The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	7692	78816	4898917	protease,transposase	Ralstonia_phage(30.0%)	55	NA	NA
AXM34597.1|7692_8529_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXM34598.1|8715_9522_+	M48 family peptidase	NA	NA	NA	NA	NA
AXM34599.1|9798_10992_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXM34600.1|11145_11817_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM34601.1|11901_12663_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
AXM34602.1|12709_13132_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM34603.1|13135_13549_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM34604.1|13844_14612_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AXM34605.1|14622_14892_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34606.1|14966_16427_-	cardiolipin synthase	NA	NA	NA	NA	NA
AXM34607.1|17073_18084_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
AXM34608.1|18355_19558_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AXM34609.1|19699_21838_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
AXM38003.1|22048_22342_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34610.1|22458_23004_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34611.1|23117_24098_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.2	5.3e-89
AXM34612.1|24145_25312_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AXM34613.1|25458_26025_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
AXM34614.1|27499_28708_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
AXM34615.1|29335_30358_-	sugar kinase	NA	NA	NA	NA	NA
AXM34616.1|31180_32149_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM34617.1|33595_34477_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.5e-05
AXM34618.1|35078_36455_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
AXM34619.1|39467_39710_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34620.1|39651_39975_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34621.1|40105_40492_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34622.1|40440_41421_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
AXM34623.1|41780_42032_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34624.1|42039_43329_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
AXM38004.1|43768_44104_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34625.1|44378_44810_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34626.1|45158_46568_-	FAD-binding protein	NA	NA	NA	NA	NA
AXM34627.1|47885_48146_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34628.1|48162_48495_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34629.1|48494_48953_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34630.1|49312_50527_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
AXM34631.1|51047_51845_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM34632.1|53560_54526_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM34633.1|54522_54723_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34634.1|54944_56264_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM34635.1|56381_57428_+	methylamine utilization protein	NA	NA	NA	NA	NA
AXM34636.1|58229_58862_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AXM34637.1|58878_61041_-	glycogen debranching enzyme GlgX	NA	NA	NA	NA	NA
AXM34638.1|61155_61341_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
AXM34639.1|61363_63967_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
AXM38005.1|63963_65853_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AXM34640.1|65909_67667_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
AXM34641.1|67669_69904_-	glycogen-branching enzyme	NA	NA	NA	NA	NA
AXM34642.1|69900_71484_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
AXM34643.1|71957_73586_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXM34644.1|73582_74947_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
AXM34645.1|75139_76081_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AXM34646.1|76098_76311_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34647.1|76321_78046_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
AXM34648.1|78052_78816_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	109333	135585	4898917	holin,transposase	Ralstonia_phage(50.0%)	24	NA	NA
AXM34675.1|109333_110302_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM34676.1|110514_111834_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM34677.1|112022_113006_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXM34678.1|113727_116136_+	serine kinase	NA	NA	NA	NA	NA
AXM38008.1|117011_118640_+	type III secretion system effector XopAE	NA	NA	NA	NA	NA
AXM34679.1|119197_119581_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34680.1|119577_120063_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AXM34681.1|120066_120429_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34682.1|120545_121982_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
AXM34683.1|122223_123075_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AXM34684.1|123534_123852_-	ATP-binding protein	NA	NA	NA	NA	NA
AXM34685.1|124157_125045_-	TIGR01777 family protein	NA	NA	NA	NA	NA
AXM34686.1|125751_126702_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
AXM34687.1|126815_127001_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34688.1|127092_127365_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34689.1|127405_127687_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34690.1|127825_128884_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM34691.1|129024_129972_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
AXM34692.1|130226_130538_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34693.1|131810_131993_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34694.1|132004_132475_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXM34695.1|132644_133337_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34696.1|133428_133827_+	host attachment protein	NA	NA	NA	NA	NA
AXM34697.1|134628_135585_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	220003	385029	4898917	tRNA,transposase	Bacillus_phage(15.79%)	114	NA	NA
AXM34737.1|220003_221908_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AXM34738.1|222168_222348_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34739.1|222481_222949_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34740.1|223106_224066_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
AXM34741.1|224050_224668_+	YdcF family protein	NA	NA	NA	NA	NA
AXM34742.1|224710_225130_+	isopropylmalate/homocitrate/citramalate synthase	NA	NA	NA	NA	NA
AXM34743.1|225382_226288_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.2	4.4e-37
AXM34744.1|226536_227421_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AXM34745.1|227484_228267_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM38016.1|228311_229073_-	pimeloyl-[acyl-carrier protein] methyl ester esterase	NA	NA	NA	NA	NA
AXM34746.1|229236_229566_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34747.1|229884_230976_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
AXM34748.1|231044_232643_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AXM34749.1|232807_234052_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AXM34750.1|234503_235133_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
AXM34751.1|235339_237316_+	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
AXM34752.1|238702_239368_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
AXM34753.1|239647_240658_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
AXM34754.1|240654_241386_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AXM34755.1|241739_243269_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
AXM34756.1|243378_246411_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34757.1|246709_249748_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34758.1|249912_250965_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXM34759.1|251133_251379_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34760.1|251377_252343_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34761.1|252342_255003_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
AXM34762.1|256821_257040_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AXM34763.1|259598_260084_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
AXM34764.1|260115_260442_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM34765.1|260663_261308_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
AXM34766.1|261448_262339_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
AXM34767.1|262466_262949_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXM34768.1|265984_266518_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34769.1|269333_270392_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
AXM34770.1|270377_270584_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34771.1|270699_271773_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
AXM34772.1|272535_273588_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
AXM34773.1|274235_275366_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
AXM38017.1|276682_277072_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34774.1|277279_277486_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34775.1|277717_278686_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM34776.1|278939_281102_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
AXM34777.1|281649_282954_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
AXM34778.1|283013_283616_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
AXM34779.1|283612_285517_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
AXM34780.1|294835_295651_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
AXM34781.1|295997_296960_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM34782.1|297064_297827_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM34783.1|299626_300685_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
AXM34784.1|300695_300986_-	STAS domain-containing protein	NA	NA	NA	NA	NA
AXM34785.1|300975_301638_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
AXM34786.1|301634_302186_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AXM34787.1|302197_302947_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM34788.1|302946_303741_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
AXM34789.1|304125_304413_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34790.1|304431_304989_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM34791.1|305006_305972_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM34792.1|306816_307773_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
AXM34793.1|308260_309229_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM34794.1|309806_310605_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM34795.1|310736_311951_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
AXM34796.1|312010_312841_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM34797.1|313003_314239_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM34798.1|315637_316066_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38018.1|316085_316526_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AXM34799.1|316428_316734_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34800.1|317041_318796_-	polyvinylalcohol dehydrogenase	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
AXM34801.1|319674_320437_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM34802.1|320490_321075_-	gluconokinase	NA	NA	NA	NA	NA
AXM34803.1|321232_322615_+	MFS transporter	NA	NA	NA	NA	NA
AXM38019.1|322617_325017_+	NdvB protein	NA	NA	NA	NA	NA
AXM34804.1|325120_327763_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34805.1|328169_328370_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38020.1|328510_331960_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AXM34806.1|332152_332737_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34807.1|333213_333990_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXM34808.1|334170_335472_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AXM38021.1|335468_335834_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AXM34809.1|336270_337752_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
AXM38022.1|337944_338910_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM34810.1|339736_341899_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AXM34811.1|342025_344194_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AXM34812.1|344831_345461_-	acyltransferase	NA	NA	NA	NA	NA
AXM34813.1|345463_345895_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AXM34814.1|345987_346530_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
AXM34815.1|346625_347378_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AXM34816.1|347602_347992_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM34817.1|348105_349779_-	ubiquinone biosynthesis protein UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
AXM34818.1|349775_350420_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
AXM34819.1|350429_350624_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34820.1|354104_354389_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34821.1|354740_355539_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM34822.1|355598_356362_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38023.1|360315_361281_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM34823.1|362341_363448_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM34824.1|365059_365242_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38024.1|365241_366180_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AXM34825.1|366298_367048_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	5.6e-54
AXM34826.1|367050_367842_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM34827.1|367859_368855_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
AXM34828.1|368957_369719_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AXM34829.1|369803_370805_-	cation transporter	NA	NA	NA	NA	NA
AXM34830.1|370870_371143_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AXM38025.1|371628_372216_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34831.1|372212_372413_+	transcriptional regulator	NA	NA	NA	NA	NA
AXM34832.1|372473_374075_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM34833.1|374106_374853_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
AXM34834.1|374849_376043_+	ABC transporter permease	NA	NA	NA	NA	NA
AXM34835.1|376452_377475_-	energy transducer TonB	NA	NA	NA	NA	NA
AXM34836.1|377614_379180_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
AXM34837.1|379190_380204_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
AXM34838.1|380193_380895_-	peptidase	NA	NA	NA	NA	NA
AXM38026.1|381078_384093_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM34839.1|384266_385029_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	567652	617150	4898917	tRNA,integrase,transposase	Stenotrophomonas_phage(25.0%)	45	575803:575819	613938:613954
AXM34971.1|567652_568618_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM34972.1|569085_570405_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM34973.1|570934_571450_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXM34974.1|571852_574075_-	primosomal protein N'	NA	NA	NA	NA	NA
AXM34975.1|574543_575569_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34976.1|575552_576155_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
575803:575819	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
AXM34977.1|576485_577430_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34978.1|577389_577671_+	hypothetical protein	NA	NA	NA	NA	NA
AXM34979.1|577948_579325_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AXM34980.1|579409_581311_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
AXM34981.1|581496_581712_-	hypothetical protein	NA	NA	NA	NA	NA
AXM34982.1|581818_582595_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM34983.1|582756_583431_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM34984.1|583427_584201_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM34985.1|584424_584988_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AXM34986.1|584998_587491_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
AXM34987.1|587673_588948_-	RDD family protein	NA	NA	NA	NA	NA
AXM34988.1|588989_589712_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
AXM34989.1|589752_590226_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AXM34990.1|590268_591411_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AXM34991.1|591482_592619_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
AXM34992.1|592751_593264_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
AXM34993.1|593657_594581_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
AXM34994.1|594580_595894_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AXM34995.1|595944_597666_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AXM34996.1|597830_599108_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
AXM34997.1|599305_600130_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AXM34998.1|600130_601189_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
AXM34999.1|601354_602821_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38050.1|602817_603321_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35000.1|603430_604564_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
AXM35001.1|604806_605328_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXM35002.1|605527_606442_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
AXM35003.1|606542_606983_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AXM35004.1|607091_608966_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
AXM35005.1|609158_609479_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35006.1|610107_611382_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
AXM35007.1|611294_611558_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	71.4	7.2e-17
AXM35008.1|611515_611722_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35009.1|611718_611991_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38051.1|611987_612233_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35010.1|614168_615404_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
613938:613954	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
AXM35011.1|615472_615862_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35012.1|615858_616062_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38052.1|616184_617150_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	721765	779740	4898917	transposase	Enterobacteria_phage(25.0%)	54	NA	NA
AXM35100.1|721765_722731_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM38062.1|725139_726411_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM35101.1|726618_728448_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	1.3e-133
AXM35102.1|728829_729303_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35103.1|729534_730110_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35104.1|730142_730905_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38063.1|731021_732056_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM35105.1|732272_732797_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AXM35106.1|732969_733938_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM35107.1|734113_735220_-	copper resistance protein B	NA	NA	NA	NA	NA
AXM35108.1|735216_737064_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
AXM35109.1|737150_737567_-	copper homeostasis protein	NA	NA	NA	NA	NA
AXM35110.1|737702_738806_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
AXM35111.1|738849_740874_+	oligopeptidase A	NA	NA	NA	NA	NA
AXM35112.1|741047_741869_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35113.1|741982_743191_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AXM35114.1|743190_743706_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AXM35115.1|743704_744052_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35116.1|744051_745131_+	DNA polymerase IV	NA	NA	NA	NA	NA
AXM35117.1|745272_745923_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AXM35118.1|746234_746633_-	transcriptional regulator	NA	NA	NA	NA	NA
AXM35119.1|746629_747112_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AXM35120.1|747436_748111_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AXM35121.1|748225_748561_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35122.1|748753_749107_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AXM35123.1|749068_749248_+	GTP-binding protein	NA	NA	NA	NA	NA
AXM35124.1|749519_750902_-	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	1.4e-55
AXM35125.1|750994_751120_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AXM38064.1|751281_752271_+	FAA hydrolase family protein	NA	NA	NA	NA	NA
AXM35126.1|752314_752941_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
AXM35127.1|753279_754419_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
AXM35128.1|754511_754895_+	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
AXM35129.1|754891_755782_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35130.1|756123_756342_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AXM38065.1|756583_757954_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
AXM35131.1|758044_759238_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AXM35132.1|759284_760085_+	FkbM family methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	3.5e-06
AXM35133.1|760119_761196_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SG19	Hokovirus	21.8	4.9e-11
AXM35134.1|762227_763154_+	glycosyltransferase	NA	NA	NA	NA	NA
AXM35135.1|763174_763465_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35136.1|763455_764619_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AXM35137.1|764624_765677_+	acyltransferase	NA	A9YX16	Burkholderia_phage	33.9	1.5e-41
AXM35138.1|765763_767083_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM38066.1|767398_768583_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXM35139.1|769112_770426_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
AXM35140.1|770415_771234_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM35141.1|771456_772398_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AXM35142.1|772397_773144_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
AXM38067.1|773369_774425_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
AXM35143.1|774480_775368_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
AXM35144.1|775364_775922_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
AXM35145.1|775918_776827_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
AXM35146.1|776943_778347_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
AXM35147.1|778393_779740_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	1.5e-33
>prophage 6
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	792004	835308	4898917	tRNA,transposase	Ralstonia_phage(22.22%)	28	NA	NA
AXM35160.1|792004_793699_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AXM35161.1|793810_794215_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXM35162.1|794346_795120_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXM35163.1|795130_795598_+	alanine acetyltransferase	NA	NA	NA	NA	NA
AXM38068.1|795603_796077_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AXM35164.1|796635_797955_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM35165.1|798112_799432_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM35166.1|799644_800613_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AXM35167.1|800762_802082_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM38069.1|802314_804360_+	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	8.2e-15
AXM35168.1|804626_805667_-	pectate lyase	NA	NA	NA	NA	NA
AXM35169.1|807256_808054_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM35170.1|808706_809021_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AXM35171.1|809208_810311_-|transposase	IS3-like element ISXo17 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	7.2e-42
AXM35172.1|811247_814190_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	6.4e-130
AXM35173.1|814397_814823_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AXM35174.1|814863_815169_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35175.1|815168_816641_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
AXM35176.1|816748_817831_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AXM38070.1|817827_818934_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AXM35177.1|819108_820077_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM35178.1|820508_820976_-	RDD family protein	NA	NA	NA	NA	NA
AXM35179.1|821402_822374_+	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
AXM35180.1|822829_823627_+	DsbC family protein	NA	NA	NA	NA	NA
AXM35181.1|824025_828078_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	7.5e-121
AXM35182.1|828335_828599_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35183.1|829055_832853_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35184.1|834351_835308_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	2.4e-41
>prophage 7
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	871019	922647	4898917	protease,transposase	Ralstonia_phage(18.18%)	45	NA	NA
AXM35209.1|871019_871985_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM35210.1|872375_872951_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AXM35211.1|873063_873573_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
AXM35212.1|873671_873866_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AXM35213.1|873955_874933_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
AXM35214.1|875162_875603_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
AXM35215.1|875880_876825_+	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AXM35216.1|876907_877651_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
AXM35217.1|877855_878095_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
AXM35218.1|878236_879472_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AXM35219.1|879642_880998_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
AXM35220.1|881058_882132_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
AXM35221.1|882128_883088_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
AXM35222.1|883084_883438_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AXM38072.1|883961_884435_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38073.1|885455_885782_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35223.1|886017_887616_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
AXM35224.1|887761_888658_+	methylisocitrate lyase	NA	NA	NA	NA	NA
AXM35225.1|888733_889888_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
AXM35226.1|890068_892660_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AXM35227.1|892982_893120_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM35228.1|893203_893401_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35229.1|893392_894592_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
AXM35230.1|895041_896010_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
AXM35231.1|896251_898468_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM35232.1|898546_899545_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AXM35233.1|899654_899837_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35234.1|900816_903804_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM35235.1|903978_904926_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
AXM35236.1|905251_905473_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35237.1|905429_905966_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35238.1|906036_907356_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM35239.1|907700_908663_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
AXM35240.1|908796_909357_-	bacterioferritin	NA	NA	NA	NA	NA
AXM35241.1|909399_909882_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
AXM35242.1|910044_910521_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXM35243.1|910931_911831_+	J domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
AXM35244.1|912070_912457_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
AXM38074.1|913086_914214_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
AXM35245.1|914213_915077_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
AXM35246.1|915370_915556_+	DUF2065 family protein	NA	NA	NA	NA	NA
AXM35247.1|915893_917186_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.5	8.4e-74
AXM35248.1|917511_920184_+	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	2.6e-77
AXM35249.1|920377_921160_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM38075.1|921270_922647_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	4.3e-76
>prophage 8
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	961368	1083733	4898917	integrase,protease,transposase	Ralstonia_phage(26.09%)	88	1011913:1011931	1080844:1080862
AXM35276.1|961368_962334_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM38077.1|962330_962504_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35277.1|962788_963280_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35278.1|964959_966216_-	6-phosphofructokinase	NA	NA	NA	NA	NA
AXM35279.1|966375_966939_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
AXM38078.1|967305_968664_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AXM35280.1|968663_969260_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXM35281.1|969406_970291_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35282.1|972272_972887_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXM35283.1|972969_973956_-	malate dehydrogenase	NA	NA	NA	NA	NA
AXM35284.1|974071_974566_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
AXM35285.1|974810_976640_+	translational GTPase TypA	NA	NA	NA	NA	NA
AXM35286.1|976658_977129_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
AXM35287.1|978051_979179_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AXM35288.1|979279_980662_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
AXM35289.1|980909_983033_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM35290.1|983561_984080_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AXM35291.1|984786_985888_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
AXM35292.1|986403_987639_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM38079.1|988252_989143_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35293.1|992932_994168_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM35294.1|995150_996470_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM38080.1|997215_998139_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
AXM38081.1|999201_1000167_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM35295.1|1000468_1002046_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35296.1|1002113_1002877_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM35297.1|1005545_1006514_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM35298.1|1006516_1006798_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35299.1|1006774_1007236_-	cell wall hydrolase	NA	NA	NA	NA	NA
AXM35300.1|1007784_1008027_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AXM35301.1|1008020_1008784_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM35302.1|1008816_1009548_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
AXM35303.1|1011367_1012120_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1011913:1011931	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
AXM38082.1|1012121_1013087_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM35304.1|1013350_1014358_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AXM35305.1|1014501_1015263_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35306.1|1018580_1019873_+	trigger factor	NA	NA	NA	NA	NA
AXM35307.1|1019965_1020592_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
AXM35308.1|1020716_1022003_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
AXM35309.1|1022146_1024618_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
AXM35310.1|1024831_1025104_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
AXM35311.1|1025935_1027906_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM35312.1|1028611_1029790_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AXM35313.1|1029786_1030554_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AXM35314.1|1030566_1031223_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35315.1|1031250_1031703_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
AXM35316.1|1031711_1032446_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
AXM35317.1|1032881_1033586_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AXM35318.1|1034411_1035041_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35319.1|1035932_1036133_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35320.1|1036528_1039252_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	2.8e-71
AXM38083.1|1039319_1041470_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
AXM35321.1|1041466_1043164_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM35322.1|1043483_1045688_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
AXM35323.1|1045684_1047379_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM35324.1|1047375_1047639_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
AXM35325.1|1047700_1049908_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
AXM35326.1|1049904_1051584_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AXM35327.1|1051580_1051844_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
AXM35328.1|1051905_1052463_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38084.1|1052545_1053511_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM38085.1|1053609_1054296_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
AXM35329.1|1054406_1054811_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
AXM35330.1|1055021_1056071_-	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
AXM35331.1|1056091_1056841_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
AXM35332.1|1056840_1057590_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
AXM35333.1|1057589_1058621_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
AXM35334.1|1058638_1058998_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AXM35335.1|1059022_1059520_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AXM35336.1|1059516_1059762_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
AXM35337.1|1059758_1060205_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
AXM35338.1|1060766_1062863_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
AXM35339.1|1062869_1063190_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AXM35340.1|1063287_1063881_+	recombination protein RecR	NA	NA	NA	NA	NA
AXM35341.1|1063982_1064333_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AXM35342.1|1064452_1064986_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35343.1|1064982_1066935_-	DUF3488 domain-containing protein	NA	NA	NA	NA	NA
AXM35344.1|1066927_1067884_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AXM35345.1|1067889_1068843_-	MoxR family ATPase	NA	NA	NA	NA	NA
AXM35346.1|1068881_1070750_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AXM35347.1|1072265_1072781_+	peptide deformylase	NA	NA	NA	NA	NA
AXM35348.1|1073297_1074056_+	cellulase	NA	NA	NA	NA	NA
AXM38086.1|1074528_1075275_+	cellulase	NA	NA	NA	NA	NA
AXM35349.1|1075891_1077493_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
AXM35350.1|1078481_1079717_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM35351.1|1080545_1081514_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1080844:1080862	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
AXM35352.1|1081981_1082332_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
AXM35353.1|1082413_1083733_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 9
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	1122463	1164910	4898917	transposase	Leptospira_phage(25.0%)	40	NA	NA
AXM38088.1|1122463_1123565_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
AXM35383.1|1124995_1125619_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AXM35384.1|1125642_1125882_+	rubredoxin	NA	NA	NA	NA	NA
AXM35385.1|1125931_1126813_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38089.1|1126962_1127412_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
AXM35386.1|1127562_1128210_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
AXM35387.1|1128301_1128772_-	EVE domain-containing protein	NA	NA	NA	NA	NA
AXM35388.1|1128768_1129359_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AXM35389.1|1129967_1130267_-	cell division protein ZapA	NA	NA	NA	NA	NA
AXM38090.1|1130263_1130485_-	TIGR02449 family protein	NA	NA	NA	NA	NA
AXM35390.1|1130720_1131263_+	YecA family protein	NA	NA	NA	NA	NA
AXM35391.1|1131273_1132614_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AXM35392.1|1133321_1134085_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38091.1|1134317_1135643_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
AXM35393.1|1135841_1136189_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
AXM35394.1|1136185_1138594_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
AXM35395.1|1138772_1139930_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
AXM35396.1|1139945_1140545_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
AXM35397.1|1140541_1140937_-	glyoxalase	NA	NA	NA	NA	NA
AXM35398.1|1140933_1141659_-	ribonuclease PH	NA	NA	NA	NA	NA
AXM35399.1|1141768_1142629_+	YicC family protein	NA	NA	NA	NA	NA
AXM35400.1|1142745_1143357_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
AXM35401.1|1143537_1144335_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM35402.1|1144483_1144783_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AXM35403.1|1144911_1147083_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
AXM35404.1|1147162_1147543_+	RidA family protein	NA	NA	NA	NA	NA
AXM35405.1|1147563_1149717_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AXM35406.1|1149842_1150781_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AXM35407.1|1150852_1151095_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AXM38092.1|1151308_1152598_+	citrate synthase	NA	NA	NA	NA	NA
AXM35408.1|1152975_1153626_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35409.1|1153935_1156458_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
AXM35410.1|1156580_1157639_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
AXM35411.1|1157638_1158397_+	fimbrial protein	NA	NA	NA	NA	NA
AXM35412.1|1158393_1159059_+	fimbrial protein	NA	NA	NA	NA	NA
AXM35413.1|1159055_1159589_+	fimbrial protein	NA	NA	NA	NA	NA
AXM35414.1|1159608_1161558_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
AXM35415.1|1161628_1162427_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM35416.1|1162569_1163805_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM35417.1|1163875_1164910_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	1204127	1236012	4898917	transposase	Feldmannia_irregularis_virus(16.67%)	25	NA	NA
AXM35443.1|1204127_1204890_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM35444.1|1204979_1205945_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM35445.1|1206054_1207374_-	sensor histidine kinase	NA	NA	NA	NA	NA
AXM35446.1|1207836_1208514_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
AXM38098.1|1208593_1208983_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38099.1|1209196_1210084_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
AXM35447.1|1210517_1211502_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
AXM35448.1|1211676_1213764_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AXM35449.1|1213915_1214575_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXM35450.1|1214655_1215453_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM35451.1|1215475_1215655_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35452.1|1215673_1216078_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AXM35453.1|1216111_1216471_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AXM35454.1|1216714_1217587_-	ion transporter	NA	NA	NA	NA	NA
AXM35455.1|1217659_1218886_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
AXM35456.1|1219130_1219748_-	hydrolase	NA	NA	NA	NA	NA
AXM35457.1|1221308_1222892_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
AXM35458.1|1222888_1223314_+	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
AXM35459.1|1223338_1223842_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35460.1|1225284_1225734_+	azurin	NA	NA	NA	NA	NA
AXM35461.1|1228980_1230270_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AXM35462.1|1232280_1233735_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35463.1|1234231_1235101_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
AXM35464.1|1235122_1235794_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXM35465.1|1235790_1236012_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	1450221	1593491	4898917	tRNA,transposase	uncultured_Caudovirales_phage(16.0%)	109	NA	NA
AXM35612.1|1450221_1451187_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM35613.1|1451566_1452244_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXM35614.1|1452781_1453006_-	putative selenoprotein	NA	NA	NA	NA	NA
AXM35615.1|1453005_1455078_-	carbon starvation protein A	NA	NA	NA	NA	NA
AXM35616.1|1455309_1456167_+	pirin family protein	NA	NA	NA	NA	NA
AXM38119.1|1457202_1459605_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
AXM35617.1|1459659_1460520_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM35618.1|1460480_1461167_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM38120.1|1461156_1462569_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXM35619.1|1462578_1465002_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.4e-37
AXM35620.1|1464998_1465946_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM38121.1|1466939_1467488_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM38122.1|1467882_1468440_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM35621.1|1468489_1470598_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXM35622.1|1470619_1472521_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.9e-30
AXM35623.1|1472575_1473436_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM35624.1|1473396_1474083_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM35625.1|1474546_1474780_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM38123.1|1475000_1475567_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM35626.1|1475769_1476357_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM38124.1|1476664_1477144_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM35627.1|1477140_1479549_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXM35628.1|1479893_1480355_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35629.1|1480601_1481492_-	pirin family protein	NA	NA	NA	NA	NA
AXM35630.1|1481669_1481945_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38125.1|1482259_1482973_-	endonuclease V	NA	NA	NA	NA	NA
AXM35631.1|1483076_1483826_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AXM35632.1|1484186_1484438_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35633.1|1484770_1486828_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
AXM38126.1|1488775_1489897_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AXM35634.1|1489911_1490739_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AXM35635.1|1490722_1492006_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM35636.1|1492032_1492548_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM35637.1|1492558_1494715_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
AXM35638.1|1494782_1496780_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AXM35639.1|1496798_1497128_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AXM35640.1|1497617_1501082_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AXM35641.1|1501484_1502027_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM38127.1|1502438_1503347_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AXM35642.1|1503692_1504491_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM35643.1|1504634_1505354_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXM35644.1|1505509_1506544_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM35645.1|1506564_1507377_-	peptidase C1	NA	NA	NA	NA	NA
AXM35646.1|1508112_1508496_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35647.1|1508618_1509788_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
AXM35648.1|1509782_1510841_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
AXM38128.1|1510901_1511714_-	peptidase C1	NA	NA	NA	NA	NA
AXM35649.1|1512229_1512613_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35650.1|1512771_1513935_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
AXM35651.1|1513965_1514778_-	peptidase C1	NA	NA	NA	NA	NA
AXM35652.1|1515008_1515596_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AXM35653.1|1515894_1516851_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM38129.1|1516924_1517656_+	nitrilase	NA	NA	NA	NA	NA
AXM35654.1|1517677_1518781_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
AXM35655.1|1518849_1520253_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AXM35656.1|1520266_1520773_+	transcriptional repressor	NA	NA	NA	NA	NA
AXM35657.1|1521178_1521637_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM35658.1|1522414_1522618_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35659.1|1524179_1524665_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
AXM35660.1|1524692_1524926_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35661.1|1524892_1525108_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
AXM35662.1|1525357_1525837_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXM35663.1|1525968_1526397_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35664.1|1526469_1527300_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AXM35665.1|1527361_1528129_-	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
AXM35666.1|1528128_1528344_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35667.1|1528489_1529281_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXM38130.1|1529438_1530602_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM35668.1|1532835_1533474_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AXM35669.1|1533649_1535590_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
AXM35670.1|1535806_1536361_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
AXM35671.1|1536582_1538013_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
AXM35672.1|1538079_1539534_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
AXM38131.1|1539761_1539941_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35673.1|1539950_1540676_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
AXM35674.1|1540774_1541185_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXM35675.1|1541236_1542193_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
AXM35676.1|1542436_1544818_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM38132.1|1547465_1547876_+	MerC domain-containing protein	NA	NA	NA	NA	NA
AXM35677.1|1548175_1548358_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
AXM35678.1|1548490_1549531_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AXM35679.1|1549603_1551049_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
AXM35680.1|1552579_1553548_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM35681.1|1553898_1554444_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
AXM35682.1|1554440_1555904_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
AXM35683.1|1557364_1557619_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35684.1|1558021_1558555_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
AXM35685.1|1558580_1558982_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35686.1|1558950_1559331_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35687.1|1559327_1559570_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AXM38133.1|1559606_1560260_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35688.1|1560936_1562841_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
AXM35689.1|1563104_1565501_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
AXM35690.1|1565650_1566373_+	pseudouridine synthase	NA	NA	NA	NA	NA
AXM35691.1|1569292_1569793_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
AXM35692.1|1569734_1571411_+	serine hydrolase	NA	NA	NA	NA	NA
AXM35693.1|1571557_1572823_+	cation:proton antiporter	NA	NA	NA	NA	NA
AXM35694.1|1572881_1574075_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
AXM35695.1|1574071_1574761_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
AXM38134.1|1574866_1576336_+	outer membrane channel protein	NA	NA	NA	NA	NA
AXM35696.1|1576355_1577192_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
AXM35697.1|1577217_1578321_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM35698.1|1578317_1581374_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXM35699.1|1581439_1582030_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AXM35700.1|1582161_1583994_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
AXM35701.1|1584069_1584833_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM35702.1|1584875_1586195_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM35703.1|1587492_1591983_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AXM35704.1|1592522_1593491_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 12
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	1717000	1782897	4898917	tRNA,transposase	Bacillus_phage(20.0%)	43	NA	NA
AXM35788.1|1717000_1718236_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM35789.1|1718286_1719050_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM35790.1|1719116_1720493_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
AXM35791.1|1720871_1721546_+	7-cyano-7-deazaguanine synthase	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
AXM35792.1|1722176_1722581_-	response regulator	NA	NA	NA	NA	NA
AXM35793.1|1722659_1723157_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35794.1|1723295_1725092_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
AXM35795.1|1725204_1725432_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35796.1|1725647_1726193_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
AXM35797.1|1726294_1730416_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
AXM35798.1|1730636_1733279_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM35799.1|1734720_1736235_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AXM35800.1|1736405_1737168_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM35801.1|1737479_1737992_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35802.1|1738054_1739173_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
AXM35803.1|1739169_1739448_-	pyrroloquinoline quinone biosynthesis protein PqqD	NA	NA	NA	NA	NA
AXM35804.1|1739444_1740197_-	pyrroloquinoline-quinone synthase	NA	NA	NA	NA	NA
AXM35805.1|1740193_1741093_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
AXM35806.1|1741176_1741257_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
AXM35807.1|1741546_1743733_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
AXM38142.1|1744050_1745493_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35808.1|1745825_1747928_-	glycosyltransferase	NA	NA	NA	NA	NA
AXM35809.1|1748169_1750614_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
AXM35810.1|1750627_1751152_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35811.1|1751351_1753379_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
AXM35812.1|1753392_1754112_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AXM35813.1|1754108_1755023_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
AXM35814.1|1755317_1756193_-	energy transducer TonB	NA	NA	NA	NA	NA
AXM35815.1|1756189_1757140_-	glutathione synthase	NA	NA	NA	NA	NA
AXM38143.1|1757389_1757791_+	response regulator	NA	NA	NA	NA	NA
AXM35816.1|1757808_1758171_+	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
AXM35817.1|1758170_1758701_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM35818.1|1758740_1760777_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
AXM35819.1|1760890_1767832_+	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
AXM35820.1|1767839_1769042_+	chemotaxis protein	NA	NA	NA	NA	NA
AXM35821.1|1769075_1769552_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM35822.1|1769802_1770426_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM38144.1|1770437_1771520_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM35823.1|1776141_1777206_+	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
AXM35824.1|1777202_1777934_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXM35825.1|1777958_1779917_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35826.1|1780058_1781162_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
AXM35827.1|1781661_1782897_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	1950854	2023101	4898917	coat,tRNA,protease,transposase	Emiliania_huxleyi_virus(20.0%)	59	NA	NA
AXM35952.1|1950854_1951617_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM35953.1|1952008_1954573_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
AXM35954.1|1955553_1955901_+	RidA family protein	NA	NA	NA	NA	NA
AXM35955.1|1956062_1957133_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM35956.1|1957150_1957933_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
AXM35957.1|1957929_1958475_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
AXM35958.1|1958471_1959767_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
AXM35959.1|1959763_1960723_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
AXM35960.1|1960647_1961898_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM38152.1|1961894_1962893_-	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
AXM35961.1|1963118_1963964_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35962.1|1963948_1964512_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXM35963.1|1964570_1964939_-	DUF4345 domain-containing protein	NA	NA	NA	NA	NA
AXM35964.1|1965024_1965807_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35965.1|1966030_1966213_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35966.1|1966425_1966854_-	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
AXM35967.1|1966855_1967452_-	HAD family hydrolase	NA	NA	NA	NA	NA
AXM35968.1|1967659_1969744_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
AXM35969.1|1969968_1970418_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
AXM35970.1|1971181_1972240_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM35971.1|1972510_1973908_+	S-methylmethionine permease	NA	NA	NA	NA	NA
AXM35972.1|1973904_1974882_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AXM35973.1|1975063_1977001_-	DUF885 family protein	NA	NA	NA	NA	NA
AXM35974.1|1977421_1978198_-	VUT family protein	NA	R4TNY5	Halovirus	27.2	1.9e-09
AXM38153.1|1978202_1978877_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
AXM38154.1|1980507_1981884_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
AXM35975.1|1981923_1982319_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
AXM35976.1|1982361_1983843_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.7	3.7e-102
AXM38155.1|1985071_1985242_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
AXM35977.1|1988936_1989500_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38156.1|1989972_1991289_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
AXM35978.1|1991456_1992059_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM38157.1|1992132_1992579_+	CopD family protein	NA	NA	NA	NA	NA
AXM35979.1|1992656_1992923_-	hypothetical protein	NA	NA	NA	NA	NA
AXM35980.1|1992912_1993128_+	hypothetical protein	NA	NA	NA	NA	NA
AXM35981.1|1993744_1995088_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
AXM35982.1|1995024_1996437_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
AXM35983.1|1996433_1997171_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
AXM35984.1|1997170_1999351_-	ligand-gated channel	NA	NA	NA	NA	NA
AXM35985.1|2000190_2001150_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
AXM35986.1|2001325_2004916_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
AXM35987.1|2005373_2006114_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
AXM38158.1|2006110_2007367_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AXM35988.1|2007405_2008197_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AXM35989.1|2008220_2008682_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AXM35990.1|2008678_2009692_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AXM35991.1|2010091_2012545_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AXM35992.1|2012541_2013888_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AXM35993.1|2013914_2015105_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AXM35994.1|2015107_2015935_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AXM35995.1|2015931_2016693_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
AXM35996.1|2016710_2017268_-	ribosome recycling factor	NA	NA	NA	NA	NA
AXM35997.1|2017448_2018171_-	UMP kinase	NA	NA	NA	NA	NA
AXM35998.1|2018227_2018605_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
AXM35999.1|2018732_2019611_-	elongation factor Ts	NA	NA	NA	NA	NA
AXM36000.1|2019780_2020584_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AXM36001.1|2020959_2021685_-	molecular chaperone	NA	NA	NA	NA	NA
AXM36002.1|2021687_2022020_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36003.1|2022066_2023101_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 14
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2077986	2198476	4898917	tRNA,transposase	Ralstonia_phage(17.39%)	90	NA	NA
AXM36041.1|2077986_2079306_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36042.1|2079640_2080567_-	multidrug transporter	NA	NA	NA	NA	NA
AXM36043.1|2080696_2081302_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM36044.1|2081640_2083410_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
AXM38162.1|2083406_2084000_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
AXM36045.1|2084267_2084861_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
AXM36046.1|2085059_2086496_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
AXM36047.1|2086737_2087940_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AXM36048.1|2087982_2090811_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AXM36049.1|2090991_2091924_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM36050.1|2091920_2093420_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM38163.1|2093757_2094021_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
AXM36051.1|2094300_2094801_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
AXM36052.1|2095042_2096410_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
AXM36053.1|2099433_2100196_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38164.1|2101648_2103052_+	class II fumarate hydratase	NA	NA	NA	NA	NA
AXM36054.1|2103174_2103597_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36055.1|2104229_2105066_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36056.1|2105075_2106062_-	ABC transporter permease	NA	NA	NA	NA	NA
AXM36057.1|2106058_2106934_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
AXM36058.1|2106930_2107293_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXM36059.1|2107295_2107544_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36060.1|2107679_2108237_+	glutathione peroxidase	NA	NA	NA	NA	NA
AXM36061.1|2108328_2109294_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM36062.1|2109319_2110669_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
AXM36063.1|2110661_2110898_+	protein SlyX	NA	NA	NA	NA	NA
AXM36064.1|2110898_2111651_+	DUF2058 family protein	NA	NA	NA	NA	NA
AXM36065.1|2111984_2112830_+	transporter	NA	NA	NA	NA	NA
AXM38165.1|2112970_2114146_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM36066.1|2114159_2115470_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AXM36067.1|2115394_2116453_+	carbohydrate kinase	NA	NA	NA	NA	NA
AXM36068.1|2116449_2117655_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
AXM36069.1|2118041_2120795_-	methionine synthase	NA	NA	NA	NA	NA
AXM36070.1|2120937_2122077_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
AXM36071.1|2122073_2123069_-	methyltransferase domain-containing protein	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
AXM38166.1|2123190_2124339_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM36072.1|2124338_2124479_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXM38167.1|2124672_2124897_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36073.1|2124850_2126296_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
AXM36074.1|2126862_2129391_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
AXM36075.1|2129601_2130400_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM36076.1|2131470_2132238_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AXM36077.1|2132239_2132587_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36078.1|2132745_2133714_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM38168.1|2135066_2136032_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM38169.1|2136476_2137661_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM36079.1|2137715_2139191_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
AXM36080.1|2139512_2139695_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
AXM36081.1|2139843_2141043_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AXM36082.1|2141903_2142872_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM36083.1|2143063_2144032_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM36084.1|2145208_2146311_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
AXM38170.1|2146497_2146965_-	energy transducer TonB	NA	NA	NA	NA	NA
AXM36085.1|2147325_2148090_-	energy transducer TonB	NA	NA	NA	NA	NA
AXM36086.1|2148096_2149446_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
AXM36087.1|2149595_2150394_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM36088.1|2150833_2152153_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36089.1|2152365_2153334_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM36090.1|2153397_2153982_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AXM36091.1|2154081_2155095_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM38171.1|2156295_2156391_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36092.1|2156464_2160064_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AXM36093.1|2160203_2160503_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXM36094.1|2160506_2160701_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXM36095.1|2160969_2164776_-	avirulence protein	NA	NA	NA	NA	NA
AXM36096.1|2167959_2172087_-	avirulence protein	NA	NA	NA	NA	NA
AXM36097.1|2172375_2173695_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36098.1|2175526_2176612_-	peptidase C13	NA	NA	NA	NA	NA
AXM36099.1|2176939_2177638_-	acireductone synthase	NA	NA	NA	NA	NA
AXM36100.1|2177640_2178207_-	acireductone dioxygenase	NA	NA	NA	NA	NA
AXM36101.1|2178218_2178896_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
AXM36102.1|2178984_2180415_-	amino acid permease	NA	NA	NA	NA	NA
AXM36103.1|2180491_2181973_-	amino acid permease	NA	NA	NA	NA	NA
AXM36104.1|2182109_2182697_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXM36105.1|2182852_2184094_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
AXM36106.1|2184302_2185721_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXM36107.1|2185755_2186055_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
AXM36108.1|2186051_2187923_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
AXM36109.1|2188212_2189232_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AXM38172.1|2189225_2189636_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AXM36110.1|2189653_2190256_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXM38173.1|2190248_2192186_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AXM36111.1|2192354_2192825_-	cytochrome c biogenesis protein CcmE	NA	NA	NA	NA	NA
AXM36112.1|2192821_2192992_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
AXM36113.1|2192988_2193741_-	heme ABC transporter permease	NA	NA	NA	NA	NA
AXM36114.1|2193835_2194531_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
AXM36115.1|2194527_2195172_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
AXM36116.1|2195398_2196547_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AXM36117.1|2196686_2197490_+	amidohydrolase	NA	NA	NA	NA	NA
AXM38174.1|2197510_2198476_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2300288	2353848	4898917	tRNA,transposase	Xanthomonas_phage(85.19%)	55	NA	NA
AXM36190.1|2300288_2301701_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
AXM36191.1|2302206_2303005_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM36192.1|2303318_2303645_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM36193.1|2303654_2304569_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AXM36194.1|2304565_2305861_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
AXM36195.1|2305857_2306949_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AXM36196.1|2306945_2308073_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase	NA	NA	NA	NA	NA
AXM36197.1|2308069_2308672_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AXM36198.1|2308668_2309403_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AXM36199.1|2309396_2310173_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
AXM36200.1|2310162_2310783_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
AXM36201.1|2311368_2315223_-	avirulence protein	NA	NA	NA	NA	NA
AXM36202.1|2315447_2315747_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXM36203.1|2315750_2315945_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXM36204.1|2316212_2319512_-	avirulence protein	NA	NA	NA	NA	NA
AXM36205.1|2320053_2320833_-	pectate lyase	NA	NA	NA	NA	NA
AXM36206.1|2320871_2320973_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36207.1|2321111_2322080_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM38184.1|2322886_2323072_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
AXM36208.1|2323071_2323275_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
AXM36209.1|2323410_2324484_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
AXM36210.1|2324588_2324888_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
AXM36211.1|2325251_2325491_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38185.1|2325597_2327082_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
AXM36212.1|2327083_2327404_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
AXM36213.1|2327400_2328585_+	zonular occludens toxin family protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
AXM36214.1|2328639_2328810_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
AXM36215.1|2328873_2329275_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	64.3	3.9e-38
AXM36216.1|2329214_2329529_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.7	8.1e-15
AXM36217.1|2329918_2330179_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36218.1|2330378_2330762_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	99.2	4.8e-70
AXM36219.1|2330933_2331581_-	conjugal transfer protein	NA	A0A1D6ZIU7	Xanthomonas_phage	100.0	3.0e-120
AXM36220.1|2331582_2332770_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	100.0	2.8e-217
AXM36221.1|2332769_2333099_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
AXM36222.1|2333098_2334505_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	100.0	6.4e-245
AXM36223.1|2334641_2334872_-	methyltransferase	NA	A0A1D6ZIT7	Xanthomonas_phage	100.0	1.7e-30
AXM36224.1|2334883_2335087_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
AXM36225.1|2335090_2335387_-	DNA-binding protein	NA	A0A1D6ZIU6	Xanthomonas_phage	100.0	3.6e-49
AXM38186.1|2335383_2336424_-	replication initiation protein	NA	A0A1D6ZIT9	Xanthomonas_phage	100.0	8.2e-205
AXM36226.1|2336576_2336789_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
AXM36227.1|2336788_2336974_-	hypothetical protein	NA	A0A1D6ZIV1	Xanthomonas_phage	100.0	1.4e-27
AXM36228.1|2337101_2337731_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
AXM36229.1|2337855_2338038_-	antitoxin	NA	NA	NA	NA	NA
AXM36230.1|2338159_2338372_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36231.1|2338540_2339303_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM36232.1|2339705_2340131_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36233.1|2340561_2341524_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM36234.1|2341610_2341850_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36235.1|2341824_2342337_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36236.1|2342469_2343232_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM36237.1|2344453_2348251_+	avirulence protein	NA	NA	NA	NA	NA
AXM36238.1|2348519_2348714_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXM36239.1|2348717_2349017_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXM36240.1|2349240_2352996_+	avirulence protein	NA	NA	NA	NA	NA
AXM36241.1|2353085_2353848_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2358996	2417217	4898917	transposase	Staphylococcus_prophage(18.18%)	46	NA	NA
AXM36244.1|2358996_2359218_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXM36245.1|2359214_2359886_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXM36246.1|2361140_2362097_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM36247.1|2362511_2363480_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM36248.1|2363624_2364590_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM36249.1|2364567_2368668_-	RHS repeat protein	NA	NA	NA	NA	NA
AXM38187.1|2368976_2370161_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM36250.1|2370211_2371111_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
AXM36251.1|2371277_2371784_+	glyoxalase	NA	NA	NA	NA	NA
AXM36252.1|2372258_2372891_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AXM36253.1|2372890_2374747_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AXM36254.1|2374743_2376243_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36255.1|2376185_2376650_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AXM36256.1|2376646_2377426_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AXM36257.1|2377717_2378758_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AXM36258.1|2378754_2380524_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
AXM36259.1|2380520_2380985_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXM36260.1|2380988_2381651_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
AXM36261.1|2381679_2384088_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AXM36262.1|2384341_2385307_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM36263.1|2386517_2386700_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36264.1|2386700_2387435_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
AXM36265.1|2387427_2388669_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
AXM36266.1|2388692_2389145_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36267.1|2389095_2389344_-	succinate dehydrogenase assembly factor 2 family protein	NA	NA	NA	NA	NA
AXM36268.1|2389454_2390237_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AXM36269.1|2390253_2390463_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36270.1|2390466_2392257_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AXM36271.1|2392291_2392678_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
AXM36272.1|2392674_2393070_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AXM36273.1|2393129_2393396_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
AXM36274.1|2393339_2394212_+	folate-binding protein	NA	NA	NA	NA	NA
AXM36275.1|2394340_2395438_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
AXM36276.1|2395871_2397302_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
AXM36277.1|2397298_2398306_+	glucokinase	NA	NA	NA	NA	NA
AXM36278.1|2398302_2399022_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AXM36279.1|2399124_2401041_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AXM36280.1|2401096_2401756_+	keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase	NA	NA	NA	NA	NA
AXM36281.1|2403382_2403586_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36282.1|2404601_2404982_+	response regulator	NA	NA	NA	NA	NA
AXM36283.1|2405196_2408592_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
AXM36284.1|2410157_2410920_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM36285.1|2412815_2413049_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36286.1|2413215_2414190_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
AXM38188.1|2414953_2415835_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36287.1|2416134_2417217_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 17
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2524916	2573006	4898917	tRNA,transposase	Moumouvirus(16.67%)	44	NA	NA
AXM36351.1|2524916_2526311_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
AXM36352.1|2526312_2526570_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36353.1|2526566_2526872_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36354.1|2526868_2527195_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36355.1|2527921_2528584_+	carbonate dehydratase	NA	NA	NA	NA	NA
AXM38199.1|2528672_2529203_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
AXM36356.1|2531426_2532698_+	kynureninase	NA	NA	NA	NA	NA
AXM36357.1|2532869_2534237_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
AXM36358.1|2534540_2535986_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AXM36359.1|2535982_2536669_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
AXM36360.1|2536641_2537661_+	aldo/keto reductase	NA	NA	NA	NA	NA
AXM36361.1|2537702_2538263_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
AXM36362.1|2538283_2539240_-	5'-nucleotidase	NA	NA	NA	NA	NA
AXM36363.1|2539407_2540184_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXM36364.1|2540667_2542803_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AXM36365.1|2542799_2542991_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36366.1|2544765_2545272_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM36367.1|2545312_2545840_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM36368.1|2545836_2546328_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AXM36369.1|2546351_2546927_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AXM36370.1|2547003_2547957_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
AXM36371.1|2548045_2548918_-	sulfurtransferase	NA	NA	NA	NA	NA
AXM38200.1|2548914_2549682_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
AXM36372.1|2549866_2550565_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM36373.1|2550728_2551511_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AXM36374.1|2551519_2551900_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36375.1|2551896_2552607_+	endonuclease III	NA	NA	NA	NA	NA
AXM36376.1|2553917_2554466_-	carbonic anhydrase	NA	NA	NA	NA	NA
AXM36377.1|2554637_2555606_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXM36378.1|2556210_2557446_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM36379.1|2558009_2558330_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36380.1|2558669_2559920_+	porin	NA	NA	NA	NA	NA
AXM38201.1|2560054_2561128_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
AXM36381.1|2561315_2562407_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
AXM36382.1|2562519_2563494_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AXM36383.1|2563493_2564363_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AXM36384.1|2564385_2565216_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
AXM36385.1|2565344_2566055_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AXM36386.1|2566187_2566595_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36387.1|2566872_2567514_+	ribonuclease T	NA	NA	NA	NA	NA
AXM36388.1|2567584_2568904_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36389.1|2569140_2570202_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38202.1|2570252_2571437_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXM36390.1|2571686_2573006_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 18
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2579725	2652066	4898917	tRNA,protease,transposase	uncultured_Mediterranean_phage(33.33%)	54	NA	NA
AXM36395.1|2579725_2580871_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
AXM36396.1|2580940_2582011_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AXM36397.1|2582197_2582629_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXM36398.1|2582752_2584249_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AXM36399.1|2584208_2584523_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36400.1|2584593_2585301_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36401.1|2588690_2589812_-	phytase	NA	NA	NA	NA	NA
AXM38203.1|2592084_2592510_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM38204.1|2592702_2593335_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AXM36402.1|2593731_2594494_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM36403.1|2594774_2595806_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM36404.1|2595812_2597606_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AXM36405.1|2597602_2597887_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
AXM38205.1|2597877_2598060_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38206.1|2598118_2598604_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36406.1|2598662_2599169_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
AXM36407.1|2599165_2599786_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AXM36408.1|2600026_2601931_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
AXM36409.1|2602018_2603076_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXM36410.1|2603173_2604493_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36411.1|2604726_2605884_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
AXM38207.1|2606160_2607126_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM36412.1|2607103_2608579_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
AXM36413.1|2610395_2611364_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM36414.1|2612278_2613247_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM36415.1|2613514_2613754_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36416.1|2615628_2616849_-	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AXM36417.1|2617163_2618561_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AXM36418.1|2618571_2619792_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AXM36419.1|2619788_2620427_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36420.1|2620497_2621358_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXM36421.1|2621354_2622143_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
AXM36422.1|2622153_2623359_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
AXM36423.1|2623377_2623803_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
AXM36424.1|2624022_2624655_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM36425.1|2624679_2627052_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
AXM36426.1|2627209_2628415_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AXM36427.1|2628735_2630067_+	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
AXM36428.1|2630063_2630414_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36429.1|2630445_2630853_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
AXM36430.1|2630849_2631176_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38208.1|2631207_2632584_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
AXM36431.1|2632820_2636987_+	type III effector	NA	NA	NA	NA	NA
AXM38209.1|2637099_2637729_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
AXM36432.1|2637835_2639764_-	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
AXM36433.1|2639926_2642287_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
AXM36434.1|2642570_2643539_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
AXM36435.1|2643596_2644718_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXM38210.1|2646145_2646898_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXM38211.1|2646978_2647197_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXM36436.1|2647477_2649760_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
AXM36437.1|2649903_2650224_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
AXM36438.1|2650474_2650933_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXM36439.1|2650929_2652066_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 19
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2733804	2759442	4898917	transposase	Bacillus_phage(50.0%)	17	NA	NA
AXM36507.1|2733804_2735124_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36508.1|2735273_2736242_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM36509.1|2738007_2738199_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36510.1|2746470_2746863_+	cytochrome c	NA	NA	NA	NA	NA
AXM36511.1|2746871_2747333_+	cytochrome c	NA	NA	NA	NA	NA
AXM36512.1|2747837_2748098_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36513.1|2748173_2748416_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36514.1|2748658_2748844_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36515.1|2748886_2749093_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38215.1|2749855_2750821_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM36516.1|2750827_2752126_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36517.1|2752294_2753980_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
AXM38216.1|2753976_2755713_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
AXM36518.1|2756127_2756319_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36519.1|2756312_2757269_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
AXM36520.1|2758071_2758335_+	cytochrome D ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXM38217.1|2758476_2759442_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2776320	2836922	4898917	tRNA,protease,transposase	Moumouvirus(10.0%)	54	NA	NA
AXM36536.1|2776320_2777751_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
AXM36537.1|2778248_2778686_+	SufE family protein	NA	NA	NA	NA	NA
AXM36538.1|2778682_2779933_+	MFS transporter	NA	NA	NA	NA	NA
AXM36539.1|2780000_2781062_-	peptidase S41	NA	NA	NA	NA	NA
AXM36540.1|2781204_2782245_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AXM36541.1|2782335_2782617_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
AXM36542.1|2782613_2783963_+	dihydroorotase	NA	NA	NA	NA	NA
AXM36543.1|2783902_2784802_+	M23 family peptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
AXM36544.1|2785700_2786463_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM36545.1|2786489_2786753_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36546.1|2787124_2787613_-	general stress protein	NA	NA	NA	NA	NA
AXM36547.1|2787836_2789156_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36548.1|2789292_2790261_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM36549.1|2790460_2791777_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36550.1|2792136_2793318_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
AXM36551.1|2793385_2793625_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36552.1|2794906_2796577_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
AXM36553.1|2796793_2797483_-	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
AXM36554.1|2797511_2798216_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AXM36555.1|2798289_2799009_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AXM36556.1|2799039_2800389_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
AXM38218.1|2800396_2801233_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36557.1|2801391_2801958_-	elongation factor P	NA	NA	NA	NA	NA
AXM36558.1|2802059_2803088_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
AXM36559.1|2803306_2805424_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXM38219.1|2805420_2806341_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXM36560.1|2806401_2807166_-	RNA methyltransferase	NA	NA	NA	NA	NA
AXM36561.1|2807284_2808118_+	inositol monophosphatase	NA	NA	NA	NA	NA
AXM36562.1|2808370_2808982_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
AXM36563.1|2809236_2809677_+	ribonuclease	NA	NA	NA	NA	NA
AXM36564.1|2809673_2810099_+	barnase inhibitor	NA	NA	NA	NA	NA
AXM36565.1|2810547_2812443_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.4e-48
AXM36566.1|2812532_2813909_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	2.1e-54
AXM36567.1|2814011_2814572_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
AXM36568.1|2814669_2816226_-	YdiU family protein	NA	NA	NA	NA	NA
AXM36569.1|2816509_2817385_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXM36570.1|2817585_2818284_-	glutathione S-transferase	NA	NA	NA	NA	NA
AXM36571.1|2818454_2818664_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
AXM36572.1|2818933_2819419_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
AXM36573.1|2819489_2820038_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36574.1|2820034_2821216_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM36575.1|2821439_2823509_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM36576.1|2823608_2824487_-|protease	protease HtpX	protease	NA	NA	NA	NA
AXM36577.1|2824584_2825484_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXM36578.1|2825571_2826312_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AXM38220.1|2826471_2827047_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AXM36579.1|2827220_2828192_-	TraB/GumN family protein	NA	NA	NA	NA	NA
AXM36580.1|2828225_2829167_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
AXM36581.1|2829166_2831044_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
AXM36582.1|2831181_2832915_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
AXM36583.1|2832967_2833468_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AXM36584.1|2833464_2834952_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AXM36585.1|2834976_2836044_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AXM36586.1|2836158_2836922_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 21
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2840117	2913141	4898917	tRNA,protease,transposase	Bacillus_phage(18.18%)	56	NA	NA
AXM36589.1|2840117_2840865_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM36590.1|2841181_2843017_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
AXM36591.1|2843288_2844380_+	ribonuclease D	NA	NA	NA	NA	NA
AXM36592.1|2844455_2844845_-	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
AXM36593.1|2844708_2845059_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36594.1|2845472_2845874_+	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXM36595.1|2846380_2846515_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38221.1|2846737_2846917_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36596.1|2847518_2847809_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM36597.1|2847796_2848075_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AXM38222.1|2848559_2848748_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AXM38223.1|2849520_2850705_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXM38224.1|2851285_2852251_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM36598.1|2856743_2857160_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
AXM36599.1|2857370_2857697_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36600.1|2857729_2858170_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
AXM36601.1|2858248_2858884_-	stringent starvation protein A	NA	NA	NA	NA	NA
AXM38225.1|2859277_2860021_-	cytochrome c1	NA	NA	NA	NA	NA
AXM36602.1|2860028_2861288_-	cytochrome b	NA	NA	NA	NA	NA
AXM36603.1|2861287_2861932_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AXM36604.1|2862461_2863448_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
AXM36605.1|2865383_2866838_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AXM36606.1|2867261_2868248_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
AXM36607.1|2868659_2869322_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36608.1|2869376_2869862_+	endoribonuclease YbeY	NA	NA	NA	NA	NA
AXM36609.1|2869861_2870380_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36610.1|2870474_2871353_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AXM36611.1|2871349_2872630_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
AXM36612.1|2872645_2873647_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AXM38226.1|2873798_2875163_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXM38227.1|2875417_2875828_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36613.1|2875983_2876814_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AXM36614.1|2876829_2877192_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXM36615.1|2877127_2878375_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
AXM36616.1|2878520_2880032_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36617.1|2880018_2881605_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AXM36618.1|2881601_2882804_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AXM36619.1|2883310_2884699_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36620.1|2884932_2886318_-	glutamine synthetase	NA	NA	NA	NA	NA
AXM36621.1|2887225_2888605_+	glutamine synthetase	NA	NA	NA	NA	NA
AXM36622.1|2888604_2889921_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXM36623.1|2890057_2891302_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.5e-19
AXM36624.1|2891609_2892890_-	MFS transporter	NA	NA	NA	NA	NA
AXM36625.1|2893195_2893504_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36626.1|2893463_2895812_-	CbbBc protein	NA	NA	NA	NA	NA
AXM36627.1|2895808_2896654_-	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AXM36628.1|2896660_2898385_-	MFS transporter	NA	NA	NA	NA	NA
AXM36629.1|2898527_2898710_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36630.1|2898742_2899505_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM36631.1|2899730_2901083_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AXM38228.1|2901143_2904281_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36632.1|2904447_2905302_+	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
AXM36633.1|2905472_2906777_+	DUF445 family protein	NA	NA	NA	NA	NA
AXM36634.1|2906918_2911013_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.9e-55
AXM36635.1|2911046_2912033_+	two-component system response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
AXM36636.1|2912157_2913141_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.4e-97
>prophage 22
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2925028	3004942	4898917	transposase	uncultured_Caudovirales_phage(57.14%)	54	NA	NA
AXM38229.1|2925028_2925994_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM36642.1|2926700_2927696_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM36643.1|2927856_2930373_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
AXM36644.1|2930369_2931326_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
AXM36645.1|2931484_2933227_+	PTS fructose transporter subunit EIIBC	NA	NA	NA	NA	NA
AXM38230.1|2933545_2934682_+	carbohydrate porin	NA	NA	NA	NA	NA
AXM36646.1|2935348_2936317_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM36647.1|2936529_2937849_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36648.1|2938088_2940434_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36649.1|2940451_2941180_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36650.1|2941208_2943551_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38231.1|2943575_2944319_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36651.1|2944349_2947184_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36652.1|2947180_2948110_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM36653.1|2948118_2950881_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
AXM36654.1|2952446_2954936_-	avirulence protein	NA	NA	NA	NA	NA
AXM36655.1|2954975_2955365_-	type VI secretion protein	NA	NA	NA	NA	NA
AXM36656.1|2955519_2956479_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36657.1|2956411_2956726_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
AXM36658.1|2956953_2958273_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36659.1|2959377_2959794_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
AXM36660.1|2959790_2960099_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38232.1|2960040_2960418_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36661.1|2960479_2961115_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36662.1|2961614_2962583_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM38233.1|2964048_2967090_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM36663.1|2967456_2967645_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
AXM36664.1|2968139_2968592_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36665.1|2968846_2970652_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM36666.1|2970800_2971001_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36667.1|2971076_2971784_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
AXM36668.1|2971935_2972328_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM38234.1|2972350_2972866_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM36669.1|2972862_2973216_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36670.1|2973304_2974045_+	flagellar motor protein	NA	NA	NA	NA	NA
AXM36671.1|2974051_2975026_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
AXM36672.1|2975027_2975810_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
AXM36673.1|2975806_2976829_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM36674.1|2976929_2977238_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AXM36675.1|2977234_2977600_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
AXM36676.1|2977633_2979643_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AXM38235.1|2981743_2982433_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	8.3e-12
AXM36677.1|2982748_2983510_+	transporter	NA	NA	NA	NA	NA
AXM36678.1|2983523_2985866_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
AXM36679.1|2986362_2987328_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM36680.1|2987567_2989814_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
AXM38236.1|2990542_2992654_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
AXM36681.1|2993338_2995414_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
AXM36682.1|2996006_2998268_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
AXM36683.1|2998661_3000923_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
AXM36684.1|3001601_3001811_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36685.1|3001880_3002678_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AXM36686.1|3002813_3003296_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXM36687.1|3004144_3004942_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 23
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3085988	3097763	4898917	tRNA	Escherichia_phage(22.22%)	14	NA	NA
AXM36749.1|3085988_3086288_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
AXM36750.1|3086330_3086561_-	hypothetical protein	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
AXM36751.1|3086804_3087554_-	isopentenyl transferase	NA	NA	NA	NA	NA
AXM36752.1|3087558_3088254_-	DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
AXM36753.1|3088189_3088417_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38243.1|3088439_3088739_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38244.1|3089126_3089531_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
AXM36754.1|3090256_3090469_-	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AXM36755.1|3090608_3093257_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
AXM36756.1|3093358_3093847_-	recombination regulator RecX	NA	NA	NA	NA	NA
AXM36757.1|3093897_3094101_+	hypothetical protein	NA	NA	NA	NA	NA
AXM36758.1|3094149_3095184_-	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
AXM36759.1|3095356_3095998_-	LexA repressor 2	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AXM38245.1|3096086_3097763_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 24
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3158180	3288746	4898917	plate,protease,transposase	Ralstonia_phage(40.0%)	91	NA	NA
AXM36808.1|3158180_3159506_+|protease	serine protease	protease	A0A217EQY2	Bacillus_phage	39.2	2.4e-23
AXM36809.1|3159516_3160275_+	heme ABC transporter permease	NA	NA	NA	NA	NA
AXM36810.1|3160271_3160478_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
AXM36811.1|3160474_3160945_+	cytochrome c-type biogenesis protein CcmE 1	NA	NA	NA	NA	NA
AXM36812.1|3161008_3162997_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AXM36813.1|3162993_3163536_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXM38258.1|3163535_3164033_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AXM36814.1|3164032_3164737_+	C-type cytochrome biogenesis protein	NA	NA	NA	NA	NA
AXM36815.1|3164945_3168665_+	avirulence protein	NA	NA	NA	NA	NA
AXM36816.1|3168933_3169128_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXM36817.1|3169131_3169431_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXM36818.1|3169654_3174106_+	avirulence protein	NA	NA	NA	NA	NA
AXM36819.1|3174374_3174569_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
AXM36820.1|3174572_3174872_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXM36821.1|3175095_3179745_+	avirulence protein	NA	NA	NA	NA	NA
AXM36822.1|3180807_3182283_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
AXM36823.1|3182365_3184954_-	hydrophobe/amphiphile efflux-1 family RND transporter	NA	NA	NA	NA	NA
AXM36824.1|3185010_3186123_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM36825.1|3186247_3186826_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM36826.1|3188312_3190400_+	type III effector	NA	NA	NA	NA	NA
AXM36827.1|3190785_3191883_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM36828.1|3192299_3195380_+	histidine kinase	NA	NA	NA	NA	NA
AXM38259.1|3198415_3199123_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM36829.1|3199119_3200112_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AXM36830.1|3200108_3202568_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
AXM36831.1|3202681_3203662_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM36832.1|3203670_3204699_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AXM36833.1|3204871_3205198_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36834.1|3205194_3208098_-	serine/threonine protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
AXM36835.1|3208094_3208817_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AXM36836.1|3208813_3209461_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AXM36837.1|3209457_3212916_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AXM36838.1|3212919_3214236_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AXM36839.1|3214237_3215575_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXM36840.1|3215571_3216963_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AXM36841.1|3216959_3217499_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36842.1|3217507_3219445_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
AXM36843.1|3219709_3220168_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36844.1|3220555_3220882_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36845.1|3221115_3221613_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36846.1|3221801_3224507_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
AXM36847.1|3224539_3225550_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXM36848.1|3225513_3227391_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXM36849.1|3227394_3227898_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXM36850.1|3227885_3228719_-	ImpE protein	NA	NA	NA	NA	NA
AXM36851.1|3228754_3229258_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AXM36852.1|3229357_3230872_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXM38260.1|3230864_3231371_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXM36853.1|3232729_3233698_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM36854.1|3233833_3235150_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM36855.1|3235320_3236556_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM36856.1|3236741_3237710_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM36857.1|3237761_3239678_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36858.1|3239702_3240440_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36859.1|3240470_3242813_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38261.1|3242830_3243577_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36860.1|3243605_3246440_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36861.1|3247097_3248927_-	transmembrane repetitive protein	NA	NA	NA	NA	NA
AXM36862.1|3248940_3249540_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
AXM36863.1|3249627_3249984_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AXM36864.1|3249980_3250403_+	energy transducer TonB	NA	NA	NA	NA	NA
AXM36865.1|3250418_3250652_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXM36866.1|3250678_3250939_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXM36867.1|3251287_3253072_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AXM36868.1|3253104_3254091_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AXM36869.1|3254501_3258215_+	ribonuclease E/G	NA	NA	NA	NA	NA
AXM36870.1|3258740_3259504_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM36871.1|3259607_3260255_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM36872.1|3260476_3261238_-	sulfurtransferase	NA	NA	NA	NA	NA
AXM36873.1|3261395_3262364_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM36874.1|3262497_3262863_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36875.1|3262921_3263353_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXM36876.1|3263364_3264627_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
AXM36877.1|3264610_3265903_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
AXM36878.1|3266272_3267043_+	phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AXM36879.1|3267799_3269035_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXM38262.1|3270334_3270592_-	stress-induced protein	NA	NA	NA	NA	NA
AXM36880.1|3271031_3272015_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	1.5e-99
AXM36881.1|3272330_3273299_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM36882.1|3273427_3274390_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM36883.1|3274829_3275009_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36884.1|3275373_3276339_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM36885.1|3277546_3278524_+	siroheme synthase	NA	NA	NA	NA	NA
AXM36886.1|3279332_3279527_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AXM36887.1|3280920_3281283_-	hypothetical protein	NA	NA	NA	NA	NA
AXM36888.1|3281266_3281836_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
AXM36889.1|3281873_3283127_-	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AXM36890.1|3283332_3283710_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38263.1|3285383_3285590_-|transposase	transposase	transposase	NA	NA	NA	NA
AXM36891.1|3285638_3286874_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM38264.1|3287711_3288746_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 25
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3429876	3490189	4898917	tRNA,protease,transposase	Burkholderia_virus(14.29%)	51	NA	NA
AXM36986.1|3429876_3430640_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM36987.1|3431663_3434030_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXM38274.1|3434026_3434701_-	methylamine utilization protein	NA	NA	NA	NA	NA
AXM36988.1|3434910_3435849_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
AXM36989.1|3435971_3437321_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXM36990.1|3437317_3438205_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AXM36991.1|3438522_3439329_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXM36992.1|3439774_3440992_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXM36993.1|3441097_3442066_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
AXM36994.1|3442408_3443077_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AXM36995.1|3443073_3443847_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AXM38275.1|3444420_3446487_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AXM36996.1|3447053_3448079_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXM36997.1|3448163_3449237_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
AXM36998.1|3449229_3450333_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
AXM36999.1|3450343_3451270_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXM37000.1|3451350_3452001_+	SCO family protein	NA	NA	NA	NA	NA
AXM37001.1|3451997_3452846_+	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
AXM37002.1|3453396_3454980_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
AXM38276.1|3454899_3455085_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37003.1|3456402_3457620_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM37004.1|3457580_3457802_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38277.1|3457978_3458485_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
AXM37005.1|3458606_3460007_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AXM37006.1|3460269_3460845_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
AXM37007.1|3460841_3461276_+	HIT family protein	NA	NA	NA	NA	NA
AXM37008.1|3461303_3461471_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37009.1|3462122_3462308_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37010.1|3462342_3462912_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
AXM37011.1|3463004_3463856_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AXM37012.1|3465243_3467259_+	M13 family peptidase	NA	NA	NA	NA	NA
AXM37013.1|3467529_3468228_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM37014.1|3468268_3468676_-	cysteine methyltransferase	NA	NA	NA	NA	NA
AXM37015.1|3469113_3470076_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM37016.1|3471359_3472610_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXM37017.1|3472617_3473862_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
AXM37018.1|3474089_3474569_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM38278.1|3474679_3475216_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
AXM37019.1|3475325_3476075_+	NlpC/P60 family protein	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
AXM37020.1|3476282_3476774_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXM37021.1|3477887_3479207_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AXM37022.1|3479350_3481057_+	alkaline phosphatase	NA	NA	NA	NA	NA
AXM37023.1|3481090_3482395_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AXM37024.1|3482426_3482687_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AXM37025.1|3482688_3483564_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
AXM38279.1|3485398_3485863_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
AXM37026.1|3485914_3486103_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37027.1|3486075_3486396_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38280.1|3486392_3487760_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AXM37028.1|3487905_3488487_+	ribosome-associated protein	NA	NA	NA	NA	NA
AXM37029.1|3488743_3490189_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 26
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3509289	3557991	4898917	tRNA,integrase,transposase	Ralstonia_phage(33.33%)	41	3532108:3532167	3548778:3549441
AXM37042.1|3509289_3511932_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
AXM37043.1|3512004_3512616_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
AXM37044.1|3512820_3513678_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
AXM37045.1|3513933_3514383_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AXM38281.1|3514682_3515648_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM37046.1|3515772_3516535_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37047.1|3516592_3516781_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37048.1|3517145_3517439_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37049.1|3517912_3518146_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AXM37050.1|3518179_3519193_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXM37051.1|3519160_3519352_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37052.1|3519442_3520762_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM37053.1|3520849_3522064_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
AXM37054.1|3522209_3522737_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37055.1|3522733_3523699_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM37056.1|3523939_3524702_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37057.1|3525004_3527137_+	glycogen debranching enzyme GlgX	NA	NA	NA	NA	NA
AXM37058.1|3527687_3528656_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM37059.1|3528847_3529816_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM38282.1|3529960_3530926_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM37060.1|3530891_3531305_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AXM37061.1|3531301_3532065_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3532108:3532167	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
AXM37062.1|3532936_3533734_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37063.1|3533767_3534160_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXM37064.1|3534250_3534643_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38283.1|3536981_3537401_+|integrase	integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
AXM37065.1|3538628_3538853_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37066.1|3539117_3540902_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
AXM37067.1|3541092_3541293_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AXM37068.1|3541828_3542623_+	thiazole synthase	NA	NA	NA	NA	NA
AXM37069.1|3542615_3542909_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37070.1|3542924_3543683_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AXM37071.1|3543758_3545621_+	SLC13 family permease	NA	NA	NA	NA	NA
AXM38284.1|3545678_3546020_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AXM37072.1|3546279_3546555_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37073.1|3549601_3550315_+	FAA hydrolase family protein	NA	NA	NA	NA	NA
3548778:3549441	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
AXM37074.1|3550375_3550798_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AXM37075.1|3550929_3551693_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37076.1|3554766_3555678_-	RNA methyltransferase	NA	NA	NA	NA	NA
AXM38285.1|3556193_3556331_-	acetyltransferase	NA	NA	NA	NA	NA
AXM38286.1|3557025_3557991_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 27
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3605441	3650017	4898917	protease,transposase	Ralstonia_phage(50.0%)	35	NA	NA
AXM37105.1|3605441_3606410_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM38289.1|3607430_3608465_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM37106.1|3608848_3609574_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXM37107.1|3609705_3610167_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38290.1|3613613_3615734_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM37108.1|3616000_3616846_-	transporter	NA	NA	NA	NA	NA
AXM37109.1|3617102_3617465_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37110.1|3617837_3618806_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM37111.1|3619130_3621101_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AXM37112.1|3621529_3622927_+|protease	serine protease	protease	NA	NA	NA	NA
AXM38291.1|3623039_3623858_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
AXM38292.1|3624168_3627366_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.0e-81
AXM38293.1|3627406_3627589_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37113.1|3627601_3629020_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
AXM38294.1|3629029_3629632_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
AXM37114.1|3629681_3630287_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
AXM37115.1|3630436_3630658_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXM37116.1|3630667_3631093_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
AXM37117.1|3631584_3632382_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37118.1|3633459_3634239_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AXM37119.1|3634453_3635083_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXM37120.1|3635143_3635899_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38295.1|3636227_3637004_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37121.1|3637000_3637243_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37122.1|3637412_3638987_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXM38296.1|3639235_3639502_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37123.1|3639780_3642960_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	1.2e-73
AXM37124.1|3643025_3643994_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXM37125.1|3644193_3645513_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM37126.1|3645596_3646271_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37127.1|3646270_3647017_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37128.1|3647013_3647208_-	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
AXM37129.1|3647672_3648641_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXM37130.1|3648755_3649046_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AXM37131.1|3649048_3650017_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 28
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3666281	3724984	4898917	plate,transposase	Staphylococcus_prophage(20.0%)	35	NA	NA
AXM37143.1|3666281_3667238_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
AXM37144.1|3667212_3669651_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37145.1|3669562_3670594_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37146.1|3670602_3672540_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37147.1|3672451_3673471_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37148.1|3673475_3675419_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37149.1|3675330_3676353_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37150.1|3678317_3679343_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37151.1|3679346_3682214_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37152.1|3682232_3683138_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM37153.1|3683079_3685842_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	9.6e-43
AXM37154.1|3685934_3686288_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37155.1|3686318_3689048_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
AXM37156.1|3689133_3690225_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXM37157.1|3690188_3692024_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXM37158.1|3692026_3692515_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXM37159.1|3692662_3693160_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AXM37160.1|3693301_3694798_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXM37161.1|3694801_3695302_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXM38299.1|3695348_3695837_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37162.1|3696223_3696832_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXM37163.1|3696983_3698318_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXM38300.1|3698317_3699106_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AXM37164.1|3699116_3701834_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXM37165.1|3701830_3702808_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37166.1|3703366_3705535_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXM37167.1|3705559_3708454_+	calcium-binding protein	NA	A0A2D1GNI0	Pseudomonas_phage	27.5	7.5e-06
AXM37168.1|3708692_3709655_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM37169.1|3710368_3711802_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AXM37170.1|3711805_3714061_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37171.1|3716420_3716810_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
AXM37172.1|3716790_3719022_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXM37173.1|3719021_3719618_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXM37174.1|3719610_3720435_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXM37175.1|3724015_3724984_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 29
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3774373	3785204	4898917	transposase	Burkholderia_virus(28.57%)	9	NA	NA
AXM38306.1|3774373_3775177_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
AXM37212.1|3775607_3775790_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38307.1|3776261_3779216_+	glycine dehydrogenase (aminomethyl-transferring)	NA	M4QFZ1	Prochlorococcus_phage	49.9	5.3e-257
AXM37213.1|3779275_3779458_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37214.1|3779545_3779995_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
AXM37215.1|3779991_3780687_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.2e-36
AXM37216.1|3780694_3781765_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	5.7e-60
AXM37217.1|3781761_3782847_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
AXM38308.1|3784247_3785204_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
>prophage 30
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	4092761	4187875	4898917	tRNA,transposase	Ralstonia_phage(17.65%)	67	NA	NA
AXM38334.1|4092761_4094369_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM37475.1|4094566_4094794_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AXM37476.1|4094798_4095458_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
AXM37477.1|4095644_4097009_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AXM37478.1|4097224_4097920_+	VIT family protein	NA	NA	NA	NA	NA
AXM37479.1|4098866_4099490_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AXM38335.1|4099691_4100432_+	cytochrome c4	NA	NA	NA	NA	NA
AXM37480.1|4100525_4101176_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
AXM37481.1|4101267_4102083_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
AXM37482.1|4102132_4102870_+	EEP domain-containing protein	NA	NA	NA	NA	NA
AXM37483.1|4104798_4105794_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.0	5.4e-97
AXM37484.1|4105916_4108490_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
AXM37485.1|4108682_4109445_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37486.1|4109518_4110487_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM37487.1|4111220_4111487_+|transposase	transposase	transposase	NA	NA	NA	NA
AXM37488.1|4112418_4113217_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38336.1|4114863_4116096_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	41.7	2.0e-72
AXM37489.1|4116135_4117098_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM37490.1|4117273_4118230_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXM37491.1|4118441_4119410_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM37492.1|4119745_4120508_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37493.1|4123918_4124884_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
AXM37494.1|4125345_4125576_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37495.1|4126200_4128243_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
AXM37496.1|4128244_4130143_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AXM37497.1|4130144_4131398_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AXM37498.1|4131394_4132000_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AXM37499.1|4132419_4133574_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AXM37500.1|4133576_4134605_-	SIS domain-containing protein	NA	NA	NA	NA	NA
AXM37501.1|4134601_4135678_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM37502.1|4135718_4136996_-	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
AXM37503.1|4137040_4137808_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXM37504.1|4138022_4139189_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
AXM37505.1|4139322_4141719_-	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AXM37506.1|4141715_4144613_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
AXM37507.1|4144763_4147454_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM37508.1|4147735_4148692_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
AXM37509.1|4148725_4148938_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37510.1|4149182_4150418_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM37511.1|4151853_4153038_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM37512.1|4153105_4153843_+	pteridine reductase	NA	NA	NA	NA	NA
AXM37513.1|4154011_4154527_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXM37514.1|4154618_4156121_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
AXM37515.1|4156124_4156565_-	response regulator	NA	NA	NA	NA	NA
AXM37516.1|4156561_4158373_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
AXM38337.1|4158658_4159021_-	BON domain-containing protein	NA	NA	NA	NA	NA
AXM37517.1|4159180_4160233_+	oxidoreductase	NA	NA	NA	NA	NA
AXM37518.1|4160572_4161514_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
AXM37519.1|4161534_4162872_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37520.1|4163043_4163424_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AXM37521.1|4163548_4164310_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
AXM37522.1|4166558_4167962_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	52.1	1.2e-131
AXM37523.1|4168084_4169140_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.7e-80
AXM37524.1|4169301_4170168_+	endonuclease	NA	NA	NA	NA	NA
AXM37525.1|4170459_4172643_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	31.4	1.8e-81
AXM38338.1|4173141_4174137_-	restriction endonuclease	NA	NA	NA	NA	NA
AXM37526.1|4174232_4176044_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM37527.1|4176288_4177302_-	lipoyl synthase	NA	NA	NA	NA	NA
AXM37528.1|4177316_4178015_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
AXM37529.1|4178002_4178281_-	DUF493 family protein	NA	NA	NA	NA	NA
AXM37530.1|4179346_4180552_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
AXM37531.1|4180660_4180942_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37532.1|4181052_4182468_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
AXM37533.1|4182464_4183604_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AXM37534.1|4185343_4186618_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
AXM37535.1|4186617_4186836_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37536.1|4186912_4187875_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
>prophage 31
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	4254012	4383441	4898917	tRNA,transposase	Leptospira_phage(20.0%)	103	NA	NA
AXM37579.1|4254012_4254776_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38344.1|4255823_4256609_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AXM37580.1|4256631_4256838_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37581.1|4256862_4258536_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
AXM37582.1|4259079_4259526_-	autotransporter	NA	NA	NA	NA	NA
AXM37583.1|4259856_4260141_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37584.1|4260735_4261647_-	magnesium transporter	NA	NA	NA	NA	NA
AXM37585.1|4261892_4262888_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AXM38345.1|4262981_4264358_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AXM37586.1|4265524_4267225_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AXM37587.1|4267633_4269406_+	cellulase	NA	NA	NA	NA	NA
AXM38346.1|4269681_4270566_-	DMT family transporter	NA	NA	NA	NA	NA
AXM38347.1|4270754_4271633_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXM37588.1|4273672_4274764_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
AXM37589.1|4276666_4278991_+	S9 family peptidase	NA	NA	NA	NA	NA
AXM37590.1|4279186_4281133_-	S9 family peptidase	NA	NA	NA	NA	NA
AXM37591.1|4281507_4281699_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37592.1|4282089_4283673_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
AXM38348.1|4284020_4284617_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37593.1|4285965_4286814_-	threonine aldolase	NA	NA	NA	NA	NA
AXM37594.1|4286848_4288324_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
AXM37595.1|4288914_4289844_-	lipid kinase YegS	NA	NA	NA	NA	NA
AXM37596.1|4290078_4290570_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM38349.1|4290566_4291238_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AXM37597.1|4291632_4291962_-	J domain-containing protein	NA	NA	NA	NA	NA
AXM37598.1|4292164_4293097_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
AXM37599.1|4293885_4294684_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38350.1|4294831_4295866_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM37600.1|4298733_4299219_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
AXM37601.1|4299757_4302586_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AXM37602.1|4302585_4302960_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AXM37603.1|4302956_4304507_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AXM37604.1|4304503_4305010_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AXM37605.1|4305006_4305291_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AXM37606.1|4305287_4305641_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
AXM37607.1|4306088_4306427_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37608.1|4306850_4308176_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
AXM37609.1|4308540_4309611_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AXM37610.1|4309781_4310270_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM37611.1|4310626_4311217_-	thioredoxin family protein	NA	NA	NA	NA	NA
AXM37612.1|4311228_4312737_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.6	2.9e-62
AXM37613.1|4313179_4314073_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
AXM37614.1|4315447_4316113_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
AXM38351.1|4316745_4317711_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM37615.1|4318243_4318624_+	peptide-binding protein	NA	NA	NA	NA	NA
AXM37616.1|4318826_4319732_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37617.1|4319800_4321096_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
AXM38352.1|4321186_4321750_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37618.1|4322175_4323441_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
AXM37619.1|4323437_4324415_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37620.1|4324518_4325322_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AXM37621.1|4325497_4326307_+	glycosyl transferase	NA	NA	NA	NA	NA
AXM37622.1|4326314_4327113_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38353.1|4327155_4327803_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37623.1|4327897_4328473_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37624.1|4328684_4330004_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM37625.1|4330153_4331122_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXM37626.1|4331247_4332000_-	HAD family hydrolase	NA	NA	NA	NA	NA
AXM37627.1|4332037_4332478_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
AXM38354.1|4332684_4333026_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
AXM37628.1|4333251_4333629_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38355.1|4333839_4334037_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AXM37629.1|4334343_4335090_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
AXM37630.1|4335182_4335989_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AXM38356.1|4336212_4337625_+	NlpC-P60 family protein	NA	NA	NA	NA	NA
AXM37631.1|4337621_4338719_+	dipeptide epimerase	NA	NA	NA	NA	NA
AXM37632.1|4338873_4339672_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37633.1|4339725_4340524_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37634.1|4340743_4341706_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
AXM37635.1|4342153_4342917_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37636.1|4343198_4343975_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37637.1|4343971_4345288_+	amino acid permease	NA	NA	NA	NA	NA
AXM37638.1|4345804_4347040_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM37639.1|4347633_4347915_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37640.1|4348475_4348910_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37641.1|4349084_4350263_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
AXM37642.1|4350298_4350625_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37643.1|4351258_4352221_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM37644.1|4354554_4356726_-	beta-glucosidase	NA	NA	NA	NA	NA
AXM37645.1|4356953_4357310_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXM37646.1|4357388_4358453_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
AXM37647.1|4358732_4358948_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXM37648.1|4359255_4359702_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
AXM37649.1|4361179_4362142_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
AXM37650.1|4362231_4363980_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
AXM37651.1|4365307_4365553_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37652.1|4365552_4365786_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37653.1|4366043_4367090_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AXM37654.1|4367273_4368854_+	thioredoxin family protein	NA	NA	NA	NA	NA
AXM37655.1|4369242_4370139_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AXM37656.1|4370141_4371305_-	heme A synthase	NA	NA	NA	NA	NA
AXM37657.1|4371315_4371891_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37658.1|4371918_4372638_-	SURF1 family protein	NA	NA	NA	NA	NA
AXM37659.1|4372698_4372917_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
AXM37660.1|4373030_4373906_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
AXM37661.1|4373944_4374541_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
AXM37662.1|4374537_4374711_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37663.1|4374691_4376296_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
AXM37664.1|4376334_4377288_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AXM38357.1|4377304_4377781_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
AXM37665.1|4378057_4381258_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
AXM37666.1|4381417_4382396_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
AXM38358.1|4382475_4383441_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 32
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	4395680	4476143	4898917	tRNA,integrase,transposase	Leptospira_phage(21.43%)	57	4452684:4452703	4466743:4466762
AXM38361.1|4395680_4396782_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
AXM37680.1|4397386_4399618_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
AXM38362.1|4399807_4401520_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37681.1|4401668_4403045_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
AXM37682.1|4405252_4406051_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37683.1|4407035_4408004_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXM37684.1|4408170_4409142_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
AXM37685.1|4409334_4410519_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXM37686.1|4410986_4411802_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
AXM37687.1|4412560_4413877_-	amidohydrolase	NA	NA	NA	NA	NA
AXM37688.1|4414136_4415381_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXM37689.1|4415473_4418722_+	acriflavine resistance protein B	NA	NA	NA	NA	NA
AXM37690.1|4418855_4421996_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXM37691.1|4422285_4423653_-	VOC family protein	NA	NA	NA	NA	NA
AXM37692.1|4423662_4423872_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37693.1|4424397_4425363_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM37694.1|4425781_4426747_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM38363.1|4427209_4427680_+	thioesterase	NA	NA	NA	NA	NA
AXM37695.1|4427708_4428131_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37696.1|4428206_4428641_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AXM37697.1|4428750_4429266_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
AXM37698.1|4429281_4430307_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AXM37699.1|4430629_4431226_-	Ax21 family protein	NA	NA	NA	NA	NA
AXM37700.1|4431583_4433311_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AXM37701.1|4433360_4434803_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXM37702.1|4434787_4436134_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXM37703.1|4436324_4437074_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37704.1|4437175_4437787_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37705.1|4437891_4439115_+	MFS transporter	NA	NA	NA	NA	NA
AXM37706.1|4439456_4439933_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AXM37707.1|4439959_4440421_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37708.1|4440806_4441127_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AXM37709.1|4441228_4442245_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
AXM37710.1|4442316_4443480_+	Fic family protein	NA	NA	NA	NA	NA
AXM37711.1|4443476_4445108_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
AXM37712.1|4445109_4447611_+	helicase SNF2	NA	NA	NA	NA	NA
AXM37713.1|4447607_4448510_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AXM37714.1|4448731_4449115_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXM37715.1|4449433_4451104_+	peptide synthase	NA	NA	NA	NA	NA
AXM37716.1|4451332_4452343_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
AXM37717.1|4452407_4452566_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
AXM37718.1|4452583_4452802_-	hypothetical protein	NA	NA	NA	NA	NA
4452684:4452703	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
AXM37719.1|4452800_4454177_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
AXM37720.1|4454187_4454721_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM37721.1|4455149_4456409_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
AXM37722.1|4456547_4457855_-	MFS transporter	NA	NA	NA	NA	NA
AXM38364.1|4459939_4460974_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXM37723.1|4461324_4461870_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AXM38365.1|4461895_4462162_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXM37724.1|4462336_4464175_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AXM37725.1|4464405_4465281_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
AXM38366.1|4467103_4467367_-	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
4466743:4466762	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
AXM37726.1|4467398_4468541_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
AXM37727.1|4469667_4470567_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AXM37728.1|4471514_4474316_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
AXM37729.1|4474392_4474683_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
AXM37730.1|4475040_4476143_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	6.7e-40
>prophage 33
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	4629714	4696075	4898917	tRNA,transposase	Mycobacterium_phage(20.0%)	46	NA	NA
AXM37825.1|4629714_4631952_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXM37826.1|4632240_4633149_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AXM37827.1|4633238_4635053_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
AXM38384.1|4635438_4643895_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37828.1|4644362_4645160_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37829.1|4645074_4645305_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38385.1|4645332_4645569_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37830.1|4645704_4646457_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AXM37831.1|4646516_4647416_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37832.1|4647567_4648323_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
AXM37833.1|4648319_4648955_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AXM37834.1|4648970_4649198_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AXM37835.1|4649270_4650173_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37836.1|4650327_4651293_+	ferrochelatase	NA	NA	NA	NA	NA
AXM37837.1|4651390_4652146_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
AXM37838.1|4652226_4652685_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37839.1|4652955_4653741_-	M48 family peptidase	NA	NA	NA	NA	NA
AXM37840.1|4653766_4653994_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37841.1|4654367_4655273_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	4.1e-43
AXM37842.1|4655336_4656254_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
AXM37843.1|4656344_4656854_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37844.1|4656857_4658195_+	xylose isomerase	NA	NA	NA	NA	NA
AXM37845.1|4658420_4659488_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXM37846.1|4659663_4661859_+	alpha-glucuronidase	NA	NA	NA	NA	NA
AXM37847.1|4661855_4663820_+	9-O-acetylesterase	NA	NA	NA	NA	NA
AXM37848.1|4663831_4665091_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
AXM38386.1|4665090_4666791_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AXM37849.1|4666793_4669508_+	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
AXM37850.1|4669730_4671203_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
AXM37851.1|4672180_4673236_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37852.1|4673463_4674882_-	glucuronate isomerase	NA	NA	NA	NA	NA
AXM37853.1|4674922_4675900_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
AXM37854.1|4677316_4678798_-	MFS transporter	NA	NA	NA	NA	NA
AXM38387.1|4679139_4682013_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXM37855.1|4682111_4683599_+	MFS transporter	NA	NA	NA	NA	NA
AXM37856.1|4683630_4684665_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AXM37857.1|4685081_4685879_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM38388.1|4686755_4686893_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38389.1|4687185_4688142_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM37858.1|4688869_4689632_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37859.1|4689649_4690750_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM37860.1|4690815_4691937_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
AXM37861.1|4691946_4693041_-	ferredoxin reductase	NA	NA	NA	NA	NA
AXM37862.1|4693115_4693796_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AXM37863.1|4693828_4694627_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXM37864.1|4694755_4696075_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 34
CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	4814223	4887039	4898917	protease,transposase	Ralstonia_virus(20.0%)	56	NA	NA
AXM37947.1|4814223_4815459_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
AXM38401.1|4816098_4816272_-	4-oxalomesaconate hydratase	NA	NA	NA	NA	NA
AXM37948.1|4816330_4817386_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
AXM37949.1|4817378_4818050_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
AXM37950.1|4818147_4819455_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXM37951.1|4819471_4820890_+	cardiolipin synthase	NA	NA	NA	NA	NA
AXM37952.1|4821461_4822856_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AXM37953.1|4822855_4823194_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37954.1|4823203_4825390_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.7	2.2e-111
AXM37955.1|4825565_4825790_-	hypothetical protein	NA	NA	NA	NA	NA
AXM38402.1|4826370_4827336_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXM38403.1|4827511_4828927_-	amino acid permease	NA	NA	NA	NA	NA
AXM37956.1|4829143_4829353_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37957.1|4829417_4831742_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
AXM38404.1|4832147_4832510_+	hypothetical protein	NA	NA	NA	NA	NA
AXM38405.1|4832887_4833433_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
AXM37958.1|4836685_4837813_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
AXM37959.1|4838668_4840009_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37960.1|4840225_4840918_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXM38406.1|4841034_4841355_+	DUF1820 family protein	NA	NA	NA	NA	NA
AXM37961.1|4841354_4842347_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
AXM37962.1|4842653_4844177_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
AXM37963.1|4844281_4845517_-	peptidase M23	NA	NA	NA	NA	NA
AXM37964.1|4845677_4846334_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37965.1|4846484_4848296_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AXM37966.1|4848443_4848794_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AXM37967.1|4848972_4850292_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM37968.1|4851704_4852886_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37969.1|4852983_4856415_-	ATP-binding protein	NA	NA	NA	NA	NA
AXM37970.1|4856562_4857261_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
AXM37971.1|4857244_4858717_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
AXM37972.1|4858713_4859301_-	DUF4276 family protein	NA	NA	NA	NA	NA
AXM37973.1|4859300_4860497_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AXM37974.1|4860570_4861200_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	1.2e-46
AXM37975.1|4861348_4861792_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXM37976.1|4862047_4862671_+	transporter	NA	NA	NA	NA	NA
AXM37977.1|4862667_4863234_+	FUSC family protein	NA	NA	NA	NA	NA
AXM37978.1|4863509_4864871_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
AXM37979.1|4864984_4865305_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37980.1|4867120_4867327_+	hypothetical protein	NA	NA	NA	NA	NA
AXM37981.1|4867313_4868426_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXM37982.1|4870777_4871530_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37983.1|4871526_4872234_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	34.6	2.0e-08
AXM37984.1|4872247_4872589_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37985.1|4872569_4873079_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	4.8e-09
AXM37986.1|4873075_4873477_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXM37987.1|4873868_4875188_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXM37988.1|4876299_4876557_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37989.1|4876605_4877043_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37990.1|4877417_4877624_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37991.1|4878635_4879805_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	1.3e-41
AXM38407.1|4879830_4881141_-	MFS transporter	NA	NA	NA	NA	NA
AXM37992.1|4883054_4883375_-	hypothetical protein	NA	NA	NA	NA	NA
AXM37993.1|4883493_4884660_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
AXM37994.1|4884922_4885879_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	29.9	8.4e-31
AXM37995.1|4886253_4887039_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
