The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029246	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 chromosome, complete genome	4752717	599668	671267	4752717	tail,plate,capsid,lysis,tRNA,terminase,integrase,head,portal	Salmonella_phage(50.0%)	92	588582:588612	676959:676989
588582:588612	attL	TGTAGGCCGGGTAAGCGCAGCGCCACCCGGC	NA	NA	NA	NA
AXL98181.1|599668_600670_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	1.0e-191
AXL98182.1|600669_601245_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.7	3.1e-60
AXL98183.1|601374_601638_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
AXL98184.1|601668_602178_+	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	96.4	2.0e-87
AXL98185.1|602185_602386_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	3.3e-30
AXL98186.1|602349_602688_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
AXL98187.1|602755_602983_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	96.0	5.8e-31
AXL98188.1|602982_603204_+	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	91.8	1.0e-32
AXL98189.1|603205_605422_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.8	0.0e+00
AXL98190.1|605540_605981_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	96.4	1.0e-68
AXL98191.1|606063_606795_+	hypothetical protein	NA	Q37850	Escherichia_phage	95.1	2.1e-130
AXL98192.1|606791_606983_-	hypothetical protein	NA	A0A0M4R4Y4	Salmonella_phage	83.3	3.8e-07
AXL98193.1|606968_607151_+	hypothetical protein	NA	NA	NA	NA	NA
AXM01990.1|607328_608333_-	hypothetical protein	NA	NA	NA	NA	NA
AXL98194.1|608410_609457_-|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	95.1	1.2e-190
AXL98195.1|609458_611228_-	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	99.5	0.0e+00
AXL98196.1|611393_612248_+|capsid	capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	98.2	1.8e-157
AXL98197.1|612323_613391_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	97.7	2.3e-194
AXL98198.1|613395_614145_+|terminase	terminase	terminase	A0A218M4L0	Erwinia_phage	96.0	1.1e-113
AXL98199.1|614238_614748_+|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	98.2	4.3e-90
AXL98200.1|614747_614951_+|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	95.5	2.6e-30
AXL98201.1|614941_615163_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	98.6	8.4e-35
AXL98202.1|615146_615659_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	97.6	7.8e-92
AXL98203.1|615655_616087_+	lysA protein	NA	A0A218M4L6	Erwinia_phage	86.0	1.8e-65
AXL98204.1|616086_616497_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	93.4	4.2e-64
AXL98205.1|616468_616642_+|lysis	phage lysis protein	lysis	O80311	Escherichia_phage	96.5	1.8e-24
AXL98206.1|616604_617072_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	100.0	1.4e-84
AXL98207.1|617064_617514_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	96.6	8.7e-71
AXL98208.1|617582_618218_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	98.1	7.2e-111
AXL98209.1|618214_618562_+|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	97.4	8.0e-56
AXL98210.1|618568_619477_+|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	85.4	1.0e-139
AXL98211.1|619469_620000_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.4	1.3e-89
AXL98212.1|620011_622042_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.0	1.5e-90
AXL98213.1|622053_622458_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	44.0	2.6e-21
AXL98214.1|622581_623769_+|tail	phage tail protein	tail	Q37844	Escherichia_phage	96.5	1.0e-214
AXL98215.1|623784_624303_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	6.5e-94
AXL98216.1|624365_624701_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	98.2	5.2e-52
AXL98217.1|624715_624853_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	97.8	1.2e-18
AXL98218.1|624845_627287_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	94.6	0.0e+00
AXL98219.1|627299_627785_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	95.7	4.1e-82
AXL98220.1|627781_628951_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	97.2	1.2e-207
AXL98221.1|629017_629236_+	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	100.0	4.3e-39
AXL98222.1|629479_630565_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	60.5	2.6e-121
AXL98223.1|630587_631202_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	39.0	1.4e-34
AXL98224.1|631302_631539_+	regulator	NA	NA	NA	NA	NA
AXL98225.1|631573_632083_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	86.4	7.6e-79
AXL98226.1|632090_632315_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	73.0	1.8e-24
AXL98227.1|632304_632505_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	70.8	4.3e-22
AXL98228.1|632574_632808_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	68.8	2.3e-19
AXL98229.1|632807_633035_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	80.0	5.4e-29
AXL98230.1|633031_633904_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.3	1.1e-106
AXL98231.1|637182_637878_+	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	75.0	7.9e-95
AXL98232.1|638038_638227_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.0	3.7e-23
AXL98233.1|638237_638471_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	88.3	5.4e-32
AXL98234.1|638757_638976_+	multidrug ABC transporter ATPase	NA	NA	NA	NA	NA
AXL98235.1|638975_639818_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	47.7	2.9e-59
AXL98236.1|639827_640061_+	hypothetical protein	NA	NA	NA	NA	NA
AXL98237.1|640030_641776_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AXL98238.1|641812_642874_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	81.8	4.5e-158
AXL98239.1|642873_644637_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	87.7	3.2e-312
AXL98240.1|644786_645614_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	67.4	4.1e-74
AXL98241.1|645629_646778_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	67.0	1.9e-130
AXL98242.1|646781_647435_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	56.1	3.0e-56
AXL98243.1|647533_648001_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
AXL98244.1|648000_648204_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AXL98245.1|648207_648423_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
AXL98246.1|648403_648919_+	lysozyme	NA	E5G6N1	Salmonella_phage	75.9	2.4e-72
AXL98247.1|648915_649344_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	84.3	1.2e-56
AXL98248.1|649273_649477_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	91.0	1.8e-28
AXL98249.1|649439_649871_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	3.5e-69
AXL98250.1|649863_650310_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	78.4	1.7e-58
AXL98251.1|650378_650957_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.4	2.0e-104
AXL98252.1|650953_651313_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.8	2.3e-53
AXL98253.1|651299_652208_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	92.4	8.0e-148
AXL98254.1|652200_652806_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	93.5	1.8e-111
AXL98255.1|654289_654763_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	59.6	6.6e-53
AXL98256.1|655193_655529_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	65.8	1.9e-06
AXL98257.1|656026_656614_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	85.8	1.1e-84
AXL98258.1|656672_657425_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	50.6	1.5e-62
AXL98259.1|657505_658678_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	9.5e-210
AXL98260.1|658687_659203_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
AXL98261.1|659257_659560_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	3.1e-40
AXL98262.1|659574_659694_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
AXL98263.1|659686_663130_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.4	0.0e+00
AXL98264.1|663129_663615_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	90.1	3.0e-69
AXL98265.1|663611_664712_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	91.8	7.1e-183
AXM01991.1|664781_665000_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.6e-25
AXL98266.1|665336_665843_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AXL98267.1|665943_667788_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AXL98268.1|667940_669686_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
AXL98269.1|669801_670017_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXL98270.1|670253_671267_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	6.3e-109
676959:676989	attR	TGTAGGCCGGGTAAGCGCAGCGCCACCCGGC	NA	NA	NA	NA
>prophage 2
CP029246	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 chromosome, complete genome	4752717	1028467	1128662	4752717	protease,tail,plate,holin,capsid,lysis,tRNA,terminase,integrase,head,portal	Escherichia_phage(20.59%)	114	1096250:1096265	1124982:1124997
AXL98603.1|1028467_1031095_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	1.7e-81
AXL98604.1|1031336_1031522_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AXL98605.1|1032712_1033279_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AXL98606.1|1033275_1033704_+	DedA family protein	NA	NA	NA	NA	NA
AXL98607.1|1033787_1035332_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AXL98608.1|1035484_1036000_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AXM01998.1|1036053_1036818_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXL98609.1|1036804_1038460_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
AXL98610.1|1038626_1040174_-	multidrug efflux MFS transporter subunit EmrB	NA	NA	NA	NA	NA
AXL98611.1|1040190_1041363_-	multidrug export protein EmrA	NA	NA	NA	NA	NA
AXL98612.1|1041493_1042024_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
AXL98613.1|1042338_1043523_-	MFS transporter	NA	NA	NA	NA	NA
AXL98614.1|1043713_1044709_-	proline/glycine betaine ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
AXL98615.1|1044718_1045783_-	proline/glycine betaine ABC transporter permease ProW	NA	NA	NA	NA	NA
AXL98616.1|1045775_1046978_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.3	3.2e-27
AXL98617.1|1047311_1048271_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.1	5.7e-136
AXL98618.1|1048280_1050425_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.8	7.8e-202
AXL98619.1|1050397_1050808_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.3	3.0e-17
AXL98620.1|1050804_1051044_-	NrdH-redoxin	NA	A0A0M7REK7	Lactobacillus_phage	43.2	9.8e-13
AXL98621.1|1051287_1051614_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
AXL98622.1|1051772_1052117_+	DUF2002 domain-containing protein	NA	NA	NA	NA	NA
AXL98623.1|1052149_1052599_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
AXL98624.1|1053095_1053500_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
AXL98625.1|1053537_1053717_-	hypothetical protein	NA	NA	NA	NA	NA
AXL98626.1|1053799_1054318_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
AXL98627.1|1054497_1054656_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AXL98628.1|1054652_1055582_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXL98629.1|1055902_1056508_+	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	25.2	1.6e-06
AXL98630.1|1056616_1058158_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AXM01999.1|1058154_1059573_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AXL98631.1|1059584_1061165_+	xanthine permease	NA	NA	NA	NA	NA
AXL98632.1|1061161_1062118_+	carbamate kinase	NA	NA	NA	NA	NA
AXL98633.1|1062119_1063499_+	deaminase	NA	NA	NA	NA	NA
AXL98634.1|1065162_1066011_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.5	6.4e-139
AXL98635.1|1066020_1067232_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	85.7	5.8e-194
AXL98636.1|1067275_1067602_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	6.1e-50
AXL98637.1|1067598_1067943_+|head,tail	head-tail adaptor protein	head,tail	Q7Y406	Yersinia_phage	57.3	1.1e-25
AXL98638.1|1067923_1068307_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	57.5	2.8e-41
AXL98639.1|1068309_1068714_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	72.7	9.7e-45
AXL98640.1|1068746_1069199_+|tail	phage tail protein	tail	Q7Y403	Yersinia_phage	76.7	9.1e-60
AXL98641.1|1069262_1069625_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	55.2	1.1e-26
AXM02000.1|1069645_1069864_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	59.7	2.0e-20
AXL98642.1|1069863_1073193_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	66.5	0.0e+00
AXL98643.1|1073195_1073534_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	77.7	9.2e-49
AXL98644.1|1073530_1074286_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	92.4	1.0e-135
AXL98645.1|1074287_1074998_+	peptidase P60	NA	K7PJV6	Enterobacteria_phage	96.2	1.5e-141
AXL98646.1|1075026_1075374_+	hypothetical protein	NA	NA	NA	NA	NA
AXL98647.1|1075400_1075991_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	85.2	3.8e-90
AXL98648.1|1076045_1079843_+	DUF1983 domain-containing protein	NA	K7PHL5	Enterobacterial_phage	83.5	0.0e+00
AXL98649.1|1079886_1080201_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	71.6	6.4e-36
AXL98650.1|1080201_1080873_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	70.9	1.1e-85
AXL98651.1|1080980_1081214_+	cor protein	NA	E4WL42	Enterobacteria_phage	75.3	2.5e-29
AXL98652.1|1081271_1082399_+|tail	tail fiber domain-containing protein	tail	A0A2I6PID3	Escherichia_phage	37.3	2.1e-52
AXL98653.1|1082652_1083006_-	hypothetical protein	NA	NA	NA	NA	NA
AXL98654.1|1083769_1084192_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	47.2	1.8e-25
AXL98655.1|1084278_1084518_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	89.9	2.2e-33
AXL98656.1|1085241_1085724_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
AXL98657.1|1085841_1086318_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AXL98658.1|1086307_1086595_+	RnfH family protein	NA	NA	NA	NA	NA
AXL98659.1|1086656_1086995_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXL98660.1|1086976_1087159_-	hypothetical protein	NA	NA	NA	NA	NA
AXL98661.1|1087133_1088795_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AXL98662.1|1088880_1089759_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXL98663.1|1089857_1090475_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXL98664.1|1090527_1091814_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AXM02001.1|1091833_1092625_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AXL98665.1|1092791_1094153_+	signal recognition particle protein	NA	NA	NA	NA	NA
AXL98666.1|1094269_1094518_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXL98667.1|1094533_1095073_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXL98668.1|1095104_1095872_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AXL98669.1|1095915_1096263_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
1096250:1096265	attL	AGCGTCTGAACTAAGA	NA	NA	NA	NA
AXL98670.1|1096422_1096641_-	transcriptional regulator	NA	Q37973	Salmonella_virus	80.6	2.1e-30
AXL98671.1|1096718_1097864_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	78.6	3.8e-155
AXL98672.1|1097863_1098343_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	84.3	2.6e-73
AXL98673.1|1098358_1100902_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	70.2	1.2e-217
AXL98674.1|1100894_1101014_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	6.7e-15
AXL98675.1|1101046_1101322_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	83.5	2.8e-35
AXL98676.1|1101383_1101902_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	90.7	4.5e-87
AXL98677.1|1101915_1103106_-|tail	phage tail protein	tail	Q7Y4D1	Escherichia_virus	89.9	4.5e-207
AXL98678.1|1103230_1103635_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	51.1	2.6e-29
AXL98679.1|1103646_1105833_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.5	4.8e-90
AXL98680.1|1105844_1106375_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	85.8	2.6e-90
AXL98681.1|1106367_1107276_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	81.1	1.1e-133
AXL98682.1|1107279_1107627_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	74.8	3.8e-42
AXL98683.1|1107623_1108265_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	80.3	8.9e-93
AXL98684.1|1108333_1108783_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	1.8e-47
AXL98685.1|1108775_1109243_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	85.8	2.2e-72
AXM02002.1|1109205_1109448_-|holin	holin	holin	S4TNY4	Salmonella_phage	69.6	1.7e-25
AXL98686.1|1109350_1109764_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	68.6	7.1e-43
AXL98687.1|1109760_1110258_-	lysozyme	NA	O80309	Escherichia_phage	91.4	2.4e-85
AXL98688.1|1110244_1110541_-|holin	holin	holin	O80308	Escherichia_phage	88.8	2.3e-40
AXL98689.1|1110545_1110749_-|tail	phage tail protein	tail	Q858W3	Yersinia_virus	82.1	1.6e-24
AXL98690.1|1110748_1111249_-|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	67.4	1.8e-56
AXL98691.1|1111348_1112110_-|terminase	terminase	terminase	A0A218M4L0	Erwinia_phage	66.8	7.3e-78
AXL98692.1|1112113_1113187_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	79.3	1.6e-158
AXL98693.1|1113247_1114102_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	70.1	3.4e-108
AXL98694.1|1114267_1116037_+	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	85.9	6.5e-303
AXL98695.1|1116038_1117061_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.6	6.0e-168
AXL98696.1|1117760_1117994_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	1.8e-35
AXL98697.1|1117997_1118180_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	70.7	6.5e-17
AXL98698.1|1118395_1118623_+	hypothetical protein	NA	NA	NA	NA	NA
AXL98699.1|1118641_1121035_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	85.8	0.0e+00
AXL98700.1|1121012_1121294_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	69.9	1.5e-28
AXL98701.1|1121294_1121522_-	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	61.3	2.6e-15
AXL98702.1|1121587_1121926_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	75.9	2.4e-41
AXL98703.1|1121889_1122090_-	DUF2724 domain-containing protein	NA	A0A218M4I1	Erwinia_phage	75.8	5.7e-22
AXL98704.1|1122097_1122607_-	hypothetical protein	NA	Q6K1F8	Salmonella_virus	85.8	1.9e-77
AXL98705.1|1122638_1122869_-	hypothetical protein	NA	NA	NA	NA	NA
AXL98706.1|1122988_1123849_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	43.8	3.5e-68
AXL98707.1|1123851_1124883_+|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	79.8	1.4e-164
AXL98708.1|1125127_1125532_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
1124982:1124997	attR	AGCGTCTGAACTAAGA	NA	NA	NA	NA
AXL98709.1|1125570_1126941_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AXL98710.1|1126943_1127429_-	OmpA family protein	NA	NA	NA	NA	NA
AXL98711.1|1127441_1128662_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
>prophage 3
CP029246	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 chromosome, complete genome	4752717	1613238	1622088	4752717		Enterobacteria_phage(28.57%)	7	NA	NA
AXL99122.1|1613238_1614303_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
AXL99123.1|1614318_1615185_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.3	2.8e-110
AXL99124.1|1615197_1616088_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	31.3	4.8e-28
AXL99125.1|1616098_1616647_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	9.1e-54
AXL99126.1|1616782_1618189_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
AXL99127.1|1618442_1619609_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	1.2e-111
AXL99128.1|1621083_1622088_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	3.3e-33
>prophage 4
CP029246	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 chromosome, complete genome	4752717	1723110	1743228	4752717	integrase,holin	Pectobacterium_phage(33.33%)	25	1717500:1717515	1752369:1752384
1717500:1717515	attL	TCGATCCTGAGCTGGT	NA	NA	NA	NA
AXL99218.1|1723110_1724127_-|integrase	integrase	integrase	H9C152	Pectobacterium_phage	64.0	2.8e-125
AXL99219.1|1724110_1724359_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	39.5	6.4e-07
AXL99220.1|1724294_1724519_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	56.3	1.7e-11
AXL99221.1|1724569_1724752_-	hypothetical protein	NA	NA	NA	NA	NA
AXL99222.1|1724754_1725315_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	56.3	2.9e-47
AXM02021.1|1725311_1727504_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.9	6.5e-103
AXL99223.1|1727554_1727878_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02022.1|1728429_1728843_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	61.9	2.0e-37
AXL99224.1|1728911_1729106_+	hypothetical protein	NA	NA	NA	NA	NA
AXL99225.1|1730332_1731091_+	hypothetical protein	NA	NA	NA	NA	NA
AXL99226.1|1731090_1731501_+	hypothetical protein	NA	NA	NA	NA	NA
AXL99227.1|1731561_1731903_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	51.8	3.7e-21
AXL99228.1|1731899_1733510_+	transcriptional regulator	NA	A0A2H4JCA3	uncultured_Caudovirales_phage	70.3	8.4e-225
AXL99229.1|1733530_1735777_+	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	46.0	3.8e-66
AXL99230.1|1735806_1737288_-	hypothetical protein	NA	NA	NA	NA	NA
AXL99231.1|1737284_1738226_-	glycosyltransferase	NA	U5P087	Shigella_phage	91.7	5.5e-160
AXL99232.1|1738222_1738585_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	75.0	3.5e-46
AXL99233.1|1738734_1738965_+|holin	holin	holin	A5LH82	Enterobacteria_phage	71.0	2.9e-22
AXL99234.1|1738945_1739485_+	lysozyme	NA	H6WRZ4	Salmonella_phage	89.3	2.2e-92
AXL99235.1|1739481_1739841_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	45.5	2.4e-15
AXL99236.1|1740412_1740514_+	DNA invertase	NA	NA	NA	NA	NA
AXL99237.1|1740592_1740916_+	hypothetical protein	NA	NA	NA	NA	NA
AXL99238.1|1740945_1741872_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXL99239.1|1741877_1742348_-	hypothetical protein	NA	NA	NA	NA	NA
AXL99240.1|1742511_1743228_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	1.0e-12
1752369:1752384	attR	TCGATCCTGAGCTGGT	NA	NA	NA	NA
>prophage 5
CP029246	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 chromosome, complete genome	4752717	1790703	1841715	4752717	protease,tail,holin,capsid,tRNA,terminase,head,portal	Enterobacteria_phage(23.4%)	63	NA	NA
AXL99283.1|1790703_1792437_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	37.0	8.8e-87
AXL99284.1|1792675_1793236_+	VOC family protein	NA	NA	NA	NA	NA
AXL99285.1|1793314_1794058_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXL99286.1|1794038_1794422_+	hypothetical protein	NA	NA	NA	NA	NA
AXL99287.1|1794318_1795290_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AXL99288.1|1795286_1796030_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
AXL99289.1|1796070_1796466_-	hypothetical protein	NA	NA	NA	NA	NA
AXL99290.1|1796517_1797291_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	8.6e-58
AXL99291.1|1797269_1798583_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	86.0	2.7e-221
AXL99292.1|1798638_1798875_-	excisionase	NA	Q8W657	Enterobacteria_phage	85.9	8.1e-36
AXL99293.1|1798917_1799745_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.4	5.5e-111
AXL99294.1|1799741_1799936_-	hypothetical protein	NA	NA	NA	NA	NA
AXL99295.1|1799935_1800343_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	48.5	6.1e-23
AXL99296.1|1800339_1800561_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	66.7	1.4e-18
AXM02025.1|1800560_1800917_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	88.3	1.1e-47
AXL99297.1|1800897_1801101_-	hypothetical protein	NA	NA	NA	NA	NA
AXL99298.1|1801237_1801897_-	AP2 domain-containing protein	NA	L0AQZ0	Klebsiella_phage	44.0	2.4e-45
AXL99299.1|1802387_1802600_-	hypothetical protein	NA	NA	NA	NA	NA
AXL99300.1|1802790_1803480_-	helix-turn-helix domain-containing protein	NA	K7PK07	Enterobacteria_phage	64.8	4.6e-71
AXL99301.1|1803591_1803819_+	transcriptional regulator	NA	NA	NA	NA	NA
AXL99302.1|1803844_1804141_+	transcriptional regulator	NA	NA	NA	NA	NA
AXL99303.1|1804137_1805049_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	60.2	1.1e-91
AXL99304.1|1805064_1805946_+	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	62.0	2.0e-79
AXL99305.1|1805942_1807322_+	helicase	NA	Q8W640	Enterobacteria_phage	67.5	3.2e-172
AXL99306.1|1807349_1808132_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.4	1.3e-109
AXL99307.1|1808330_1808912_+	endonuclease	NA	A0A2I7RSG2	Vibrio_phage	43.2	7.2e-25
AXL99308.1|1808958_1809186_-	hypothetical protein	NA	NA	NA	NA	NA
AXL99309.1|1809691_1810081_+	hypothetical protein	NA	G8C7V8	Escherichia_phage	99.2	8.9e-64
AXL99310.1|1810070_1810349_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	97.8	4.7e-43
AXL99311.1|1810348_1810891_+	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	74.3	6.2e-79
AXL99312.1|1810887_1811163_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	80.2	1.0e-29
AXL99313.1|1811113_1811293_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	80.0	4.0e-19
AXM02026.1|1811359_1811617_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	52.7	5.1e-15
AXL99314.1|1811855_1812320_-|protease	retroviral-like aspartic protease	protease	NA	NA	NA	NA
AXL99315.1|1812580_1813378_+	DUF1983 domain-containing protein	NA	S4TNN5	Salmonella_phage	52.8	3.5e-54
AXL99316.1|1813380_1813614_+	hypothetical protein	NA	NA	NA	NA	NA
AXL99317.1|1813654_1815112_+	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	93.2	7.3e-276
AXL99318.1|1815071_1815749_+	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	37.0	1.7e-14
AXM02027.1|1816315_1816684_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	86.9	1.9e-55
AXL99319.1|1816791_1817286_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
AXL99320.1|1817282_1818944_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	98.7	0.0e+00
AXL99321.1|1819002_1820937_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	98.3	0.0e+00
AXL99322.1|1821140_1822499_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	93.1	8.6e-247
AXL99323.1|1822495_1823539_+|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	83.9	1.2e-102
AXL99324.1|1823535_1823862_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	89.8	5.8e-48
AXL99325.1|1823870_1824221_+|head,tail	head-tail adaptor protein	head,tail	S4TND9	Salmonella_phage	90.5	1.7e-53
AXL99326.1|1824217_1824667_+	hypothetical protein	NA	K7P6X4	Enterobacteria_phage	98.7	2.2e-74
AXL99327.1|1824663_1825011_+	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	96.5	5.5e-57
AXL99328.1|1825070_1825514_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	94.5	1.6e-72
AXL99329.1|1825522_1825906_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	92.9	1.3e-62
AXL99330.1|1825914_1826193_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	8.1e-43
AXM02028.1|1826244_1826538_+	hypothetical protein	NA	NA	NA	NA	NA
AXL99331.1|1826596_1829899_+|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	81.6	0.0e+00
AXL99332.1|1829901_1830240_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
AXL99333.1|1830236_1830995_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.2	2.5e-94
AXL99334.1|1830997_1831708_+	peptidase P60	NA	F1C573	Cronobacter_phage	70.2	1.3e-97
AXL99335.1|1831707_1832295_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	4.7e-48
AXL99336.1|1832347_1836187_+	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	61.5	0.0e+00
AXL99337.1|1836188_1837154_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.2	8.2e-58
AXM02029.1|1837773_1838352_+|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	54.4	9.3e-33
AXL99338.1|1838482_1838749_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	94.3	1.4e-39
AXL99339.1|1839113_1839680_-	hydrolase	NA	NA	NA	NA	NA
AXL99340.1|1839942_1841715_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
CP029246	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 chromosome, complete genome	4752717	2057579	2111325	4752717	tail,protease,plate,holin,capsid,lysis,terminase,integrase,head,portal	Escherichia_phage(23.68%)	63	2048081:2048095	2074719:2074733
2048081:2048095	attL	AGCCTGCGAATATCG	NA	NA	NA	NA
AXL99524.1|2057579_2058590_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	76.7	2.1e-149
AXL99525.1|2058686_2058983_-	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	70.1	9.6e-34
AXL99526.1|2059118_2059394_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	82.2	3.7e-40
AXL99527.1|2059560_2060061_+	replication protein B	NA	M1SV55	Escherichia_phage	75.3	4.8e-70
AXL99528.1|2060127_2060346_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	62.1	2.2e-11
AXL99529.1|2060368_2060632_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	60.5	6.7e-23
AXL99530.1|2060633_2062931_+	replication endonuclease	NA	Q858T4	Yersinia_virus	74.9	0.0e+00
AXM02038.1|2063063_2063291_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	60.0	9.3e-13
AXL99531.1|2063404_2063914_+	hypothetical protein	NA	NA	NA	NA	NA
AXL99532.1|2064191_2064506_+	hypothetical protein	NA	NA	NA	NA	NA
AXL99533.1|2064507_2065101_+	hypothetical protein	NA	NA	NA	NA	NA
AXL99534.1|2065352_2067011_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
AXL99535.1|2067040_2068066_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.6	7.1e-169
AXL99536.1|2068067_2069837_-	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	85.7	1.9e-302
AXL99537.1|2070003_2070858_+|capsid	capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	73.6	1.4e-117
AXL99538.1|2070913_2072008_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	81.1	7.9e-166
AXL99539.1|2072011_2072767_+|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	68.5	1.2e-80
AXL99540.1|2072866_2073373_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	71.4	8.3e-62
AXL99541.1|2073372_2073576_+|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	80.6	1.1e-25
AXL99542.1|2073566_2073788_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	75.3	1.4e-26
AXL99543.1|2073771_2074281_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	86.3	4.9e-78
AXL99544.1|2074277_2074703_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	68.6	3.0e-44
AXL99545.1|2074590_2074836_+|holin	holin	holin	S4TNY4	Salmonella_phage	77.8	1.0e-28
2074719:2074733	attR	CGATATTCGCAGGCT	NA	NA	NA	NA
AXL99546.1|2074798_2075266_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	72.3	1.3e-61
AXL99547.1|2075258_2075717_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	63.8	1.1e-44
AXL99548.1|2075809_2077333_-	ATP-binding protein	NA	NA	NA	NA	NA
AXL99549.1|2077614_2078256_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	82.6	1.3e-96
AXL99550.1|2078252_2078603_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	70.7	6.9e-39
AXL99551.1|2078608_2079517_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	83.1	1.7e-137
AXL99552.1|2079509_2080040_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	5.3e-91
AXL99553.1|2080051_2081884_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.0	2.2e-91
AXL99554.1|2081886_2082402_+|tail	tail assembly chaperone	tail	F1BUK2	Cronobacter_phage	38.3	7.5e-18
AXL99555.1|2082776_2083970_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	1.4e-184
AXL99556.1|2083982_2084501_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	82.0	5.9e-79
AXL99557.1|2084557_2084851_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	72.4	1.7e-27
AXL99558.1|2084883_2085006_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	92.3	2.0e-14
AXL99559.1|2084995_2087443_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	57.8	8.9e-218
AXL99560.1|2087456_2087921_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	74.8	1.4e-60
AXL99561.1|2087917_2089087_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	74.6	8.1e-161
AXL99562.1|2089163_2089385_+	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.9	3.5e-25
AXL99563.1|2089566_2090505_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AXL99564.1|2090668_2090965_-	hypothetical protein	NA	NA	NA	NA	NA
AXL99565.1|2091186_2091915_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
AXL99566.1|2091953_2092349_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
AXL99567.1|2092447_2094634_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AXL99568.1|2094814_2095354_-	septation protein A	NA	NA	NA	NA	NA
AXL99569.1|2095367_2096111_-	UPF0259 family protein	NA	NA	NA	NA	NA
AXL99570.1|2096136_2096541_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXL99571.1|2096823_2097456_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
AXL99572.1|2097742_2097976_-	SirA-like protein	NA	NA	NA	NA	NA
AXL99573.1|2097972_2099184_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
AXL99574.1|2099358_2100168_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXL99575.1|2100167_2101361_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXL99576.1|2101371_2102730_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.0	5.0e-37
AXL99577.1|2102733_2104329_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.3	1.2e-50
AXL99578.1|2104328_2105891_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
AXM02039.1|2105985_2106030_-	trp operon leader peptide	NA	NA	NA	NA	NA
AXL99579.1|2106169_2107051_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
AXL99580.1|2107047_2107668_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AXL99581.1|2107765_2108641_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
AXL99582.1|2108677_2109268_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AXL99583.1|2109264_2110026_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
AXL99584.1|2110278_2111325_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.2	1.3e-19
>prophage 7
CP029246	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 chromosome, complete genome	4752717	2488838	2495846	4752717	integrase	Escherichia_phage(100.0%)	8	NA	NA
AXL99911.1|2488838_2489555_-	HNH endonuclease	NA	A0A1I9SEA5	Escherichia_phage	46.5	1.0e-33
AXL99912.1|2489723_2491088_-|integrase	integrase	integrase	NA	NA	NA	NA
AXL99913.1|2491319_2492429_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	47.3	2.5e-87
AXL99914.1|2492439_2493057_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.0e-74
AXL99915.1|2493058_2493913_+	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	34.6	7.6e-23
AXL99916.1|2493957_2494572_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.7	8.7e-29
AXL99917.1|2494681_2494993_+	DNA damage-inducible SOS regulon protein	NA	NA	NA	NA	NA
AXL99918.1|2495168_2495846_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.1	5.5e-77
>prophage 8
CP029246	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 chromosome, complete genome	4752717	2672457	2713873	4752717	tail,tRNA,transposase	Escherichia_phage(30.56%)	50	NA	NA
AXM00079.1|2672457_2672922_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	36.7	2.3e-13
AXM00080.1|2672994_2673750_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	26.2	1.7e-10
AXM00081.1|2673749_2674301_-	glutathione peroxidase	NA	NA	NA	NA	NA
AXM00082.1|2674684_2675356_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.0	2.4e-80
AXM00083.1|2675422_2675830_-	tolA family protein	NA	NA	NA	NA	NA
AXM00084.1|2675972_2677241_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.7	4.4e-229
AXM00085.1|2677240_2677561_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.8	3.3e-24
AXM00086.1|2677560_2677800_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	72.2	9.1e-27
AXM00087.1|2678170_2679298_-|tail	tail fiber domain-containing protein	tail	A0A2I6PID3	Escherichia_phage	36.2	5.6e-50
AXM00088.1|2679356_2679590_-	cor protein	NA	E4WL42	Enterobacteria_phage	77.6	3.9e-30
AXM00089.1|2679697_2680369_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	2.2e-86
AXM00090.1|2680369_2680684_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	63.7	7.3e-32
AXM00091.1|2680727_2684594_-	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	76.8	0.0e+00
AXM00092.1|2684649_2685249_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	92.5	1.9e-97
AXM00093.1|2685236_2685968_-	peptidase P60	NA	G8C7R2	Escherichia_phage	96.3	2.0e-149
AXM00094.1|2685980_2686754_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	95.7	2.7e-144
AXM00095.1|2686750_2687101_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	92.2	2.3e-55
AXM00096.1|2687155_2687488_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00097.1|2687484_2688450_-	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	40.9	1.3e-10
AXM00098.1|2688515_2688740_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00099.1|2688745_2690668_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	48.5	1.3e-150
AXM00100.1|2690727_2691848_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AXM00101.1|2691897_2692260_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00102.1|2692851_2693373_-	hypothetical protein	NA	I6R9C4	Salmonella_phage	45.0	1.7e-30
AXM00103.1|2693656_2693854_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00104.1|2694592_2694898_-	hypothetical protein	NA	A0A2H4A316	Salmonella_phage	77.6	2.8e-12
AXM00105.1|2694894_2695365_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00106.1|2695361_2695814_-	hypothetical protein	NA	A0A076G839	Escherichia_phage	40.3	6.6e-10
AXM00107.1|2695810_2696071_-	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	72.3	3.1e-28
AXM00108.1|2696074_2696761_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00109.1|2696772_2697465_-	phage replication protein	NA	G8C7U6	Escherichia_phage	60.9	2.4e-80
AXM02060.1|2697448_2698441_-	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	1.4e-49
AXM00110.1|2698878_2699421_-	regulator	NA	M9NZI6	Enterobacteria_phage	55.6	5.6e-48
AXM00111.1|2699423_2699657_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	59.5	1.5e-18
AXM00112.1|2699760_2700156_+	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	71.8	2.9e-46
AXM00113.1|2700467_2700926_+	hypothetical protein	NA	NA	NA	NA	NA
AXM00114.1|2700912_2701293_+	hypothetical protein	NA	NA	NA	NA	NA
AXM00115.1|2701664_2702015_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	51.7	6.0e-27
AXM02061.1|2702004_2702202_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00116.1|2702216_2702402_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AXM00117.1|2702655_2702943_+	DNA breaking-rejoining protein	NA	H6WRX2	Salmonella_phage	67.4	4.2e-34
AXM00118.1|2703065_2706134_+	exodeoxyribonuclease	NA	K7PJT5	Enterobacteria_phage	70.1	0.0e+00
AXM02062.1|2706145_2707258_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	76.7	1.7e-160
AXM00119.1|2707292_2707532_+	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	69.2	2.1e-23
AXM00120.1|2707596_2707812_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	60.6	2.2e-19
AXM00121.1|2707811_2709032_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	51.9	9.8e-117
AXM00122.1|2709098_2710079_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AXM00123.1|2710182_2710482_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AXM00124.1|2710486_2712874_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXM00125.1|2712889_2713873_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	43.2	9.9e-35
>prophage 9
CP029246	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 chromosome, complete genome	4752717	2770112	2829441	4752717	tail,protease,holin,capsid,tRNA,terminase,head,portal	Enterobacterial_phage(32.69%)	78	NA	NA
AXM00181.1|2770112_2771396_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
AXM00182.1|2771658_2771979_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.1	8.2e-23
AXM00183.1|2771978_2772218_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	78.2	8.8e-30
AXM00184.1|2772317_2772584_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	92.0	4.4e-38
AXM02067.1|2772715_2773078_-|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	57.0	3.1e-26
AXM00185.1|2773901_2774135_-	cor protein	NA	E4WL42	Enterobacteria_phage	77.6	3.9e-30
AXM00186.1|2774242_2774914_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	2.2e-86
AXM00187.1|2774914_2775229_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	63.7	7.3e-32
AXM02068.1|2775272_2779121_-	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	61.1	0.0e+00
AXM00188.1|2779174_2779759_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	52.1	9.7e-54
AXM00189.1|2779758_2780469_-	peptidase P60	NA	F1C573	Cronobacter_phage	69.8	5.0e-97
AXM00190.1|2780471_2781230_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	3.9e-95
AXM00191.1|2781226_2781565_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	58.9	4.7e-37
AXM00192.1|2785105_2785441_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	93.7	4.0e-52
AXM00193.1|2785496_2785775_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	6.2e-43
AXM00194.1|2785783_2786167_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
AXM00195.1|2786175_2786619_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	92.4	3.9e-71
AXM00196.1|2786678_2787026_-	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	93.9	2.7e-56
AXM00197.1|2787022_2787472_-	hypothetical protein	NA	K7P6X4	Enterobacteria_phage	98.7	1.7e-74
AXM00198.1|2787468_2787807_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	4.3e-38
AXM00199.1|2787815_2788142_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	81.5	3.4e-48
AXM00200.1|2788185_2789397_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.7	2.8e-196
AXM00201.1|2789406_2790255_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.4	2.7e-137
AXM00202.1|2790268_2791573_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	92.9	1.4e-233
AXM00203.1|2791572_2793309_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	100.0	0.0e+00
AXM00204.1|2793308_2793782_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.7	1.3e-85
AXM00205.1|2793938_2794289_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	1.2e-51
AXM00206.1|2794288_2794879_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	81.1	1.8e-95
AXM00207.1|2795044_2795302_+	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	96.3	9.2e-33
AXM00208.1|2795602_2797060_-	glycosyltransferase	NA	S4TSQ9	Salmonella_phage	89.9	1.8e-266
AXM00209.1|2797117_2797723_+	hypothetical protein	NA	NA	NA	NA	NA
AXM00210.1|2797780_2797960_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	81.4	7.8e-15
AXM02069.1|2797916_2798186_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	82.0	2.0e-30
AXM00211.1|2798193_2798823_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.0	9.3e-103
AXM00212.1|2798822_2799104_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	2.8e-43
AXM00213.1|2799090_2799486_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	96.9	3.8e-62
AXM00214.1|2799641_2800220_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	53.9	7.3e-46
AXM00215.1|2800232_2801222_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	85.1	2.4e-166
AXM00216.1|2801218_2801608_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	94.6	1.7e-67
AXM00217.1|2801604_2801925_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	75.5	1.2e-42
AXM00218.1|2801921_2802149_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00219.1|2802145_2802805_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.3	1.1e-98
AXM00220.1|2802804_2803299_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00221.1|2803295_2804222_-	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	56.0	4.0e-70
AXM00222.1|2804178_2804391_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	63.5	5.6e-12
AXM00223.1|2804631_2805102_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	96.8	8.5e-77
AXM00224.1|2805143_2805362_-	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	60.3	4.9e-11
AXM00225.1|2805460_2806180_+	helix-turn-helix domain-containing protein	NA	A0A2R2X2B0	Escherichia_phage	63.3	4.1e-78
AXM00226.1|2807391_2808219_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	87.8	7.9e-126
AXM00227.1|2808215_2808707_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	38.0	2.8e-06
AXM00228.1|2808816_2809374_+	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	69.7	2.0e-61
AXM00229.1|2809366_2809567_+	hypothetical protein	NA	NA	NA	NA	NA
AXM00230.1|2810470_2810755_+	DUF4752 domain-containing protein	NA	A0A2H5BFM0	Salmonella_phage	44.1	5.2e-21
AXM00231.1|2810821_2811091_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	74.2	6.9e-31
AXM00232.1|2811123_2811387_+	hypothetical protein	NA	NA	NA	NA	NA
AXM00233.1|2812724_2813225_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AXM00234.1|2813634_2814966_+	MFS transporter	NA	NA	NA	NA	NA
AXM00235.1|2814981_2817018_+	family 31 glucosidase	NA	NA	NA	NA	NA
AXM00236.1|2817124_2817571_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AXM00237.1|2817554_2818346_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXM00238.1|2818445_2819633_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AXM00239.1|2819664_2820372_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00240.1|2820522_2820867_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AXM00241.1|2820867_2821173_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00242.1|2821253_2821508_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AXM00243.1|2821520_2821703_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00244.1|2821820_2822849_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	2.2e-13
AXM00245.1|2822894_2822993_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02070.1|2822993_2823068_+	hypothetical protein	NA	NA	NA	NA	NA
AXM00246.1|2823121_2823370_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AXM02071.1|2823398_2823584_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00247.1|2823742_2823835_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
AXM00248.1|2823959_2825459_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AXM00249.1|2825463_2825709_-	DUF2543 domain-containing protein	NA	NA	NA	NA	NA
AXM00250.1|2825784_2827035_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	2.3e-20
AXM00251.1|2827152_2827815_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AXM00252.1|2827814_2828288_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXM00253.1|2828328_2829441_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
CP029246	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 chromosome, complete genome	4752717	3448970	3498832	4752717	tail,holin,lysis,terminase,integrase	Salmonella_phage(25.0%)	74	3448624:3448675	3498841:3498892
3448624:3448675	attL	TTTTAAATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
AXM00798.1|3448970_3450239_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	90.5	6.4e-228
AXM00799.1|3450659_3451022_+	GtrA family protein	NA	U5P0S6	Shigella_phage	84.2	2.0e-49
AXM00800.1|3451018_3451951_+	glycosyltransferase	NA	U5P087	Shigella_phage	92.1	8.5e-161
AXM00801.1|3451960_3453463_+	hypothetical protein	NA	Q8LTG0	Salmonella_phage	26.6	9.5e-37
AXM00802.1|3453508_3455713_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	61.4	1.1e-38
AXM00803.1|3455770_3458248_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.2	0.0e+00
AXM00804.1|3458234_3458600_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	90.8	1.6e-62
AXM00805.1|3458613_3459084_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
AXM00806.1|3459083_3459581_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.9	1.9e-87
AXM00807.1|3459622_3459850_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02094.1|3459860_3463364_-	hypothetical protein	NA	R9TMK1	Aeromonas_phage	51.7	1.7e-209
AXM00808.1|3463425_3464109_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	62.3	1.2e-79
AXM00809.1|3464167_3464929_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	69.0	2.4e-73
AXM00810.1|3464985_3465369_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	57.5	1.3e-38
AXM00811.1|3465408_3465951_-	HNH endonuclease	NA	Q7Y5F9	Xanthomonas_virus	43.7	1.9e-32
AXM00812.1|3466053_3466422_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	63.9	8.8e-37
AXM00813.1|3466424_3466781_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	56.4	2.7e-27
AXM00814.1|3466932_3467103_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	50.0	2.2e-11
AXM02095.1|3467102_3467504_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	78.2	4.6e-55
AXM00815.1|3467547_3468096_-	HNH endonuclease	NA	A0A2D2W633	Pectobacterium_phage	35.9	1.3e-20
AXM00816.1|3468188_3468482_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	88.7	8.5e-43
AXM00817.1|3468491_3469568_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.9	5.9e-190
AXM00818.1|3469586_3470036_-	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.9	3.2e-65
AXM00819.1|3470048_3471314_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	91.9	2.0e-221
AXM00820.1|3471316_3473050_-	hypothetical protein	NA	G0ZND6	Cronobacter_phage	67.6	1.3e-218
AXM00821.1|3473009_3474359_-	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	87.3	1.1e-230
AXM00822.1|3474724_3475978_-|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	97.3	5.2e-214
AXM00823.1|3475974_3476430_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	81.3	4.0e-63
AXM00824.1|3476460_3477099_-	hypothetical protein	NA	I6S676	Salmonella_phage	92.5	1.8e-114
AXM00825.1|3477102_3477303_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00826.1|3477306_3477525_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00827.1|3477874_3478561_-	hypothetical protein	NA	A0A192Y918	Salmonella_phage	99.1	1.8e-123
AXM00828.1|3478758_3479232_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	54.1	1.6e-38
AXM00829.1|3479228_3479669_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	81.9	4.2e-62
AXM00830.1|3479655_3479973_-|holin	holin	holin	E7C9S8	Salmonella_phage	86.7	8.9e-46
AXM00831.1|3480098_3480332_+	hypothetical protein	NA	NA	NA	NA	NA
AXM00832.1|3480465_3481155_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	1.4e-56
AXM00833.1|3481154_3481292_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.0	1.9e-05
AXM00834.1|3481288_3481900_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	69.0	3.7e-40
AXM00835.1|3481892_3482561_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	95.5	1.3e-126
AXM00836.1|3482557_3482728_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	85.7	1.0e-19
AXM00837.1|3482720_3483170_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.2	2.5e-33
AXM00838.1|3483389_3483683_-	DUF4752 domain-containing protein	NA	K7PHN1	Enterobacterial_phage	43.5	7.0e-21
AXM00839.1|3483682_3484300_-	hypothetical protein	NA	G8C7V0	Escherichia_phage	68.3	1.9e-55
AXM00840.1|3484296_3484482_-	hypothetical protein	NA	K7P7P5	Enterobacteria_phage	91.8	1.6e-26
AXM00841.1|3484478_3484823_-	hypothetical protein	NA	K7P7C5	Enterobacteria_phage	56.8	2.8e-21
AXM00842.1|3484819_3485116_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	63.0	7.1e-29
AXM00843.1|3485112_3485427_-	protein ren	NA	O48423	Enterobacteria_phage	54.7	2.1e-18
AXM00844.1|3485416_3486790_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	63.8	5.8e-166
AXM00845.1|3486786_3487872_-	DNA replication protein	NA	E5AGE9	Erwinia_phage	45.4	1.5e-84
AXM00846.1|3488100_3488667_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00847.1|3488696_3488948_-	transcriptional regulator	NA	G8C7U2	Escherichia_phage	54.7	9.0e-17
AXM00848.1|3489075_3489768_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	53.3	1.1e-59
AXM00849.1|3489781_3490156_-	hypothetical protein	NA	NA	NA	NA	NA
AXM00850.1|3490581_3490923_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	98.2	3.0e-55
AXM00851.1|3491016_3491268_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02096.1|3491477_3491672_+	hypothetical protein	NA	NA	NA	NA	NA
AXM00852.1|3491823_3492033_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	2.0e-33
AXM00853.1|3492104_3492389_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	91.5	8.0e-46
AXM00854.1|3492398_3493313_+	DNA recombinase	NA	G8C7T0	Escherichia_phage	100.0	6.1e-172
AXM00855.1|3493309_3493792_+	hypothetical protein	NA	G8C7S9	Escherichia_phage	99.4	8.4e-80
AXM00856.1|3493800_3494229_+	regulator	NA	M9NYX4	Enterobacteria_phage	94.4	4.9e-71
AXM00857.1|3494225_3494378_+	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	44.2	2.1e-05
AXM00858.1|3494374_3495034_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	93.2	1.2e-121
AXM00859.1|3495030_3495249_+	hypothetical protein	NA	NA	NA	NA	NA
AXM00860.1|3495245_3495542_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	66.7	1.4e-29
AXM00861.1|3495538_3495730_+	DUF1382 domain-containing protein	NA	A0A0P0ZC60	Stx2-converting_phage	66.1	2.4e-14
AXM00862.1|3495726_3496086_+	DUF2591 domain-containing protein	NA	J7I4M3	Pseudomonas_phage	36.1	6.2e-11
AXM00863.1|3496186_3496402_+	hypothetical protein	NA	M1FQT7	Enterobacteria_phage	61.4	1.3e-16
AXM00864.1|3496401_3496797_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	38.8	3.4e-10
AXM00865.1|3496774_3497014_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	70.5	3.5e-26
AXM00866.1|3497023_3497350_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	81.9	5.0e-44
AXM02097.1|3497456_3497792_+	DNA-binding protein	NA	NA	NA	NA	NA
AXM02098.1|3497788_3498832_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	99.1	5.3e-204
3498841:3498892	attR	TTTTAAATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 1
CP029248	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence	354256	1126	63730	354256	transposase	Leptospira_phage(50.0%)	50	NA	NA
AXM02266.1|1126_2247_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AXM02267.1|2478_2727_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02268.1|3249_3603_+	pili assembly chaperone	NA	NA	NA	NA	NA
AXM02269.1|3620_3971_+	plasmid transfer protein	NA	NA	NA	NA	NA
AXM02270.1|3982_4771_+	pilus assembly protein	NA	NA	NA	NA	NA
AXM02271.1|4770_6042_+	TrhK	NA	NA	NA	NA	NA
AXM02272.1|6179_7388_+|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AXM02273.1|7381_7843_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02274.1|7832_9188_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AXM02597.1|9255_9678_+	transcriptional regulator	NA	NA	NA	NA	NA
AXM02596.1|9715_10549_+	DsbC family protein	NA	NA	NA	NA	NA
AXM02275.1|10558_11509_+	TrhV	NA	NA	NA	NA	NA
AXM02276.1|11517_14199_+	conjugal transfer protein	NA	NA	NA	NA	NA
AXM02277.1|18037_19291_+	ParA family protein	NA	NA	NA	NA	NA
AXM02278.1|19287_20292_+	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	33.8	2.7e-11
AXM02279.1|20353_20743_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02280.1|20739_21261_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02281.1|21253_22090_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02282.1|23026_24146_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AXM02283.1|25848_26403_-	plasmid transfer protein	NA	NA	NA	NA	NA
AXM02284.1|26411_26837_-	htdF	NA	NA	NA	NA	NA
AXM02285.1|26826_27279_-	transfer repressor	NA	NA	NA	NA	NA
AXM02286.1|27767_28691_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	8.4e-177
AXM02287.1|28747_29386_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02288.1|29397_30435_-	stbA family protein	NA	A0A0A7NPX4	Enterobacteria_phage	35.0	3.6e-43
AXM02289.1|30910_32031_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AXM02290.1|35135_35648_+	signal peptidase I	NA	NA	NA	NA	NA
AXM02598.1|35928_37146_+	conjugal transfer protein	NA	NA	NA	NA	NA
AXM02599.1|37335_38346_+	plasmid transfer protein	NA	NA	NA	NA	NA
AXM02291.1|38364_41553_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AXM02292.1|41581_42454_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02293.1|42633_44418_+	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	23.1	6.0e-22
AXM02294.1|44812_45685_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02295.1|45742_46120_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02296.1|46180_47158_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02297.1|47215_48274_+	ATP-binding protein	NA	NA	NA	NA	NA
AXM02298.1|48642_49770_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
AXM02299.1|49846_51853_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AXM02300.1|51925_52147_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02301.1|52260_53493_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02302.1|53762_54284_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02303.1|54362_55241_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02304.1|55310_56246_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02305.1|56314_57235_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02306.1|57301_58240_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02307.1|58411_59368_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02308.1|59631_59907_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02309.1|60352_61473_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AXM02310.1|61774_62032_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02311.1|62610_63730_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 2
CP029248	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence	354256	90192	122643	354256	transposase,integrase	Salmonella_phage(18.18%)	35	94072:94131	115794:117159
AXM02340.1|90192_91401_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
AXM02341.1|91823_92015_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02342.1|92106_92448_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02343.1|93434_93689_+	hypothetical protein	NA	NA	NA	NA	NA
94072:94131	attL	GGGGTCGTCTCAGAAAACGGAATCTATGGTCACTCCCGTTTTTGCAACACCGATTTTGAC	NA	NA	NA	NA
AXM02344.1|94348_95353_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXM02345.1|95431_98398_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
AXM02346.1|98664_98922_-	DDE domain-containing protein	NA	A0A077SL39	Escherichia_phage	61.9	8.9e-12
AXM02347.1|98985_99750_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXM02348.1|99837_99951_+	NTP-binding protein	NA	NA	NA	NA	NA
AXM02349.1|100256_100757_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXM02350.1|100775_100955_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02351.1|100884_101724_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXM02352.1|101717_102065_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXM02353.1|102228_103020_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AXM02354.1|103125_103929_-	OXA-5 family class D beta-lactamase OXA-129	NA	NA	NA	NA	NA
AXM02355.1|104024_104522_-	trimethoprim-resistant dihydrofolate reductase DfrA21	NA	A0A076GDN3	Bacillus_phage	36.2	4.9e-22
AXM02356.1|104666_105704_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	43.4	7.7e-62
AXM02357.1|105675_106512_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXM02358.1|106511_107315_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AXM02359.1|107380_107995_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
AXM02360.1|108120_111006_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.4e-190
AXM02361.1|111113_111293_-	transcriptional regulator	NA	NA	NA	NA	NA
AXM02362.1|111461_111752_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AXM02363.1|111748_112150_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AXM02364.1|112139_112496_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXM02365.1|112750_113077_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02366.1|113073_113574_+|transposase	transposase	transposase	NA	NA	NA	NA
AXM02367.1|113570_113942_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02368.1|113935_114493_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AXM02369.1|114571_115576_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXM02370.1|117514_118501_-	hypothetical protein	NA	NA	NA	NA	NA
115794:117159	attR	GTCAAAATCGGTGTTGCAAAAACGGGAGTGACCATAGATTCCGTTTTCTGAGACGACCCCGATCAGTATTACGTTATCCCACTCCAGCCCCTTGGAACCATGCAGTGTGGAAAGGATGAAGGGATCGCAGTCAGTAGCAGCCTCGCCTGGATTCAAGATAAGGTTTAAAAACGTGCGGGAATCGATCTTACTGGAGTCAAGTAGCTCCCCGATCCTCACGACCCCTCGTTGCTGGTCGTTCGATCCAGTGCGAGTTACACCCTCAGAGCCAACACTATCAATGAAACCCTCCATACTCAGGCGTCGTAACACATCGATAGCAGGCGTTTCCTCTCCGTCTTTCTGGCAGATAGTGGCGAGCCTGCCCAGCCGATCTTTTTGGTATTGTGCGCCCTCGAATAACTGACCTAGAGCAGACCATAGGTCGGCGTGCGGAGCCATCAATCCACTGAGCGCCGCTTTGAATTGCCCTTTCTGCCATCTAAAACCAGCCTCCTTCAGAAAGCCGTAAACAATCGCTTGTTTGTTGGGATGGTTTTCCAGTAGCCGCAGATCGCCGTACACAGACAGCAAGACGCCAACTACCAGTATCCCGATTTCGGTGCGGGTGTGTAATGCGCTTGAACCATTGAGGTAGCGATAAGGTAGCCCACACAGGCGTAAAGCAATTTCCGCCTCAGCAAGGTTCGCCTTAGTGCGGGACAATATGGCTTGTGTTCCACTGCTCACCGAGAGGTTTGATAGCACCTTGGATAGGCAGTTATCAAAGTGCAATCTGACCTCTGTTTTGGGGGTGCTAGGATGACTGACACAAAGCTTGGTCAGCTTTGTAGAGTTGCGCCGAATTACCGAGTTAGCCATCAAGGAAAGCTCATGGCCAAATCTGAACGTGCATGACAGTTGAAACACCTTCGTATTCGGGTAGTGCCTTTCAAACAGTCCGCCGATAAAGTCTGGTCGAGCACCACGCCACTCATAAATACACTGGTTAACATCACCAACAGCCATAACCGACGTATCCGACTTAGATAGCAAGCGGGTCATGTCATGCTGTATCAGGTTAACGTCCTGATATTCATCAACAATGATGTGCTTGAAGTGGGCACCAAGGCTGCTGTCATTACGCAACAGTGCGACAGCCTCAATCAAACAGTCATCAAAGGTTCGCAGACTGTTTTCCTCCAGCAGCTCACAATAGCGGCCATAGGCGTGAATAAACTCCCGTTTGATGTTGCTGAACGTTGGATCATTGGCAGCATCAACAGGAGTTACGGCCGCCGCCCGGCAGCGAGCAATAAACAGCTCGAAGTTTTCAATTTCATTGGGGTCAATATAATTCGCCTCATGGTCAAAGCCATAGCGGTAG	NA	NA	NA	NA
AXM02371.1|119421_119814_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02372.1|119792_120104_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02373.1|120472_121129_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02374.1|121434_122643_+|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 3
CP029248	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence	354256	180138	288524	354256	transposase,integrase,protease	uncultured_Caudovirales_phage(30.77%)	108	221232:221247	277932:277947
AXM02427.1|180138_181258_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AXM02428.1|183439_183820_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02429.1|184158_184362_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02430.1|184351_184642_-	korC	NA	NA	NA	NA	NA
AXM02431.1|184638_185676_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02432.1|185951_186215_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02433.1|186211_186778_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02434.1|188633_188798_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02435.1|188855_189224_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02436.1|189907_191275_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXM02437.1|191250_191919_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXM02438.1|192004_192781_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02439.1|192931_193078_+	phosphoribulokinase	NA	NA	NA	NA	NA
AXM02440.1|194444_195149_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXM02441.1|195314_195791_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AXM02442.1|195867_197487_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AXM02443.1|197675_198599_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
AXM02444.1|198682_200029_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
AXM02445.1|200246_200681_+	copper-binding protein	NA	NA	NA	NA	NA
AXM02446.1|200938_202054_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AXM02447.1|202176_202449_+	transcriptional repressor RcnR	NA	NA	NA	NA	NA
AXM02448.1|202914_203733_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AXM02449.1|203729_204935_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AXM02450.1|204998_205202_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02451.1|205214_206534_-	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
AXM02452.1|206784_208212_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
AXM02453.1|208426_208942_+	nuclease	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
AXM02454.1|208944_209841_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02455.1|209888_210203_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02456.1|210276_210534_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02457.1|210592_210826_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02458.1|210871_211126_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02459.1|211163_211451_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02604.1|211520_211718_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02460.1|211858_212134_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02461.1|212625_214104_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
AXM02462.1|214122_214950_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
AXM02463.1|215009_215435_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
AXM02464.1|215447_216737_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
AXM02465.1|216782_217103_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
AXM02466.1|217189_217894_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
AXM02467.1|217926_219330_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXM02468.1|219521_219839_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02469.1|219861_220167_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02470.1|220211_220883_+|protease	serine protease	protease	NA	NA	NA	NA
221232:221247	attL	AGAAAAGTTACTTTTC	NA	NA	NA	NA
AXM02471.1|221340_221748_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02472.1|221798_222116_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02473.1|222114_222243_+	ABC transporter	NA	NA	NA	NA	NA
AXM02474.1|222281_223196_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.4	3.6e-172
AXM02475.1|223692_224184_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02476.1|224742_226458_-|integrase	integrase	integrase	NA	NA	NA	NA
AXM02477.1|226567_229597_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
AXM02478.1|229703_230729_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AXM02479.1|230725_231505_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AXM02480.1|231891_232773_+	carbapenem-hydrolyzing class A beta-lactamase KPC-4	NA	A0A1B0VBP7	Salmonella_phage	52.5	1.1e-74
AXM02481.1|233022_234342_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AXM02482.1|235359_238695_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02483.1|238917_239271_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02484.1|239424_239979_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02485.1|241003_241438_+	peptidase	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
AXM02486.1|241421_242681_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.5	1.5e-96
AXM02487.1|242726_243536_-	DsbA family protein	NA	NA	NA	NA	NA
AXM02488.1|243642_244254_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02605.1|244313_244574_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02489.1|244769_245162_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02490.1|245186_245936_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXM02491.1|246083_246623_+	lytic transglycosylase	NA	NA	NA	NA	NA
AXM02492.1|246705_247263_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02493.1|247386_248448_+	HNH endonuclease	NA	NA	NA	NA	NA
AXM02494.1|248457_248964_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02495.1|249031_250240_-|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AXM02496.1|250424_254375_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AXM02497.1|254383_255799_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXM02498.1|255788_256835_-	thioredoxin family protein	NA	NA	NA	NA	NA
AXM02499.1|257426_257939_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02500.1|257940_258741_-	trhR	NA	NA	NA	NA	NA
AXM02501.1|259500_259986_+	plasmid transfer protein	NA	NA	NA	NA	NA
AXM02502.1|259982_260720_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02503.1|260729_263876_+	helicase	NA	NA	NA	NA	NA
AXM02504.1|263875_265960_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02505.1|265959_267069_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02506.1|267055_267718_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
AXM02507.1|267728_268910_+	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	7.5e-13
AXM02606.1|269442_270649_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	2.6e-101
AXM02508.1|271270_271624_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02509.1|271689_271974_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02510.1|272330_272630_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02511.1|273062_273431_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02512.1|273652_274189_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02513.1|274256_274694_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02514.1|274738_275035_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02515.1|275169_275871_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02516.1|276185_276467_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02517.1|276532_277717_-	DNA-binding protein	NA	NA	NA	NA	NA
AXM02518.1|278133_278328_-	hypothetical protein	NA	NA	NA	NA	NA
277932:277947	attR	AGAAAAGTTACTTTTC	NA	NA	NA	NA
AXM02519.1|278820_279765_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02520.1|279860_280463_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
AXM02521.1|280522_280873_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02522.1|280919_281123_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02523.1|281404_281725_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02524.1|282333_282492_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AXM02525.1|282563_282851_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AXM02526.1|282850_283090_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AXM02527.1|283114_283309_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02528.1|283352_284276_-	cation transporter	NA	NA	NA	NA	NA
AXM02607.1|284475_285048_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
AXM02529.1|285523_286762_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
AXM02530.1|287183_288524_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP029247	Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence	108404	0	107660	108404	tail,integrase,terminase,capsid,protease	Salmonella_phage(94.74%)	127	1058:1080	108283:108305
AXM02138.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
1058:1080	attL	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
AXM02139.1|1624_1837_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
AXM02140.1|1836_2172_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	98.2	2.0e-56
AXM02141.1|2168_2348_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	96.6	1.6e-20
AXM02258.1|2388_2664_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	2.7e-46
AXM02259.1|2732_3143_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	1.1e-75
AXM02142.1|3658_4489_-|protease	serine protease	protease	J9Q7Z4	Salmonella_phage	99.3	1.1e-127
AXM02143.1|4492_4693_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	93.9	9.3e-25
AXM02144.1|4784_5861_-	recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AXM02145.1|5863_6130_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AXM02146.1|6129_7074_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.7	4.0e-182
AXM02147.1|7134_8163_-	regulator	NA	J9Q7Z3	Salmonella_phage	99.7	1.3e-165
AXM02148.1|8282_8756_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	99.3	1.3e-72
AXM02149.1|8934_9186_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02150.1|9258_9822_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	66.1	9.0e-65
AXM02151.1|9851_10295_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.8e-72
AXM02152.1|10291_13810_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.7	0.0e+00
AXM02153.1|13784_13988_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	98.5	1.2e-32
AXM02154.1|13990_15226_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.8	6.0e-239
AXM02155.1|15322_17731_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	92.1	0.0e+00
AXM02156.1|17840_18053_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02157.1|18316_18703_+	transcriptional regulator	NA	NA	NA	NA	NA
AXM02158.1|18694_19801_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	32.6	5.6e-26
AXM02159.1|19972_20389_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02160.1|20379_20904_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02161.1|21000_21246_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	43.6	2.9e-12
AXM02162.1|21245_21611_-	hypothetical protein	NA	K7PH35	Enterobacteria_phage	65.6	1.5e-36
AXM02163.1|21626_21830_-	hypothetical protein	NA	A0A0B6VT64	Edwardsiella_phage	49.2	4.4e-06
AXM02164.1|21840_22674_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.1	7.0e-90
AXM02165.1|22821_24054_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02166.1|25059_25365_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	98.0	1.2e-47
AXM02167.1|25361_25514_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	100.0	4.0e-20
AXM02260.1|25513_25720_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	100.0	2.8e-32
AXM02168.1|25709_25886_-	hypothetical protein	NA	J9Q729	Salmonella_phage	93.1	1.3e-22
AXM02169.1|25885_27208_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.3	2.8e-258
AXM02261.1|27242_27500_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	96.5	1.2e-35
AXM02262.1|27410_27752_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02170.1|27800_28595_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	76.5	2.1e-112
AXM02171.1|28781_30035_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AXM02172.1|30026_31238_-	DNA primase	NA	J9Q720	Salmonella_phage	93.8	3.7e-209
AXM02173.1|31300_32641_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	99.3	1.5e-246
AXM02174.1|32701_33427_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	97.9	2.7e-138
AXM02175.1|33691_34489_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	26.4	7.3e-12
AXM02176.1|34529_34889_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AXM02177.1|34888_35554_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	95.0	4.7e-113
AXM02178.1|35882_36152_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AXM02179.1|36155_36680_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXM02180.1|36706_37048_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	80.6	6.9e-28
AXM02181.1|37116_37809_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	96.1	3.9e-126
AXM02182.1|37822_38146_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	8.0e-50
AXM02183.1|39366_39798_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	53.8	1.5e-16
AXM02184.1|48670_49261_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	91.8	9.0e-100
AXM02185.1|49248_50046_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	95.1	3.5e-155
AXM02186.1|50038_50770_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	3.9e-137
AXM02187.1|50826_51162_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	99.1	5.2e-60
AXM02188.1|51203_55787_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	91.2	0.0e+00
AXM02189.1|55794_56064_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AXM02190.1|56144_56462_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	97.1	1.7e-49
AXM02191.1|56521_57268_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	98.4	6.8e-129
AXM02192.1|57342_57726_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AXM02193.1|57727_58201_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AXM02194.1|58191_58536_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AXM02195.1|58633_59467_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	1.3e-152
AXM02196.1|59466_59901_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	8.1e-74
AXM02197.1|59944_60868_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	99.7	9.6e-157
AXM02198.1|60942_61818_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	99.7	8.5e-163
AXM02199.1|61844_62738_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	91.6	3.3e-138
AXM02200.1|62760_64335_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	98.9	3.5e-300
AXM02201.1|64368_65625_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
AXM02202.1|65627_66269_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	98.1	3.4e-108
AXM02203.1|66464_66731_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AXM02204.1|66740_67640_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	8.2e-169
AXM02205.1|67636_67891_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AXM02206.1|67883_68522_-	adenylyl-sulfate kinase	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
AXM02207.1|68518_69187_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	99.1	4.3e-114
AXM02208.1|69186_69885_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	99.1	2.5e-125
AXM02209.1|69949_71509_+	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	99.4	9.8e-295
AXM02210.1|71511_71790_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	1.3e-40
AXM02211.1|71855_72380_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02212.1|72423_73224_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	39.0	9.3e-07
AXM02213.1|73338_73851_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	68.2	3.1e-56
AXM02214.1|74168_74819_+	hypothetical protein	NA	J9Q754	Salmonella_phage	98.6	3.5e-113
AXM02215.1|74869_75073_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	97.0	8.3e-29
AXM02216.1|75714_76197_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	7.1e-87
AXM02217.1|76209_76443_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02263.1|76402_76690_-	ABC transporter	NA	J9Q753	Salmonella_phage	97.8	6.6e-48
AXM02218.1|76810_77206_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	66.2	1.2e-42
AXM02219.1|77334_77646_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	96.1	7.9e-47
AXM02220.1|77786_78005_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AXM02221.1|78009_78231_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	98.6	1.4e-34
AXM02222.1|79870_80176_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02264.1|80213_80531_-	hypothetical protein	NA	J9Q750	Salmonella_phage	83.8	3.9e-49
AXM02223.1|80530_80767_-	DUF1380 domain-containing protein	NA	J9Q7H8	Salmonella_phage	97.4	1.6e-39
AXM02224.1|80852_81119_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	3.1e-31
AXM02225.1|81305_81509_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	97.0	6.8e-31
AXM02226.1|81564_82263_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	91.8	2.0e-114
AXM02227.1|82301_82853_-	hypothetical protein	NA	J9Q748	Salmonella_phage	92.3	2.3e-97
AXM02228.1|82849_83491_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	99.1	1.4e-114
AXM02229.1|83582_83954_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	99.2	7.2e-63
AXM02230.1|83956_84238_-	hypothetical protein	NA	J9Q801	Salmonella_phage	97.8	3.6e-46
AXM02231.1|84234_84924_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	87.7	5.2e-107
AXM02232.1|84981_86685_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	99.3	0.0e+00
AXM02233.1|86808_87381_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AXM02234.1|87489_88332_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AXM02235.1|88440_88629_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AXM02236.1|88638_89133_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	98.2	2.1e-81
AXM02237.1|89275_89884_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AXM02238.1|90479_90710_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AXM02239.1|90913_91507_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	98.5	1.9e-110
AXM02240.1|91692_92619_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	92.9	3.7e-108
AXM02241.1|92663_93221_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AXM02242.1|93230_93650_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
AXM02243.1|93713_94358_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AXM02244.1|94357_94834_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AXM02245.1|94830_95244_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AXM02246.1|95245_96361_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.9	2.4e-218
AXM02247.1|96538_97408_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	98.3	3.9e-160
AXM02248.1|97490_98633_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
AXM02249.1|98740_101056_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AXM02250.1|101133_101703_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
AXM02251.1|101714_102461_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.4	3.4e-136
AXM02252.1|102450_104367_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AXM02253.1|104363_104600_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AXM02254.1|104596_105682_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	98.6	5.9e-206
AXM02255.1|105910_106414_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	98.2	5.5e-90
AXM02256.1|106445_106940_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	98.2	7.8e-89
AXM02257.1|107015_107660_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.6	6.3e-123
108283:108305	attR	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
