The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027697	Klebsiella pneumoniae strain KP30835 chromosome, complete genome	5428613	983788	995437	5428613	integrase	Enterobacteria_phage(77.78%)	11	971926:971940	994974:994988
971926:971940	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
AXL23622.1|983788_986122_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
AXL23623.1|986133_986454_-	hypothetical protein	NA	NA	NA	NA	NA
AXL23624.1|986450_986678_-	hypothetical protein	NA	NA	NA	NA	NA
AXL23625.1|986674_987232_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AXL23626.1|987228_987495_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AXL23627.1|988036_988774_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
AXL23628.1|988770_989016_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AXL23629.1|989033_989600_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
AXL23630.1|991526_992717_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AXL23631.1|993069_994323_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AXL23632.1|994333_995437_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
994974:994988	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 2
CP027697	Klebsiella pneumoniae strain KP30835 chromosome, complete genome	5428613	1185719	1251309	5428613	integrase,tail,terminase,tRNA,lysis,transposase,head,protease,coat	Escherichia_phage(25.45%)	82	1207826:1207872	1258051:1258097
AXL23793.1|1185719_1186199_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AXL27364.1|1187326_1189828_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.6e-113
AXL23794.1|1189934_1190345_+	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AXL23795.1|1190341_1190800_-	NfeD family protein	NA	NA	NA	NA	NA
AXL23796.1|1190796_1191714_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AXL23797.1|1191854_1192532_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.5	7.8e-23
AXL23798.1|1192518_1193301_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AXL23799.1|1193408_1194263_-	co-chaperone YbbN	NA	NA	NA	NA	NA
AXL23800.1|1194321_1195092_-	oxidoreductase	NA	NA	NA	NA	NA
AXL23801.1|1195120_1195747_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
AXL23802.1|1195714_1196401_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
AXL23803.1|1196397_1198812_+	ABC transporter permease	NA	NA	NA	NA	NA
AXL23804.1|1198993_1200139_+	porin	NA	NA	NA	NA	NA
AXL23805.1|1200246_1201323_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AXL23806.1|1201433_1202501_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AXL23807.1|1202497_1203007_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AXL23808.1|1202939_1203107_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXL23809.1|1203103_1203412_-	hypothetical protein	NA	NA	NA	NA	NA
AXL23810.1|1203548_1204271_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AXL23811.1|1204274_1204769_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXL23812.1|1204943_1206329_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AXL23813.1|1206374_1206587_-	ribosome-associated protein	NA	NA	NA	NA	NA
AXL23814.1|1206588_1207455_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1207826:1207872	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
AXL23815.1|1207885_1209049_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
AXL23816.1|1208925_1209261_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXL23817.1|1209262_1209478_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
AXL23818.1|1209479_1209698_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
AXL23819.1|1209694_1210462_-	dcm methylase	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
AXL23820.1|1210458_1211115_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
AXL23821.1|1211111_1211270_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
AXL23822.1|1211266_1211947_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
AXL23823.1|1211943_1212789_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
AXL23824.1|1212804_1213089_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
AXL23825.1|1213177_1213372_-	hypothetical protein	NA	NA	NA	NA	NA
AXL23826.1|1213471_1213687_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
AXL23827.1|1214035_1214725_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
AXL23828.1|1214851_1215085_+	transcriptional regulator	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
AXL23829.1|1215125_1215347_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AXL23830.1|1215571_1216471_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
AXL23831.1|1216460_1217891_+	replicative DNA helicase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
AXL23832.1|1217890_1218184_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
AXL23833.1|1218792_1219635_+	addiction module toxin RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
AXL23834.1|1219807_1220455_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
AXL23835.1|1220454_1220703_+	hypothetical protein	NA	NA	NA	NA	NA
AXL23836.1|1220955_1221411_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
AXL23837.1|1221410_1221581_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
AXL23838.1|1221573_1222209_+	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
AXL23839.1|1222205_1222343_+	YlcG family protein	NA	NA	NA	NA	NA
AXL23840.1|1222335_1222866_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
AXL23841.1|1222862_1223552_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
AXL23842.1|1223779_1224826_+|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AXL23843.1|1225562_1225811_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AXL23844.1|1225813_1226344_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
AXL23845.1|1226340_1226805_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
AXL23846.1|1226910_1227240_-	hypothetical protein	NA	NA	NA	NA	NA
AXL23847.1|1227610_1228213_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
AXL23848.1|1228212_1229685_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
AXL23849.1|1229697_1231119_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
AXL23850.1|1231093_1232098_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
AXL23851.1|1232139_1232616_+	hypothetical protein	NA	NA	NA	NA	NA
AXL23852.1|1232688_1234074_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
AXL23853.1|1234077_1234506_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
AXL23854.1|1234517_1235612_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	62.8	1.7e-123
AXL23855.1|1235621_1235861_+	hypothetical protein	NA	NA	NA	NA	NA
AXL23856.1|1235863_1236244_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
AXL23857.1|1236243_1236417_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
AXL23858.1|1236416_1236779_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
AXL23859.1|1236781_1237207_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AXL23860.1|1237203_1237596_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
AXL23861.1|1237664_1238417_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
AXL23862.1|1238469_1239147_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
AXL23863.1|1239321_1240077_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
AXL23864.1|1240079_1240334_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
AXL23865.1|1240778_1241096_+	hypothetical protein	NA	NA	NA	NA	NA
AXL23866.1|1241112_1241472_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
AXL23867.1|1241571_1241742_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
AXL23868.1|1242509_1243295_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
AXL23869.1|1244017_1247464_+	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
AXL27365.1|1247563_1247983_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
AXL23870.1|1247982_1248453_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
AXL23871.1|1248449_1248845_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
AXL23872.1|1248831_1251309_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.6	2.7e-198
1258051:1258097	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 3
CP027697	Klebsiella pneumoniae strain KP30835 chromosome, complete genome	5428613	1696318	1777502	5428613	integrase,tail,capsid,tRNA,portal,plate,head,protease	Salmonella_phage(60.87%)	81	1696226:1696244	1733714:1733732
1696226:1696244	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
AXL24220.1|1696318_1697371_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
AXL24221.1|1697538_1697790_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24222.1|1697789_1699274_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AXL24223.1|1699372_1700317_-	hypothetical protein	NA	NA	NA	NA	NA
AXL24224.1|1701351_1701573_+	regulator	NA	NA	NA	NA	NA
AXL24225.1|1701605_1702115_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AXL27385.1|1702122_1702323_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AXL24226.1|1702286_1702628_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AXL24227.1|1702695_1702929_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AXL24228.1|1702928_1703156_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AXL24229.1|1706697_1707003_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AXL24230.1|1707117_1707795_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24231.1|1709871_1710897_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AXL24232.1|1710896_1712663_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	98.8	0.0e+00
AXL24233.1|1712805_1713639_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AXL24234.1|1713655_1714714_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AXL24235.1|1714717_1715368_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AXL24236.1|1715463_1715928_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AXL24237.1|1715927_1716131_+|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AXL24238.1|1716134_1716839_+	glycoside hydrolase	NA	E5G6N1	Salmonella_phage	83.4	2.9e-81
AXL24239.1|1716843_1717227_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AXL24240.1|1717223_1717652_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AXL24241.1|1717747_1718179_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AXL24242.1|1718171_1718618_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AXL24243.1|1718614_1719307_-	hypothetical protein	NA	NA	NA	NA	NA
AXL24244.1|1719401_1719974_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AXL24245.1|1719970_1720333_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
AXL24246.1|1720319_1721228_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AXL27386.1|1721220_1721820_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AXL24247.1|1724036_1724771_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24248.1|1724774_1725506_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24249.1|1725502_1725706_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24250.1|1725735_1726812_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AXL24251.1|1726950_1728123_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AXL24252.1|1728132_1728648_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AXL24253.1|1728700_1729000_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AXL24254.1|1729014_1729134_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AXL24255.1|1729126_1731754_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AXL24256.1|1731750_1732236_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AXL24257.1|1732232_1733333_+	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AXL24258.1|1733424_1733643_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AXL24259.1|1733861_1735547_-	transporter	NA	NA	NA	NA	NA
1733714:1733732	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
AXL24260.1|1735813_1736197_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24261.1|1736203_1736467_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AXL24262.1|1736669_1736957_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24263.1|1737778_1738681_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AXL24264.1|1738769_1739249_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AXL24265.1|1739597_1740710_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AXL27387.1|1740873_1742007_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AXL24266.1|1742017_1742971_+	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AXL24267.1|1742967_1743813_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AXL24268.1|1743870_1744359_+	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AXL24269.1|1744400_1745528_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AXL24270.1|1745605_1746322_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AXL24271.1|1746318_1747791_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AXL24272.1|1747833_1748565_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXL24273.1|1748748_1749417_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AXL24274.1|1749416_1750133_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AXL27388.1|1750139_1750871_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXL24275.1|1750891_1751620_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AXL24276.1|1751845_1752361_-	lipoprotein	NA	NA	NA	NA	NA
AXL24277.1|1753235_1754375_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXL24278.1|1755232_1756246_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXL24279.1|1756333_1757776_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AXL24280.1|1757786_1758788_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AXL27389.1|1758826_1760545_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AXL24281.1|1760695_1761130_+	DoxX family protein	NA	NA	NA	NA	NA
AXL24282.1|1761187_1761391_-	hypothetical protein	NA	NA	NA	NA	NA
AXL24283.1|1761341_1762310_-	NADH oxidoreductase	NA	NA	NA	NA	NA
AXL27390.1|1762320_1763973_-	hydroxylamine reductase	NA	NA	NA	NA	NA
AXL24284.1|1765118_1765814_-	aquaporin Z	NA	NA	NA	NA	NA
AXL24285.1|1766233_1767892_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AXL24286.1|1768038_1769154_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AXL24287.1|1769150_1771091_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AXL24288.1|1771030_1771213_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24289.1|1771167_1771389_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXL24290.1|1771714_1772032_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXL24291.1|1772062_1774342_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXL24292.1|1774462_1774681_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXL24293.1|1775034_1775736_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXL24294.1|1775780_1777502_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.4	3.4e-14
>prophage 4
CP027697	Klebsiella pneumoniae strain KP30835 chromosome, complete genome	5428613	2166983	2217858	5428613	integrase,tail,terminase,holin,transposase	Klebsiella_phage(27.91%)	59	2158965:2158980	2181788:2181803
2158965:2158980	attL	CATTTTTTTGCTCGTT	NA	NA	NA	NA
AXL24613.1|2166983_2167793_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
AXL24614.1|2167794_2168787_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AXL24615.1|2168786_2169677_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AXL27409.1|2169853_2171041_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
AXL24616.1|2170937_2171252_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AXL24617.1|2171248_2171911_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AXL24618.1|2171907_2172336_-	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AXL24619.1|2173297_2174143_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
AXL24620.1|2174158_2174443_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AXL24621.1|2174531_2174726_-	hypothetical protein	NA	NA	NA	NA	NA
AXL27410.1|2175153_2175357_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AXL24622.1|2176656_2176776_-	hypothetical protein	NA	NA	NA	NA	NA
AXL24623.1|2176798_2177458_-	hypothetical protein	NA	Q76H56	Enterobacteria_phage	84.0	6.3e-102
AXL24624.1|2177874_2178096_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AXL24625.1|2179035_2179884_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
AXL24626.1|2179864_2180182_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24627.1|2180237_2180483_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24628.1|2180690_2181719_-	hypothetical protein	NA	NA	NA	NA	NA
AXL24629.1|2182239_2182707_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
2181788:2181803	attR	AACGAGCAAAAAAATG	NA	NA	NA	NA
AXL24630.1|2182687_2182855_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
AXL24631.1|2182851_2183520_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
AXL24632.1|2183512_2184151_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
AXL24633.1|2184147_2184288_+	YlcG family protein	NA	NA	NA	NA	NA
AXL27411.1|2184287_2184977_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
AXL24634.1|2185613_2185925_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
AXL24635.1|2185947_2186460_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.2	1.2e-95
AXL24636.1|2186456_2186801_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
AXL24637.1|2186797_2187073_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
AXL24638.1|2187023_2187218_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
AXL24639.1|2188031_2188277_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
AXL24640.1|2188405_2188591_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24641.1|2189139_2190144_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
AXL24642.1|2190121_2191429_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
AXL24643.1|2191428_2192829_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
AXL24644.1|2192812_2193925_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
AXL27412.1|2194134_2194341_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24645.1|2194454_2195240_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
AXL24646.1|2195250_2196204_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
AXL24647.1|2196921_2197176_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
AXL24648.1|2197185_2197419_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
AXL24649.1|2197405_2197789_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
AXL24650.1|2197790_2198342_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
AXL24651.1|2198338_2198731_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AXL24652.1|2199979_2200462_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24653.1|2200629_2200806_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24654.1|2200882_2201239_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AXL27413.1|2201463_2201655_+	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
AXL24655.1|2201916_2204814_+|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
AXL24656.1|2204897_2205233_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24657.1|2205547_2206012_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
AXL24658.1|2206192_2206675_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
AXL24659.1|2206684_2207065_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AXL24660.1|2207061_2210130_+	kinase	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
AXL24661.1|2210206_2213161_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
AXL24662.1|2213164_2213896_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24663.1|2213892_2214087_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24664.1|2214120_2214720_-	hypothetical protein	NA	NA	NA	NA	NA
AXL24665.1|2214961_2216905_-	flagellar biosynthesis protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
AXL24666.1|2217153_2217858_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 5
CP027697	Klebsiella pneumoniae strain KP30835 chromosome, complete genome	5428613	2259613	2299377	5428613	tail,terminase,lysis,transposase,head,protease	uncultured_Caudovirales_phage(37.78%)	53	NA	NA
AXL24700.1|2259613_2260375_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
AXL24701.1|2262320_2262869_-|protease	protease	protease	NA	NA	NA	NA
AXL24702.1|2263065_2264247_+	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AXL24703.1|2264227_2264470_-	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AXL24704.1|2264648_2265128_-	hypothetical protein	NA	NA	NA	NA	NA
AXL24705.1|2265124_2265337_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AXL24706.1|2265333_2265558_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AXL24707.1|2265547_2266258_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AXL24708.1|2266263_2266782_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AXL24709.1|2266886_2267714_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AXL24710.1|2267710_2267905_-	hypothetical protein	NA	NA	NA	NA	NA
AXL24711.1|2267901_2268327_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AXL24712.1|2268513_2268768_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AXL24713.1|2268760_2269126_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AXL24714.1|2269294_2269483_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AXL24715.1|2269475_2269790_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AXL24716.1|2270724_2270946_+	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AXL24717.1|2270920_2271214_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AXL24718.1|2273180_2274143_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AXL24719.1|2274139_2274616_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AXL24720.1|2274612_2275395_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AXL24721.1|2275800_2276049_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AXL24722.1|2276051_2276582_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AXL24723.1|2276578_2276968_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AXL24724.1|2277623_2278376_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
AXL24725.1|2278326_2279727_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AXL24726.1|2279964_2281416_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AXL27415.1|2281471_2282020_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AXL24727.1|2282071_2283274_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AXL24728.1|2283277_2283772_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AXL24729.1|2283783_2284725_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AXL24730.1|2284764_2285046_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24731.1|2285014_2285434_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AXL24732.1|2285430_2285937_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24733.1|2285936_2286323_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AXL24734.1|2286417_2286858_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AXL24735.1|2286861_2288007_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AXL24736.1|2288017_2288308_+	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
AXL24737.1|2288248_2289441_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
AXL24738.1|2289767_2290193_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AXL24739.1|2290228_2290381_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AXL24740.1|2290370_2292374_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AXL24741.1|2292373_2292973_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
AXL24742.1|2292973_2293276_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AXL24743.1|2293278_2294301_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AXL24744.1|2294300_2294642_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AXL24745.1|2294694_2294880_-	hypothetical protein	NA	NA	NA	NA	NA
AXL24746.1|2294916_2295483_+	hypothetical protein	NA	NA	NA	NA	NA
AXL24747.1|2295536_2296190_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AXL24748.1|2296191_2296545_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AXL24749.1|2296544_2297741_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AXL24750.1|2297737_2298511_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AXL24751.1|2298510_2299377_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 6
CP027697	Klebsiella pneumoniae strain KP30835 chromosome, complete genome	5428613	2521533	2527962	5428613		Escherichia_phage(100.0%)	7	NA	NA
AXL24936.1|2521533_2522154_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AXL24937.1|2522146_2523412_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AXL24938.1|2523423_2524326_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AXL24939.1|2524586_2525348_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXL24940.1|2525368_2526229_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AXL24941.1|2526526_2526787_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AXL24942.1|2526873_2527962_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
>prophage 7
CP027697	Klebsiella pneumoniae strain KP30835 chromosome, complete genome	5428613	3498670	3506295	5428613		Escherichia_phage(28.57%)	7	NA	NA
AXL25720.1|3498670_3499672_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
AXL25721.1|3499865_3501032_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AXL25722.1|3501212_3501767_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
AXL25723.1|3501781_3502672_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
AXL25724.1|3502703_3503573_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
AXL25725.1|3503599_3504664_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
AXL25726.1|3504888_3506295_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 8
CP027697	Klebsiella pneumoniae strain KP30835 chromosome, complete genome	5428613	3839131	3920477	5428613	tail,terminase,holin,transposase,protease	Salmonella_phage(37.21%)	73	NA	NA
AXL25963.1|3839131_3840403_+|transposase	IS4 family transposase ISPa13	transposase	NA	NA	NA	NA
AXL25964.1|3840547_3841594_-	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
AXL25965.1|3841657_3842254_-	GDP-mannose pyrophosphatase NudK	NA	NA	NA	NA	NA
AXL25966.1|3844470_3844653_+	hypothetical protein	NA	NA	NA	NA	NA
AXL25967.1|3844666_3847780_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AXL27489.1|3847907_3847967_-	hypothetical protein	NA	NA	NA	NA	NA
AXL25968.1|3848332_3848686_+	ArsC family reductase	NA	NA	NA	NA	NA
AXL25969.1|3848689_3849817_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AXL25970.1|3849843_3850047_+	hypothetical protein	NA	NA	NA	NA	NA
AXL25971.1|3852878_3853754_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
AXL25972.1|3853873_3854587_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
AXL25973.1|3854802_3855837_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AXL25974.1|3855853_3856732_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AXL25975.1|3856819_3857452_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
AXL25976.1|3857455_3857926_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
AXL25977.1|3857987_3859049_-	AI-2E family transporter	NA	NA	NA	NA	NA
AXL25978.1|3859271_3860735_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AXL25979.1|3860744_3861104_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AXL25980.1|3861231_3862143_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
AXL25981.1|3862139_3862841_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AXL25982.1|3862939_3864226_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
AXL25983.1|3864320_3864947_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AXL25984.1|3866606_3867500_-	beta-glucoside kinase	NA	NA	NA	NA	NA
AXL25985.1|3867763_3868801_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
AXL25986.1|3868797_3869439_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
AXL25987.1|3869619_3871680_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AXL25988.1|3871683_3873216_+	exopolyphosphatase	NA	NA	NA	NA	NA
AXL25989.1|3876912_3877800_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXL25990.1|3877897_3879130_+	MFS transporter	NA	NA	NA	NA	NA
AXL25991.1|3879423_3880602_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AXL25992.1|3880585_3882454_+	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
AXL25993.1|3882673_3883156_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
AXL25994.1|3883152_3883782_-	endolysin	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
AXL25995.1|3883771_3884077_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
AXL25996.1|3884063_3884468_-	hypothetical protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
AXL25997.1|3887273_3887570_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
AXL25998.1|3887884_3888574_+	anti-repressor protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
AXL25999.1|3888659_3889043_-	hypothetical protein	NA	NA	NA	NA	NA
AXL26000.1|3889185_3891951_-	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
AXL26001.1|3893859_3896691_-	hypothetical protein	NA	Q858G0	Salmonella_phage	75.7	0.0e+00
AXL26002.1|3896701_3897241_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
AXL26003.1|3897240_3897705_-	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
AXL26004.1|3900201_3900807_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
AXL26005.1|3900806_3901130_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
AXL26006.1|3901180_3901522_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
AXL26007.1|3901532_3901970_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
AXL26008.1|3902023_3903010_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.6e-178
AXL26009.1|3903024_3903705_-	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
AXL26010.1|3903999_3905682_-|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
AXL26011.1|3905696_3905903_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AXL26012.1|3906410_3906653_-	hypothetical protein	NA	NA	NA	NA	NA
AXL26013.1|3906703_3907015_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
AXL26014.1|3907080_3908556_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.1	3.8e-280
AXL27490.1|3908552_3909137_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
AXL27491.1|3909214_3909472_-	lF-82	NA	NA	NA	NA	NA
AXL26015.1|3909546_3909885_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
AXL26016.1|3909884_3910124_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
AXL26017.1|3910116_3910785_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
AXL26018.1|3910781_3910994_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
AXL26019.1|3911164_3911908_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
AXL26020.1|3911904_3912330_-	hypothetical protein	NA	NA	NA	NA	NA
AXL26021.1|3912326_3912518_-	hypothetical protein	NA	NA	NA	NA	NA
AXL26022.1|3912501_3912912_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
AXL26023.1|3915117_3915327_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AXL26024.1|3915473_3915707_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AXL26025.1|3915860_3916442_+	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
AXL26026.1|3916807_3917107_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AXL26027.1|3917103_3918003_+	endonuclease	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
AXL26028.1|3918011_3919034_+	recombinase RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
AXL26029.1|3919084_3919333_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
AXL26030.1|3919442_3919736_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
AXL26031.1|3919728_3919887_+	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
AXL26032.1|3919883_3920477_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
>prophage 9
CP027697	Klebsiella pneumoniae strain KP30835 chromosome, complete genome	5428613	3996755	4077543	5428613	integrase,tail,tRNA,capsid,portal,plate,transposase,coat	Salmonella_phage(67.39%)	81	4041446:4041492	4079203:4079249
AXL26097.1|3996755_3997493_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AXL26098.1|3997624_3998956_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
AXL26099.1|3999001_3999385_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AXL26100.1|3999723_4000386_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.3	6.9e-56
AXL26101.1|4001731_4002157_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AXL26102.1|4002226_4002925_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AXL26103.1|4002959_4005620_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AXL26104.1|4005740_4007096_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXL26105.1|4007137_4007461_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26106.1|4007464_4008763_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
AXL26107.1|4014726_4017300_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AXL26108.1|4017429_4018161_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AXL26109.1|4018157_4019138_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AXL26110.1|4019269_4020007_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AXL26111.1|4020277_4020613_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AXL26112.1|4020866_4022027_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AXL26113.1|4022023_4022896_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AXL26114.1|4022957_4024079_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AXL26115.1|4024088_4025159_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AXL26116.1|4025501_4026011_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AXL26117.1|4027237_4027720_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26118.1|4027728_4029099_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AXL26119.1|4029154_4029613_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AXL26120.1|4029731_4030079_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AXL26121.1|4030118_4030886_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AXL26122.1|4030917_4031466_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXL26123.1|4031484_4031733_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXL26124.1|4031992_4033357_-	signal recognition particle protein	NA	NA	NA	NA	NA
AXL26125.1|4033520_4034312_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AXL26126.1|4034331_4035618_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AXL26127.1|4035737_4036328_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXL26128.1|4036452_4037331_+	NAD(+) kinase	NA	NA	NA	NA	NA
AXL26129.1|4037417_4039079_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AXL26130.1|4039226_4039568_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXL26131.1|4039634_4039925_-	RnfH family protein	NA	NA	NA	NA	NA
AXL26132.1|4039914_4040391_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AXL26133.1|4040500_4040983_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4041446:4041492	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
AXL26134.1|4041584_4041962_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26135.1|4041989_4042208_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AXL26136.1|4043364_4043850_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AXL26137.1|4043846_4046477_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
AXL26138.1|4046469_4046589_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AXL26139.1|4046603_4046903_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
AXL26140.1|4046955_4047471_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AXL26141.1|4047480_4048653_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AXL26142.1|4048801_4049875_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AXL26143.1|4049926_4051045_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
AXL26144.1|4051054_4053004_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AXL27493.1|4053005_4053677_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AXL26145.1|4053669_4054578_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AXL26146.1|4054564_4054927_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AXL26147.1|4054923_4055496_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AXL26148.1|4055590_4056457_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26149.1|4056917_4057340_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AXL26150.1|4057302_4057506_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
AXL26151.1|4057435_4057864_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AXL26152.1|4057860_4058244_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AXL26153.1|4058248_4058758_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AXL27494.1|4058738_4058954_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AXL26154.1|4058957_4059161_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
AXL26155.1|4059719_4060373_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AXL26156.1|4060376_4061429_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AXL26157.1|4062418_4064182_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AXL26158.1|4064181_4065225_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AXL27495.1|4065281_4065551_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AXL26159.1|4066072_4067074_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26160.1|4067957_4068938_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AXL27496.1|4069134_4069353_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26161.1|4069382_4069589_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26162.1|4069800_4070049_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26163.1|4070116_4070350_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AXL26164.1|4070361_4070550_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AXL26165.1|4070712_4073097_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AXL26166.1|4073940_4074168_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AXL26167.1|4074167_4074401_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AXL26168.1|4074468_4074807_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AXL26169.1|4074770_4074971_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AXL26170.1|4074978_4075488_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AXL26171.1|4075520_4075763_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AXL26172.1|4075885_4076515_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AXL26173.1|4076517_4077543_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
4079203:4079249	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 10
CP027697	Klebsiella pneumoniae strain KP30835 chromosome, complete genome	5428613	4797918	4849494	5428613	integrase,tail,terminase,tRNA,capsid,portal,head,protease	uncultured_Caudovirales_phage(68.75%)	61	4833677:4833694	4849668:4849685
AXL26800.1|4797918_4798413_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
AXL26801.1|4798416_4799055_-	stringent starvation protein A	NA	NA	NA	NA	NA
AXL26802.1|4799053_4799257_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26803.1|4799366_4799759_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AXL26804.1|4799774_4800203_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AXL26805.1|4800468_4801596_-	cell division protein ZapE	NA	NA	NA	NA	NA
AXL27521.1|4801786_4802185_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26806.1|4802358_4803726_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AXL26807.1|4803813_4804872_+|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AXL26808.1|4805008_4805947_-	malate dehydrogenase	NA	NA	NA	NA	NA
AXL26809.1|4806361_4806832_+	arginine repressor	NA	NA	NA	NA	NA
AXL26810.1|4807207_4807471_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXL26811.1|4807569_4807836_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXL26812.1|4807886_4808162_-	hypothetical protein	NA	NA	NA	NA	NA
AXL26813.1|4808241_4810209_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AXL26814.1|4810214_4811147_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AXL26815.1|4811154_4811358_-	protein AaeX	NA	NA	NA	NA	NA
AXL26816.1|4811489_4812419_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AXL26817.1|4812454_4813900_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AXL26818.1|4813988_4817786_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AXL26819.1|4817823_4819293_-	ribonuclease G	NA	NA	NA	NA	NA
AXL26820.1|4819295_4819877_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AXL26821.1|4819884_4820373_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AXL26822.1|4820372_4821365_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AXL26823.1|4821435_4822479_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AXL27522.1|4822456_4822663_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26824.1|4822784_4824725_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AXL26825.1|4824804_4824996_-	hypothetical protein	NA	NA	NA	NA	NA
AXL26826.1|4825224_4826226_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AXL26827.1|4826225_4826834_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AXL26828.1|4827057_4827510_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AXL26829.1|4827532_4828000_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AXL26830.1|4828010_4829360_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AXL26831.1|4829470_4829713_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26832.1|4829702_4831154_+	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AXL26833.1|4831165_4832047_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AXL26834.1|4832052_4832247_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26835.1|4832404_4833370_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AXL26836.1|4833394_4833691_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
4833677:4833694	attL	TACGGCATGAACTGATAC	NA	NA	NA	NA
AXL26837.1|4833844_4834036_-	hypothetical protein	NA	NA	NA	NA	NA
AXL26838.1|4834038_4835700_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AXL26839.1|4835683_4836040_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AXL26840.1|4835997_4836189_-|terminase	terminase	terminase	NA	NA	NA	NA
AXL26841.1|4836315_4836759_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AXL26842.1|4836758_4837058_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AXL26843.1|4837054_4837390_-|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AXL26844.1|4837386_4838628_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AXL26845.1|4838629_4839190_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AXL26846.1|4839241_4840408_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AXL27523.1|4840669_4841182_+	hypothetical protein	NA	NA	NA	NA	NA
AXL26847.1|4841230_4841566_-	hypothetical protein	NA	NA	NA	NA	NA
AXL26848.1|4841907_4844043_-	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AXL26849.1|4844042_4844408_-	hypothetical protein	NA	NA	NA	NA	NA
AXL26850.1|4844404_4844773_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AXL26851.1|4844769_4845084_-	hypothetical protein	NA	NA	NA	NA	NA
AXL26852.1|4845076_4845265_-	hypothetical protein	NA	NA	NA	NA	NA
AXL27524.1|4845257_4845437_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
AXL26853.1|4845660_4845855_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AXL26854.1|4845978_4846758_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AXL26855.1|4846768_4847053_-	transcriptional regulator	NA	NA	NA	NA	NA
AXL26856.1|4848267_4849494_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
4849668:4849685	attR	TACGGCATGAACTGATAC	NA	NA	NA	NA
>prophage 1
CP027696	Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence	207465	16689	54513	207465	transposase,protease,integrase	Escherichia_phage(35.71%)	34	4409:4424	57984:57999
4409:4424	attL	GCGGCGACGGCCTGCG	NA	NA	NA	NA
AXL22649.1|16689_19656_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AXL22650.1|19658_20219_-	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AXL22651.1|20344_20959_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AXL22652.1|20897_21911_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXL22653.1|22055_22553_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AXL22654.1|22960_23752_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AXL22655.1|23915_24263_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXL22656.1|24256_25096_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXL22657.1|25025_25205_-	hypothetical protein	NA	NA	NA	NA	NA
AXL22658.1|25223_25427_+	hypothetical protein	NA	NA	NA	NA	NA
AXL22659.1|25581_26787_+	chromate transporter	NA	NA	NA	NA	NA
AXL22660.1|26797_27103_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXL22661.1|27118_27301_-	resolvase	NA	NA	NA	NA	NA
AXL22662.1|27329_28094_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AXL22663.1|28284_28641_-	hypothetical protein	NA	NA	NA	NA	NA
AXL22664.1|28586_29171_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXL22665.1|30404_31310_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXL22666.1|31431_32136_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXL22667.1|33288_33957_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
AXL22668.1|35259_35964_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.0e-138
AXL22669.1|36819_37647_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
AXL22670.1|37643_38507_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXL22671.1|39350_40361_+	phosphonate dehydrogenase	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
AXL22672.1|40354_41224_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXL22801.1|41928_42255_-	hypothetical protein	NA	NA	NA	NA	NA
AXL22800.1|42306_42393_+	ABC transporter	NA	NA	NA	NA	NA
AXL22673.1|42431_43412_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AXL22802.1|45398_45680_+	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AXL22674.1|45714_46284_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXL22675.1|46398_49194_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.0	5.2e-129
AXL22676.1|49193_49391_+	hypothetical protein	NA	NA	NA	NA	NA
AXL22677.1|49887_50376_+	diguanylate cyclase	NA	NA	NA	NA	NA
AXL22678.1|50362_51325_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AXL22803.1|53166_54513_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
57984:57999	attR	GCGGCGACGGCCTGCG	NA	NA	NA	NA
>prophage 1
CP027695	Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence	177464	73123	96856	177464	transposase,integrase	Enterobacteria_phage(37.5%)	20	78574:78613	97016:97055
AXL22530.1|73123_73828_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXL22531.1|77157_77895_+	resolvase	NA	NA	NA	NA	NA
AXL22532.1|77891_78116_+	hypothetical protein	NA	NA	NA	NA	NA
78574:78613	attL	ACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG	NA	NA	NA	NA
AXL22533.1|78608_81614_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
AXL22534.1|81777_82335_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AXL22535.1|82517_83378_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXL22536.1|84380_84929_-	sodium:proton antiporter	NA	NA	NA	NA	NA
AXL22537.1|84949_85342_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.5e-22
AXL22538.1|85568_87101_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXL22539.1|87192_87984_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXL22540.1|88004_89180_-	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
AXL22541.1|89283_89910_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXL22542.1|89906_90089_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AXL22543.1|91546_92518_-	Sul1-delta/DUF3363 domain-containing fusion protein	NA	NA	NA	NA	NA
AXL22544.1|92511_92859_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXL22545.1|93022_93814_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AXL22546.1|94221_94719_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AXL22547.1|94863_95877_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXL22548.1|95815_96118_+|transposase	transposase	transposase	NA	NA	NA	NA
AXL22549.1|96151_96856_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
97016:97055	attR	CTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGT	NA	NA	NA	NA
