO54200.1|1039803_1040493_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	8.4e-57
AXO54201.1|1040489_1040630_-	YlcG family protein	NA	NA	NA	NA	NA
AXO54202.1|1040626_1041262_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.9	2.0e-81
AXO54203.1|1041254_1041425_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
AXO54204.1|1041424_1041880_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	1.0e-55
AXO54205.1|1042362_1042620_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	75.3	8.3e-26
AXO54206.1|1042619_1042907_-	hypothetical protein	NA	NA	NA	NA	NA
AXO54207.1|1043712_1043922_-	hypothetical protein	NA	NA	NA	NA	NA
AXO54208.1|1043918_1044308_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	54.3	4.8e-25
AXO54209.1|1044304_1044607_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXO54210.1|1044606_1046037_-	helicase DnaB	NA	Q9MCT4	Escherichia_phage	66.5	1.3e-184
AXO54211.1|1046026_1046926_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.9	9.2e-88
AXO54212.1|1047150_1047372_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AXO54213.1|1047412_1047640_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	5.6e-18
AXO54214.1|1047708_1048431_+	helix-turn-helix domain-containing protein	NA	E7C9R0	Salmonella_phage	63.2	4.2e-75
AXO58008.1|1048453_1048573_+	hypothetical protein	NA	NA	NA	NA	NA
AXO54215.1|1048650_1049085_+	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	64.6	9.1e-49
AXO54216.1|1049081_1049729_+	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	62.0	3.8e-19
AXO54217.1|1050234_1050429_+	hypothetical protein	NA	NA	NA	NA	NA
AXO54218.1|1050517_1050802_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	60.6	1.5e-28
AXO54219.1|1050818_1051565_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	5.3e-65
AXO54220.1|1051561_1052185_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.7	3.4e-57
AXO58009.1|1052213_1052741_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	3.8e-57
AXO54221.1|1052957_1053677_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	42.3	3.4e-40
AXO54222.1|1053673_1053865_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
AXO54223.1|1053861_1054083_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	3.4e-12
AXO54224.1|1054082_1054322_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	5.9e-10
AXO58010.1|1054334_1054670_+	DNA-binding protein	NA	NA	NA	NA	NA
AXO58011.1|1054666_1055710_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	85.9	2.2e-178
AXO54225.1|1055779_1056103_-	hypothetical protein	NA	NA	NA	NA	NA
1055724:1055770	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AXO54226.1|1056141_1057008_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AXO54227.1|1057009_1057222_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AXO54228.1|1057267_1058653_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	2.7e-46
>prophage 5
CP031577	Klebsiella pneumoniae strain S12 chromosome, complete genome	5242834	2232695	2315409	5242834	protease,terminase,tail,plate,capsid,tRNA,integrase,portal	Enterobacteria_phage(40.0%)	83	2280808:2280849	2311186:2311227
AXO55250.1|2232695_2234216_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXO55251.1|2234240_2234579_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
AXO55252.1|2234697_2235519_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
AXO55253.1|2241365_2242217_-	glutamate racemase	NA	NA	NA	NA	NA
AXO55254.1|2242161_2244000_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	2.3e-08
AXO55255.1|2244366_2245467_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AXO55256.1|2245518_2245878_-	YijD family membrane protein	NA	NA	NA	NA	NA
AXO55257.1|2245893_2246529_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AXO55258.1|2246725_2248126_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AXO55259.1|2248108_2249026_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
AXO55260.1|2249285_2250659_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AXO58062.1|2250617_2250800_+	hypothetical protein	NA	NA	NA	NA	NA
AXO55261.1|2250758_2251535_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AXO55262.1|2251541_2252546_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AXO55263.1|2252659_2253811_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AXO55264.1|2254068_2256720_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AXO55265.1|2256763_2257414_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AXO55266.1|2257561_2258425_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXO55267.1|2258630_2259293_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	4.6e-28
AXO55268.1|2259347_2260451_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AXO55269.1|2260544_2261432_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AXO55270.1|2261660_2262569_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXO55271.1|2262660_2263032_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AXO55272.1|2263069_2264626_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AXO55273.1|2264764_2265901_+	cytoplasmic protein	NA	NA	NA	NA	NA
AXO55274.1|2265875_2268308_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AXO55275.1|2268310_2269471_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AXO55276.1|2269738_2270056_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
AXO55277.1|2270157_2270370_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AXO55278.1|2270622_2272818_+	primosomal protein N'	NA	NA	NA	NA	NA
AXO55279.1|2272968_2273997_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
AXO55280.1|2274090_2275059_+	cell division protein FtsN	NA	NA	NA	NA	NA
AXO55281.1|2275150_2275681_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AXO55282.1|2275690_2277025_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
AXO55283.1|2277094_2278015_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AXO55284.1|2278107_2278593_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AXO55285.1|2278654_2279617_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AXO55286.1|2279813_2280716_-	cation-efflux pump FieF	NA	NA	NA	NA	NA
2280808:2280849	attL	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
AXO55287.1|2280928_2281837_+	metallophosphoesterase	NA	NA	NA	NA	NA
AXO58063.1|2281949_2282198_-	hypothetical protein	NA	Q858U4	Yersinia_virus	50.0	4.0e-09
AXO55288.1|2282237_2283374_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	74.4	3.3e-159
AXO58064.1|2283527_2284709_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	75.7	6.1e-172
AXO55289.1|2284709_2285225_+|tail	phage tail protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.7	7.9e-60
AXO55290.1|2285273_2285591_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	56.1	2.0e-21
AXO58066.1|2285596_2285752_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	2.7e-11
AXO58065.1|2285738_2288705_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.9	3.6e-253
AXO55291.1|2288719_2289208_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	74.1	1.8e-66
AXO55292.1|2289957_2291010_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	61.9	3.6e-115
AXO55293.1|2290999_2291614_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.1	1.2e-67
AXO55294.1|2291606_2292503_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	68.5	9.8e-106
AXO55295.1|2292489_2292858_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	64.3	1.3e-35
AXO55296.1|2292854_2293430_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	66.1	3.0e-68
AXO55297.1|2293426_2294065_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	53.1	1.7e-56
AXO55298.1|2294057_2294528_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	66.7	6.6e-61
AXO55299.1|2294629_2294842_-	peptidase	NA	NA	NA	NA	NA
AXO55300.1|2294738_2295176_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	34.1	9.6e-06
AXO55301.1|2295172_2295718_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.1	2.2e-28
AXO55302.1|2295701_2296004_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXO55303.1|2295994_2296195_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	75.4	2.1e-21
AXO55304.1|2296194_2296719_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	54.1	4.8e-44
AXO55305.1|2296817_2297675_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	62.2	4.9e-70
AXO55306.1|2297720_2298770_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.0	5.1e-106
AXO55307.1|2298793_2299630_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	68.3	2.3e-101
AXO55308.1|2299789_2301520_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	76.3	6.0e-269
AXO55309.1|2301519_2302578_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	71.1	1.1e-143
AXO58067.1|2302834_2303059_+	hypothetical protein	NA	NA	NA	NA	NA
AXO55310.1|2303026_2304139_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	32.0	1.4e-32
AXO55311.1|2304162_2304756_-	hypothetical protein	NA	NA	NA	NA	NA
AXO55312.1|2304819_2307225_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	87.1	0.0e+00
AXO55313.1|2307221_2307401_-	hypothetical protein	NA	NA	NA	NA	NA
AXO55314.1|2307400_2308372_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	81.3	6.2e-138
AXO55315.1|2308373_2308586_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	67.1	7.3e-20
AXO55316.1|2308671_2308902_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	94.7	6.1e-36
AXO55317.1|2308891_2309098_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	98.5	2.1e-32
AXO55318.1|2309108_2309312_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	97.0	7.5e-30
AXO55319.1|2309322_2309604_-	regulator	NA	A0A0M4RCW1	Salmonella_phage	97.8	2.0e-49
AXO55320.1|2309704_2310025_+	XRE family transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	98.1	1.3e-52
AXO55321.1|2310094_2311075_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	98.2	3.0e-185
AXO55322.1|2311252_2311756_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2311186:2311227	attR	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
AXO55323.1|2311905_2312604_+	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
AXO55324.1|2312600_2313974_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
AXO55325.1|2314041_2314716_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AXO55326.1|2314788_2315409_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
>prophage 6
CP031577	Klebsiella pneumoniae strain S12 chromosome, complete genome	5242834	3207219	3242618	5242834	capsid,tail,integrase	Pseudomonas_phage(70.97%)	42	3197391:3197405	3247786:3247800
3197391:3197405	attL	TTGTCAGCGTCGCTG	NA	NA	NA	NA
AXO56152.1|3207219_3208734_+	hypothetical protein	NA	A0A0C5Q3X6	Klebsiella_phage	46.7	7.4e-106
AXO56153.1|3208742_3208922_+	hypothetical protein	NA	NA	NA	NA	NA
AXO56154.1|3208955_3209147_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58094.1|3209156_3210668_-	hypothetical protein	NA	H6X4Y6	Enterobacteria_phage	33.1	1.1e-56
AXO56155.1|3211072_3211876_-	hypothetical protein	NA	A0A2D1GNQ7	Pseudomonas_phage	43.6	1.8e-50
AXO56156.1|3211880_3214586_-	hypothetical protein	NA	A0A2D1GNP9	Pseudomonas_phage	66.0	1.4e-293
AXO56157.1|3214586_3214790_-	hypothetical protein	NA	A0A2D1GNL8	Pseudomonas_phage	69.2	3.9e-18
AXO56158.1|3214799_3215033_-	hypothetical protein	NA	A0A2D1GNV4	Pseudomonas_phage	83.1	8.0e-36
AXO56159.1|3215045_3215861_-	DUF2163 domain-containing protein	NA	A0A2D1GNT2	Pseudomonas_phage	68.3	2.7e-110
AXO56160.1|3215847_3216954_-|tail	phage tail protein	tail	A0A2D1GNY4	Pseudomonas_phage	48.6	1.4e-93
AXO56161.1|3217028_3220529_-|tail	phage tail tape-measure protein	tail	I6P8E3	Pseudomonas_phage	34.5	1.0e-57
AXO56162.1|3220689_3221172_-	hypothetical protein	NA	NA	NA	NA	NA
AXO56163.1|3221168_3221921_-	hypothetical protein	NA	A0A2D1GNQ7	Pseudomonas_phage	60.3	1.0e-79
AXO56164.1|3221907_3222111_-	hypothetical protein	NA	NA	NA	NA	NA
AXO56165.1|3222098_3222545_-	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	35.8	1.5e-17
AXO56166.1|3222541_3223066_-	DUF1320 domain-containing protein	NA	Q5ZQX5	Pseudomonas_phage	49.7	3.3e-37
AXO56167.1|3223079_3224009_-|capsid	phage capsid protein	capsid	J9SVQ2	Pseudomonas_phage	67.0	1.5e-120
AXO56168.1|3224064_3224268_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	61.9	1.5e-14
AXO56169.1|3224300_3224675_-	DUF2190 domain-containing protein	NA	A0A0S4L3C3	Pseudomonas_phage	50.4	5.6e-23
AXO56170.1|3224671_3225796_-	peptidase	NA	A0A0S4L0J5	Pseudomonas_phage	40.0	2.7e-68
AXO56171.1|3226034_3226595_-	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	50.3	3.2e-46
AXO56172.1|3226597_3227815_-	hypothetical protein	NA	J9STS2	Pseudomonas_phage	52.6	9.8e-117
AXO56173.1|3227804_3229295_-	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	53.8	2.2e-147
AXO56174.1|3229318_3231001_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	45.7	2.6e-115
AXO56175.1|3231000_3231549_-	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	66.4	2.9e-44
AXO56176.1|3231550_3231847_-	ArsR family transcriptional regulator	NA	J9SNG3	Pseudomonas_phage	64.9	1.3e-27
AXO56177.1|3231857_3232160_-	DUF2730 family protein	NA	NA	NA	NA	NA
AXO56178.1|3232264_3232714_-	hypothetical protein	NA	NA	NA	NA	NA
AXO56179.1|3232700_3233333_-	lytic transglycosylase domain-containing protein	NA	Q6QIC7	Burkholderia_phage	59.4	7.7e-65
AXO56180.1|3233335_3233701_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	54.4	1.7e-24
AXO56181.1|3233795_3233978_+	hypothetical protein	NA	NA	NA	NA	NA
AXO56182.1|3233974_3234745_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	65.5	4.9e-98
AXO56183.1|3234843_3235545_-	hypothetical protein	NA	NA	NA	NA	NA
AXO56184.1|3235568_3235922_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXO56185.1|3236021_3236210_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	72.6	5.5e-19
AXO56186.1|3236263_3236569_+	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	59.6	1.2e-20
AXO56187.1|3236585_3237524_+	hypothetical protein	NA	J9RW58	Pseudomonas_phage	49.0	1.3e-63
AXO56188.1|3237516_3238233_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58095.1|3238522_3240307_+|integrase	integrase	integrase	Q6QIE0	Burkholderia_phage	54.7	4.1e-180
AXO56189.1|3240319_3241489_+	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.2	3.0e-123
AXO56190.1|3241489_3241762_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58096.1|3242006_3242618_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.2	3.2e-76
3247786:3247800	attR	CAGCGACGCTGACAA	NA	NA	NA	NA
>prophage 7
CP031577	Klebsiella pneumoniae strain S12 chromosome, complete genome	5242834	4067253	4074157	5242834		Planktothrix_phage(33.33%)	6	NA	NA
AXO58125.1|4067253_4068117_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AXO56906.1|4068127_4068901_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AXO58126.1|4069140_4070034_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AXO56907.1|4070279_4071641_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AXO56908.1|4071959_4072682_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AXO56909.1|4072678_4074157_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 8
CP031577	Klebsiella pneumoniae strain S12 chromosome, complete genome	5242834	5038744	5049632	5242834		Escherichia_phage(87.5%)	10	NA	NA
AXO57764.1|5038744_5041852_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AXO57765.1|5041906_5043172_+	MFS transporter	NA	NA	NA	NA	NA
AXO57766.1|5043202_5044291_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AXO57767.1|5044377_5044638_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AXO57768.1|5044935_5045796_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AXO57769.1|5045816_5046578_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXO57770.1|5046568_5046802_+	hypothetical protein	NA	NA	NA	NA	NA
AXO57771.1|5046839_5047742_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AXO57772.1|5047753_5049019_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
AXO57773.1|5049011_5049632_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 1
CP031578	Klebsiella pneumoniae strain S12 plasmid p1502320-1	60477	0	55333	60477	capsid,tail,terminase	Salmonella_phage(88.0%)	65	NA	NA
AXO58179.1|0_5534_-	hypothetical protein	NA	J9Q713	Salmonella_phage	69.9	0.0e+00
AXO58180.1|5545_6157_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	62.6	6.5e-69
AXO58181.1|6144_6948_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	76.0	5.0e-117
AXO58182.1|6937_7636_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	76.1	2.3e-102
AXO58183.1|7692_8028_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	73.6	2.7e-45
AXO58184.1|8076_8292_-	hypothetical protein	NA	J9Q712	Salmonella_phage	61.5	6.3e-11
AXO58185.1|8414_12665_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	42.2	7.4e-212
AXO58243.1|12669_12897_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	76.7	4.0e-24
AXO58186.1|13022_13340_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	67.6	2.1e-31
AXO58187.1|14207_14591_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	43.7	3.0e-27
AXO58188.1|14587_15082_-	hypothetical protein	NA	J9Q711	Salmonella_phage	51.2	7.2e-34
AXO58189.1|15072_15417_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	57.9	1.1e-33
AXO58190.1|15427_16261_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	49.3	9.2e-74
AXO58191.1|16260_16686_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	64.3	9.5e-43
AXO58192.1|16727_17171_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	42.4	1.1e-20
AXO58193.1|17244_18117_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	81.4	1.0e-131
AXO58194.1|18146_19031_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	59.1	1.7e-81
AXO58195.1|19043_20618_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	71.5	9.1e-224
AXO58196.1|20649_21906_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	90.0	4.7e-231
AXO58197.1|21905_22493_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	59.8	3.9e-55
AXO58198.1|22663_22930_-	hypothetical protein	NA	J9Q757	Salmonella_phage	74.7	6.8e-31
AXO58199.1|22939_23830_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	79.8	1.1e-138
AXO58200.1|23826_24384_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58201.1|24373_25015_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	87.2	2.0e-97
AXO58202.1|25007_25682_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	67.3	1.8e-72
AXO58203.1|25665_26379_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	68.3	2.2e-84
AXO58204.1|26444_28022_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	70.9	2.2e-209
AXO58205.1|28066_28426_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58206.1|28550_29102_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58207.1|29129_29771_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58208.1|29969_30464_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58209.1|30472_31006_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	40.3	8.6e-25
AXO58210.1|31309_31960_+	hypothetical protein	NA	J9Q754	Salmonella_phage	50.5	1.8e-53
AXO58211.1|32572_33055_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58212.1|33286_33733_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	44.4	3.6e-24
AXO58244.1|33858_34188_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	55.6	4.5e-16
AXO58213.1|34350_34719_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58214.1|34715_34925_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	72.9	2.2e-21
AXO58215.1|36445_36646_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58216.1|36655_36976_-	hypothetical protein	NA	J9Q750	Salmonella_phage	68.9	3.0e-41
AXO58217.1|37046_37274_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58218.1|37351_37960_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58219.1|38001_38181_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58220.1|38189_39854_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	65.5	5.0e-212
AXO58221.1|39976_40615_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	52.4	4.1e-50
AXO58222.1|40611_40806_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58223.1|40802_41063_-	hypothetical protein	NA	I6WB67	Aeromonas_phage	35.7	4.8e-05
AXO58224.1|41194_41491_+	hypothetical protein	NA	G8C7R5	Escherichia_phage	39.6	4.5e-07
AXO58225.1|41500_42151_+	hypothetical protein	NA	G8C7R6	Escherichia_phage	50.5	5.2e-56
AXO58226.1|42763_43081_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58227.1|43125_43560_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58228.1|44621_45047_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	77.3	4.1e-54
AXO58245.1|45765_46266_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	54.1	8.3e-46
AXO58229.1|46916_47141_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	51.4	5.4e-13
AXO58230.1|47319_47934_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	70.8	1.0e-77
AXO58231.1|48103_48457_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	42.9	1.8e-15
AXO58232.1|48456_48840_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	46.9	1.4e-24
AXO58233.1|48853_49147_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58234.1|49423_49966_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	59.8	6.2e-55
AXO58235.1|49962_50370_-	hypothetical protein	NA	J9Q743	Salmonella_phage	33.3	9.2e-11
AXO58236.1|50424_51075_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	45.6	1.0e-27
AXO58237.1|51071_51554_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	53.2	3.1e-42
AXO58238.1|51550_51952_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	36.5	1.6e-12
AXO58246.1|53250_53997_-	hypothetical protein	NA	J9Q742	Salmonella_phage	50.2	5.2e-60
AXO58239.1|54190_55333_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	82.1	7.4e-183
>prophage 1
CP031579	Klebsiella pneumoniae strain S12 plasmid p1502320-2	44231	0	44231	44231	integrase,tail	Salmonella_phage(62.5%)	46	10183:10199	19041:19057
AXO58247.1|0_337_-	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	75.0	6.8e-44
AXO58248.1|333_603_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58249.1|659_980_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58250.1|1401_2469_-	recombinase	NA	J9Q736	Salmonella_phage	72.6	2.0e-150
AXO58251.1|2485_2746_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58252.1|2742_3720_-	exonuclease	NA	J9Q7S6	Salmonella_phage	65.4	1.4e-121
AXO58253.1|3765_4743_-	regulator	NA	J9Q7Z3	Salmonella_phage	45.6	3.6e-61
AXO58254.1|4809_5250_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	48.3	3.5e-32
AXO58255.1|5459_5882_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58256.1|5878_7039_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	62.4	2.5e-138
AXO58257.1|7109_9482_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	67.0	1.3e-311
AXO58258.1|9478_9667_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	48.2	2.3e-09
AXO58259.1|9659_10910_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	62.6	1.5e-144
10183:10199	attL	GCCAGATAAACCCACCC	NA	NA	NA	NA
AXO58260.1|11008_13021_-	hypothetical protein	NA	J9Q7G6	Salmonella_phage	45.6	2.1e-124
AXO58261.1|13107_13326_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58262.1|13578_13929_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXO58291.1|13918_14965_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	27.2	1.6e-19
AXO58263.1|15125_15542_-	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	32.2	1.3e-07
AXO58264.1|15532_16093_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58265.1|16140_16467_-	hypothetical protein	NA	A0A2H4IBK3	Erwinia_phage	51.4	6.8e-25
AXO58266.1|16453_16744_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
AXO58267.1|16839_19962_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.3	3.0e-24
19041:19057	attR	GCCAGATAAACCCACCC	NA	NA	NA	NA
AXO58268.1|20082_21246_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AXO58269.1|21242_22799_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.9	1.3e-102
AXO58270.1|22953_23205_-	antitoxin	NA	NA	NA	NA	NA
AXO58271.1|23300_23546_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	45.9	5.0e-12
AXO58272.1|23771_24017_-	hypothetical protein	NA	A0A1S6UB66	Serratia_phage	58.0	1.4e-17
AXO58292.1|24013_24454_-	DUF2829 domain-containing protein	NA	A0A2P1CCQ6	Klebsiella_phage	45.1	3.9e-23
AXO58273.1|24545_25376_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.2	9.1e-90
AXO58274.1|25542_26154_-	hypothetical protein	NA	S4TP42	Salmonella_phage	33.7	1.7e-16
AXO58275.1|27395_27647_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58276.1|27798_28014_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	62.9	4.1e-18
AXO58277.1|27997_28198_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58278.1|28194_29523_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	70.4	4.3e-182
AXO58279.1|29522_29993_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58280.1|30529_31447_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58281.1|31509_32625_-	DNA primase	NA	J9Q720	Salmonella_phage	66.8	1.2e-148
AXO58282.1|32760_34122_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	70.1	4.5e-179
AXO58283.1|34166_34907_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	53.0	3.1e-73
AXO58284.1|35235_35601_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	53.2	3.7e-19
AXO58285.1|35602_36271_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	70.5	1.8e-88
AXO58286.1|36588_36840_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	47.0	1.3e-12
AXO58287.1|36836_37529_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	78.0	1.1e-99
AXO58288.1|37539_37854_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	69.8	2.3e-33
AXO58289.1|37935_39477_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	43.2	4.2e-48
AXO58290.1|39524_44231_-	DUF1983 domain-containing protein	NA	A0A0P0IKE4	Klebsiella_phage	44.3	2.4e-70
>prophage 1
CP031584	Klebsiella pneumoniae strain S12 plasmid pIncAC2-1502320, complete sequence	164082	100085	113595	164082	integrase,transposase	Salmonella_phage(50.0%)	13	95556:95569	115782:115795
95556:95569	attL	ATCCGAGCTGGCGC	NA	NA	NA	NA
AXO58917.1|100085_101090_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXO58918.1|101168_104141_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AXO58919.1|104143_104701_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AXO58920.1|104738_105062_-|transposase	transposase	transposase	NA	NA	NA	NA
AXO58921.1|105006_106020_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXO58987.1|106165_106699_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AXO58922.1|106855_107203_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXO58923.1|107196_108036_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXO58924.1|108440_109982_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXO58925.1|110314_110971_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
AXO58926.1|111938_112118_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58927.1|112136_112409_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58928.1|112590_113595_-|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
115782:115795	attR	ATCCGAGCTGGCGC	NA	NA	NA	NA
>prophage 1
CP031581	Klebsiella pneumoniae strain S12 plasmid pIncFIA-1502320, complete sequence	71335	4692	64547	71335	transposase,integrase	Escherichia_phage(23.08%)	58	3495:3509	30588:30602
3495:3509	attL	CACCAATAAAAATAA	NA	NA	NA	NA
AXO58372.1|4692_5397_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	4.5e-138
AXO58435.1|5569_5821_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
AXO58436.1|6052_6130_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AXO58373.1|6122_6980_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AXO58374.1|7284_7473_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58375.1|7701_7899_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58376.1|8022_8358_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
AXO58377.1|8530_8812_+	cytoplasmic protein	NA	NA	NA	NA	NA
AXO58378.1|8865_9477_+	DUF2913 family protein	NA	NA	NA	NA	NA
AXO58379.1|9867_10572_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXO58380.1|10548_10830_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58381.1|11445_11781_-	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
AXO58382.1|11672_11900_-	protein SamB	NA	NA	NA	NA	NA
AXO58383.1|11875_12586_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58384.1|12650_13025_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXO58385.1|13048_13612_+	chlorite dismutase	NA	NA	NA	NA	NA
AXO58386.1|15013_15718_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXO58387.1|15764_16001_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58388.1|16074_16491_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXO58389.1|16487_16718_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXO58390.1|16701_17136_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58391.1|17279_17630_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58392.1|17680_18424_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58393.1|18420_19197_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
AXO58394.1|19254_19512_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58395.1|20276_21143_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	2.6e-23
AXO58396.1|22068_23274_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.1	1.2e-162
AXO58397.1|23270_24248_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	1.1e-86
AXO58398.1|24329_25601_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	6.4e-151
AXO58399.1|25600_26032_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AXO58400.1|27517_28942_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXO58401.1|28938_31878_-	DUF4145 domain-containing protein	NA	A0A2K9L5A2	Tupanvirus	23.8	9.9e-22
30588:30602	attR	CACCAATAAAAATAA	NA	NA	NA	NA
AXO58402.1|31955_32147_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AXO58403.1|32155_32542_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58404.1|36204_37269_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXO58405.1|38156_39308_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AXO58406.1|39264_39633_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	7.2e-39
AXO58407.1|41265_41523_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58408.1|41567_42688_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.3e-51
AXO58409.1|43057_44005_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58410.1|44231_45155_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	1.6e-172
AXO58411.1|45261_45597_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
AXO58412.1|45769_46048_+	cytoplasmic protein	NA	NA	NA	NA	NA
AXO58413.1|46310_47261_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.5	3.6e-74
AXO58414.1|47433_48054_-	serine recombinase	NA	A0A219Y912	Aeromonas_phage	31.5	7.7e-09
AXO58415.1|49274_50807_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
AXO58416.1|51820_52195_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58417.1|52194_52827_-	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.1	5.2e-29
AXO58418.1|53241_53442_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58419.1|53773_54529_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	2.0e-136
AXO58420.1|56249_56582_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXO58421.1|56578_57301_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.5e-96
AXO58422.1|57358_57787_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
AXO58423.1|57836_59120_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
AXO58424.1|59215_59569_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
AXO58425.1|60052_61531_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
AXO58426.1|61549_62377_+	universal stress protein	NA	NA	NA	NA	NA
AXO58427.1|64172_64547_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
>prophage 1
CP031583	Klebsiella pneumoniae strain S12 plasmid pIncFII-1502320, complete sequence	198719	0	15571	198719		Wolbachia_phage(100.0%)	9	NA	NA
AXO58617.1|3051_4305_+	MFS transporter	NA	NA	NA	NA	NA
AXO58618.1|6010_8320_+	ATPase	NA	NA	NA	NA	NA
AXO58619.1|8323_9640_+	ATP-binding protein	NA	NA	NA	NA	NA
AXO58782.1|12452_12641_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58620.1|12783_12972_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58621.1|13276_14134_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AXO58783.1|14126_14204_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AXO58622.1|14420_14699_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
AXO58784.1|15019_15571_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.1e-19
>prophage 2
CP031583	Klebsiella pneumoniae strain S12 plasmid pIncFII-1502320, complete sequence	198719	20674	21400	198719		Xanthomonas_phage(100.0%)	1	NA	NA
AXO58626.1|20674_21400_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.4	5.5e-06
>prophage 3
CP031583	Klebsiella pneumoniae strain S12 plasmid pIncFII-1502320, complete sequence	198719	55550	59153	198719		Cronobacter_phage(25.0%)	8	NA	NA
AXO58659.1|55550_56372_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	2.6e-44
AXO58660.1|56469_56688_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58661.1|57205_57619_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXO58662.1|57619_57898_-	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AXO58663.1|57887_58208_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
AXO58664.1|58288_58513_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58665.1|58523_58736_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58666.1|58796_59153_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
>prophage 4
CP031583	Klebsiella pneumoniae strain S12 plasmid pIncFII-1502320, complete sequence	198719	64573	68858	198719		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
AXO58676.1|64573_66610_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.0	9.0e-22
AXO58677.1|66679_66928_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXO58678.1|66976_67519_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
AXO58679.1|68079_68400_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58680.1|68294_68858_-	SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
>prophage 5
CP031583	Klebsiella pneumoniae strain S12 plasmid pIncFII-1502320, complete sequence	198719	71994	143295	198719	integrase,transposase	Bacillus_phage(25.0%)	65	68382:68398	99439:99455
68382:68398	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
AXO58789.1|71994_72249_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
AXO58684.1|72485_72911_-	antirestriction protein	NA	NA	NA	NA	NA
AXO58790.1|73431_73662_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58685.1|73894_75379_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AXO58686.1|75378_75630_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58687.1|75784_76210_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
AXO58688.1|76209_77481_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
AXO58689.1|79470_80433_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58690.1|80432_81404_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
AXO58691.1|81403_82570_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
AXO58692.1|83321_84332_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
AXO58693.1|84668_84866_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58694.1|85048_85789_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AXO58695.1|86932_87880_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
AXO58696.1|87906_88218_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AXO58697.1|89877_90135_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58698.1|90754_92191_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXO58699.1|93172_94450_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AXO58700.1|94512_96516_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AXO58791.1|97549_98757_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
AXO58701.1|100184_100616_-	silver-binding protein SilE	NA	NA	NA	NA	NA
99439:99455	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
AXO58702.1|100866_102342_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AXO58703.1|102334_103015_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AXO58704.1|103204_104590_+	Cu(I)/Ag(I) efflux RND transporter outer membrane protein	NA	NA	NA	NA	NA
AXO58705.1|104618_104972_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXO58706.1|105085_106378_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXO58707.1|109620_110061_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58708.1|110187_112635_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AXO58709.1|112675_112873_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AXO58710.1|112906_113644_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AXO58711.1|113932_114382_-	copper resistance protein	NA	NA	NA	NA	NA
AXO58712.1|114615_116433_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AXO58713.1|116432_117329_+	copper resistance protein B	NA	NA	NA	NA	NA
AXO58714.1|117368_117749_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AXO58715.1|117753_118683_+	copper resistance protein D	NA	NA	NA	NA	NA
AXO58716.1|118737_119418_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AXO58717.1|119414_120815_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AXO58718.1|121031_121466_+	copper-binding protein	NA	NA	NA	NA	NA
AXO58792.1|121697_121877_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXO58719.1|121937_123557_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	25.9	3.3e-11
AXO58720.1|123618_124128_+	porin	NA	NA	NA	NA	NA
AXO58793.1|124177_124675_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXO58721.1|125006_125333_+	transcriptional regulator	NA	NA	NA	NA	NA
AXO58794.1|125332_126043_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AXO58722.1|126051_126597_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXO58723.1|126672_127035_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AXO58724.1|128931_129468_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXO58725.1|129500_129926_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AXO58726.1|129938_131228_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AXO58727.1|131275_133027_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AXO58728.1|133044_133407_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AXO58729.1|133456_133807_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AXO58730.1|134164_134434_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58731.1|134421_134997_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58732.1|135027_135522_+	DNA-binding protein	NA	NA	NA	NA	NA
AXO58733.1|135565_135934_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58734.1|135967_136171_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AXO58735.1|136219_136477_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58736.1|136552_136807_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58737.1|136982_137249_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AXO58738.1|137236_137719_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXO58739.1|137877_139410_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
AXO58740.1|139521_140925_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AXO58741.1|140953_141586_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58742.1|141762_143295_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
>prophage 6
CP031583	Klebsiella pneumoniae strain S12 plasmid pIncFII-1502320, complete sequence	198719	148771	172545	198719	transposase	Escherichia_phage(41.67%)	21	NA	NA
AXO58746.1|148771_151534_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.1e-129
AXO58747.1|151648_152218_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXO58796.1|152252_152534_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AXO58748.1|154520_155501_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AXO58797.1|155539_155626_-	ABC transporter	NA	NA	NA	NA	NA
AXO58798.1|155677_156004_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58749.1|156709_157579_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXO58750.1|157572_158583_-	phosphonate dehydrogenase	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
AXO58799.1|158591_159419_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AXO58751.1|159427_160291_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXO58752.1|160287_161115_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
AXO58753.1|161970_162675_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXO58754.1|162686_163343_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXO58755.1|163438_164623_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AXO58756.1|164717_165827_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AXO58757.1|166316_167021_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXO58758.1|167993_169082_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AXO58759.1|169168_169429_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
AXO58760.1|170631_171267_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
AXO58800.1|171823_172201_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
AXO58761.1|172197_172545_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
>prophage 7
CP031583	Klebsiella pneumoniae strain S12 plasmid pIncFII-1502320, complete sequence	198719	176367	179056	198719		Planktothrix_phage(50.0%)	2	NA	NA
AXO58762.1|176367_178101_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
AXO58763.1|178108_179056_-	acetamidase	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
>prophage 8
CP031583	Klebsiella pneumoniae strain S12 plasmid pIncFII-1502320, complete sequence	198719	192531	193691	198719		Bacillus_virus(50.0%)	2	NA	NA
AXO58776.1|192531_193299_+	iron-dicitrate ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AXO58777.1|193397_193691_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
>prophage 9
CP031583	Klebsiella pneumoniae strain S12 plasmid pIncFII-1502320, complete sequence	198719	197440	198523	198719		Enterobacteria_phage(100.0%)	1	NA	NA
AXO58781.1|197440_198523_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
>prophage 1
CP031582	Klebsiella pneumoniae strain S12 plasmid pIncHI1B-1502320, complete sequence	206229	7626	81575	206229	protease,transposase	uncultured_Mediterranean_phage(13.33%)	54	NA	NA
AXO58441.1|7626_8725_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.3	2.2e-46
AXO58442.1|8814_9096_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58443.1|10806_11877_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58444.1|13207_14359_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
AXO58445.1|14383_15349_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AXO58446.1|15326_15824_-	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AXO58447.1|15820_17536_-	sodium:proton exchanger	NA	NA	NA	NA	NA
AXO58448.1|17539_17980_-	thioredoxin TrxC	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	5.8e-11
AXO58449.1|17969_19115_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58450.1|19194_19806_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AXO58451.1|19895_20783_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58452.1|20885_21800_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58453.1|21852_22281_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXO58454.1|22368_24177_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	39.6	2.7e-94
AXO58455.1|24237_24429_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58456.1|24428_27278_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.1	9.0e-129
AXO58457.1|27383_27953_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXO58607.1|27987_28269_-	DNA-binding protein	NA	NA	NA	NA	NA
AXO58458.1|28715_29138_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58459.1|29400_30924_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	3.3e-45
AXO58460.1|31700_32834_-	aldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	9.7e-10
AXO58461.1|33292_34891_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.4	4.0e-17
AXO58462.1|35114_36038_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.1	5.1e-166
AXO58463.1|36282_36531_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AXO58464.1|36520_36805_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	54.8	6.4e-19
AXO58465.1|44060_44366_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58466.1|44491_45478_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXO58467.1|45879_46803_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.1	2.7e-167
AXO58608.1|47516_48668_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	1.7e-25
AXO58468.1|48687_49650_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AXO58469.1|49636_50125_-	diguanylate cyclase	NA	NA	NA	NA	NA
AXO58470.1|50136_50379_-	diguanylate cyclase	NA	NA	NA	NA	NA
AXO58471.1|51154_52861_-	sodium:proton exchanger	NA	NA	NA	NA	NA
AXO58472.1|52864_53305_-	thioredoxin TrxC	NA	A0A023NHA9	Dinoroseobacter_phage	35.6	6.9e-12
AXO58473.1|53294_53900_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58474.1|53856_54549_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58475.1|54541_54733_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58476.1|54729_55641_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AXO58477.1|56478_57090_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AXO58478.1|57186_58074_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58479.1|58176_59091_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58480.1|59113_59572_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXO58481.1|60999_62430_-	cardiolipin synthase	NA	NA	NA	NA	NA
AXO58482.1|62446_65308_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.3	1.2e-128
AXO58483.1|65405_65978_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXO58484.1|66392_66656_-	hypothetical protein	NA	NA	NA	NA	NA
AXO58485.1|67212_68835_-|transposase	transposase	transposase	NA	NA	NA	NA
AXO58486.1|70331_71942_-	ATP-binding protein	NA	NA	NA	NA	NA
AXO58487.1|74007_74835_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
AXO58609.1|76783_76918_-	pilus assembly protein	NA	A0A2L1IV26	Escherichia_phage	100.0	2.6e-07
AXO58488.1|76893_77232_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58489.1|77328_77589_-	DUF2534 family protein	NA	NA	NA	NA	NA
AXO58490.1|79790_80210_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AXO58491.1|80570_81575_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP031582	Klebsiella pneumoniae strain S12 plasmid pIncHI1B-1502320, complete sequence	206229	195642	200037	206229		Salmonella_phage(25.0%)	10	NA	NA
AXO58593.1|195642_195963_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	1.7e-28
AXO58594.1|196043_196358_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58595.1|196477_196729_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
AXO58596.1|196894_197113_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
AXO58597.1|197205_197703_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.6e-23
AXO58598.1|197699_197888_+	hypothetical protein	NA	NA	NA	NA	NA
AXO58599.1|198365_198593_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
AXO58600.1|198589_199234_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
AXO58601.1|199234_199558_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
AXO58602.1|199650_200037_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
