The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031282	Escherichia fergusonii strain 40A chromosome, complete genome	4515966	308087	474573	4515966	tRNA,protease,plate,lysis,integrase,transposase,tail	Enterobacteria_phage(46.67%)	93	308028:308075	470725:470745
308028:308075	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATC	NA	NA	NA	NA
AXM02750.1|308087_309248_-|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	100.0	1.2e-228
308028:308075	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATC	NA	NA	NA	NA
AXM02751.1|309540_309819_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AXM02752.1|311116_311335_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	2.2e-35
AXM02753.1|311433_311715_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AXM02754.1|311725_312283_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	61.7	7.8e-61
AXM02755.1|312432_313113_-	exonuclease	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
AXM02756.1|313109_313895_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AXM04511.1|314270_314477_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	83.8	3.5e-27
AXM02757.1|314794_314983_-	hypothetical protein	NA	NA	NA	NA	NA
AXM04512.1|316495_317188_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
AXM02758.1|317298_317526_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
AXM02759.1|317556_318096_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
AXM02760.1|318092_319136_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.7	6.5e-109
AXM02761.1|319107_319809_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.9	1.6e-127
AXM02762.1|322220_322322_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02763.1|322318_322774_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	2.7e-59
AXM02764.1|322773_322944_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	63.6	1.8e-13
AXM02765.1|322936_323227_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	6.7e-48
AXM02766.1|323223_323586_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	3.3e-60
AXM02767.1|323807_324185_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
AXM02768.1|325055_326015_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AXM02769.1|326364_326499_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXM02770.1|326507_327095_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXM02771.1|327409_327688_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	97.8	5.6e-44
AXM02772.1|327684_328032_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AXM02773.1|329729_329945_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
AXM02774.1|329944_330442_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.2e-89
AXM02775.1|330658_330841_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	67.8	1.5e-13
AXM02776.1|330931_331225_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AXM04513.1|331814_332321_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	64.6	6.9e-48
AXM02777.1|334435_334651_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02778.1|338267_338597_+	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	40.7	3.6e-13
AXM02779.1|342278_342785_+|tail	phage tail protein	tail	A0A1B2LRS4	Wolbachia_phage	30.9	3.6e-12
AXM02780.1|342843_343143_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXM02781.1|343244_344036_+	hypothetical protein	NA	R9TRP8	Vibrio_phage	35.7	2.0e-22
AXM02782.1|344073_344373_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	44.8	2.5e-05
AXM02783.1|344418_344709_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02784.1|344820_345147_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02785.1|345587_345803_+|tail	phage tail protein	tail	R9TR63	Vibrio_phage	47.1	2.2e-11
AXM02786.1|346961_347315_+|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	5.9e-22
AXM02787.1|350453_351038_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.5	3.0e-71
AXM04514.1|351448_351631_-	hypothetical protein	NA	NA	NA	NA	NA
351480:351527	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATC	NA	NA	NA	NA
AXM02788.1|351689_352859_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	62.4	9.7e-146
351480:351527	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATC	NA	NA	NA	NA
AXM02789.1|356384_356957_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	99.5	1.8e-97
AXM02790.1|356971_357217_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	100.0	1.8e-41
AXM04515.1|358545_358827_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	3.1e-34
AXM02791.1|359341_359629_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AXM02792.1|359621_360068_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.0	2.0e-59
AXM02793.1|362916_363663_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
AXM02794.1|365671_365842_+|integrase	attP region and P4int integrase	integrase	NA	NA	NA	NA
AXM02795.1|366349_366451_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02796.1|367536_368765_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
AXM02797.1|369245_370235_-	aldo/keto reductase	NA	NA	NA	NA	NA
AXM02798.1|370261_371113_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.9	1.2e-47
AXM02799.1|371392_371872_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXM02800.1|373016_374108_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXM02801.1|374408_374759_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02802.1|379300_379972_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
AXM02803.1|381590_382223_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02804.1|385537_386707_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
AXM02805.1|394768_394948_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02806.1|399860_402869_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AXM02807.1|402956_403580_+	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
AXM02808.1|405275_406463_+	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
AXM04516.1|408370_409450_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AXM02809.1|415526_415718_+	hypothetical protein	NA	NA	NA	NA	NA
AXM02810.1|416709_416994_+	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
AXM02811.1|418067_418982_+	fructokinase	NA	NA	NA	NA	NA
AXM02812.1|424389_425193_+	two-component system sensor histidine kinase PhoR	NA	NA	NA	NA	NA
AXM02813.1|425877_426078_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02814.1|430805_431387_-	ACP phosphodiesterase	NA	NA	NA	NA	NA
AXM02815.1|432597_433725_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	6.1e-89
AXM04517.1|433747_434080_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AXM02816.1|439315_439765_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AXM02817.1|441442_441862_+	N utilization substance protein B	NA	NA	NA	NA	NA
AXM02818.1|441937_442915_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AXM02819.1|442892_443411_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AXM02820.1|447270_447513_-	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AXM02821.1|447718_449167_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AXM02822.1|449772_450684_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AXM02823.1|450851_451343_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
AXM02824.1|456942_457263_-	NIPSNAP family protein	NA	NA	NA	NA	NA
AXM02825.1|460726_462265_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AXM02826.1|462515_463406_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AXM02827.1|463417_463747_-	cytochrome bo(3) ubiquinol oxidase subunit 4	NA	NA	NA	NA	NA
AXM02828.1|463746_464361_-	cytochrome bo(3) ubiquinol oxidase subunit 3	NA	NA	NA	NA	NA
AXM02829.1|466361_467309_-	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AXM02830.1|467951_469427_-	muropeptide MFS transporter AmpG	NA	NA	NA	NA	NA
AXM02831.1|469470_470016_-	hypothetical protein	NA	NA	NA	NA	NA
AXM02832.1|470349_470667_+	transcriptional regulator BolA	NA	NA	NA	NA	NA
AXM02833.1|471007_472306_+	trigger factor	NA	NA	NA	NA	NA
AXM02834.1|472549_473173_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AXM02835.1|473298_474573_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.6	6.6e-132
>prophage 2
CP031282	Escherichia fergusonii strain 40A chromosome, complete genome	4515966	1861369	1870711	4515966	transposase,head	Salmonella_phage(28.57%)	8	NA	NA
AXM03371.1|1861369_1862770_-	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	64.7	3.8e-149
AXM03372.1|1862782_1863436_-	DNA transfer protein	NA	Q716G4	Shigella_phage	70.5	5.7e-55
AXM03373.1|1863410_1863890_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.1	1.4e-63
AXM03374.1|1864735_1866154_-	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	98.7	1.1e-273
AXM03375.1|1866163_1866625_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	98.7	6.0e-83
AXM03376.1|1868105_1868999_-	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	98.3	4.8e-129
AXM04562.1|1869389_1869596_+	hypothetical protein	NA	NA	NA	NA	NA
AXM03377.1|1869564_1870711_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	97.6	1.1e-175
>prophage 3
CP031282	Escherichia fergusonii strain 40A chromosome, complete genome	4515966	3020983	3082644	4515966	tRNA,terminase,protease,transposase,tail	Enterobacteria_phage(55.0%)	37	NA	NA
AXM03816.1|3020983_3021670_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AXM03817.1|3022067_3022208_-	hypothetical protein	NA	NA	NA	NA	NA
AXM03818.1|3022303_3023020_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.3	8.0e-26
AXM03819.1|3027305_3028175_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
AXM03820.1|3029376_3029703_-	trp operon repressor	NA	NA	NA	NA	NA
AXM04599.1|3031835_3031964_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AXM03821.1|3033658_3033943_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXM03822.1|3033944_3034298_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AXM04600.1|3035617_3037000_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AXM03823.1|3038119_3038764_+	protein Smp	NA	NA	NA	NA	NA
AXM03824.1|3039838_3040102_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXM03825.1|3043710_3044490_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
AXM04601.1|3048036_3049140_-	patatin family protein	NA	NA	NA	NA	NA
AXM03826.1|3049230_3049410_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AXM03827.1|3049518_3050124_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AXM03828.1|3052321_3052570_+	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
AXM03829.1|3053177_3053411_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
AXM03830.1|3062095_3062743_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.1e-111
AXM03831.1|3062640_3063384_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	2.2e-151
AXM03832.1|3063389_3064088_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	3.0e-134
AXM03833.1|3064132_3064426_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	3.5e-52
AXM03834.1|3067455_3067785_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AXM04602.1|3068993_3069395_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
AXM03835.1|3069980_3070256_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AXM03836.1|3070248_3070617_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
AXM03837.1|3070658_3072782_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
AXM03838.1|3074136_3074349_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AXM03839.1|3074345_3076304_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.8	0.0e+00
AXM03840.1|3076926_3077205_-	hypothetical protein	NA	NA	NA	NA	NA
AXM03841.1|3077489_3077639_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.8	2.4e-17
AXM04603.1|3078334_3078490_-	hypothetical protein	NA	NA	NA	NA	NA
AXM03842.1|3078605_3079879_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AXM04604.1|3079974_3080163_-	cold-shock protein	NA	NA	NA	NA	NA
AXM03843.1|3080746_3081244_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	30.8	2.2e-06
AXM04605.1|3081885_3082146_+	hypothetical protein	NA	NA	NA	NA	NA
AXM03844.1|3082093_3082429_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	48.6	3.6e-13
AXM03845.1|3082389_3082644_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	88.0	5.5e-30
>prophage 4
CP031282	Escherichia fergusonii strain 40A chromosome, complete genome	4515966	3086518	3095484	4515966		Shigella_phage(50.0%)	11	NA	NA
AXM03847.1|3086518_3087316_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	9.8e-150
AXM03848.1|3087719_3088046_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
AXM03849.1|3088687_3089188_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	5.7e-87
AXM03850.1|3090113_3090293_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AXM03851.1|3090468_3091020_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
AXM03852.1|3091063_3091264_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AXM03853.1|3091354_3092029_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
AXM03854.1|3092247_3092469_+	hypothetical protein	NA	NA	NA	NA	NA
AXM03855.1|3092440_3092875_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
AXM03856.1|3092793_3093138_-	hypothetical protein	NA	U5P0J5	Shigella_phage	97.4	1.1e-60
AXM03857.1|3095289_3095484_+	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	95.3	2.2e-31
>prophage 5
CP031282	Escherichia fergusonii strain 40A chromosome, complete genome	4515966	3374318	3414568	4515966	plate,tRNA,tail	Burkholderia_phage(54.55%)	29	NA	NA
AXM03995.1|3374318_3375314_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AXM03996.1|3376041_3376251_-	CsbD family protein	NA	NA	NA	NA	NA
AXM03997.1|3376382_3377708_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
AXM03998.1|3377780_3378389_-	repressor LexA	NA	U5P451	Shigella_phage	43.3	3.6e-11
AXM03999.1|3378498_3378867_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AXM04000.1|3379037_3381458_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AXM04001.1|3381513_3382386_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AXM04002.1|3383053_3384004_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AXM04003.1|3384110_3385400_-	maltoporin LamB	NA	NA	NA	NA	NA
AXM04004.1|3387015_3388206_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AXM04005.1|3393329_3393608_+	hypothetical protein	NA	NA	NA	NA	NA
AXM04620.1|3393654_3395271_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AXM04006.1|3395249_3395750_-	hypothetical protein	NA	NA	NA	NA	NA
AXM04007.1|3396482_3397121_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AXM04008.1|3399772_3401122_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AXM04009.1|3401266_3402196_+	zeta toxin	NA	NA	NA	NA	NA
AXM04010.1|3402367_3402712_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	47.6	6.3e-21
AXM04011.1|3403249_3403537_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.0e-16
AXM04012.1|3403539_3404145_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	56.6	5.7e-57
AXM04013.1|3404157_3404472_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.2	7.1e-19
AXM04014.1|3405040_3405238_+	hypothetical protein	NA	NA	NA	NA	NA
AXM04015.1|3406650_3407175_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	7.3e-69
AXM04016.1|3407224_3407542_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXM04017.1|3407501_3407630_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXM04018.1|3407730_3410130_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	27.8	1.6e-54
AXM04019.1|3410104_3411058_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
AXM04020.1|3412302_3413004_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	32.8	5.1e-17
AXM04021.1|3413102_3413462_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.2e-34
AXM04022.1|3413452_3414568_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.7	2.0e-100
