The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	1063818	1070957	4599824		Escherichia_phage(83.33%)	6	NA	NA
AXL16652.1|1063818_1064457_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AXL16653.1|1064548_1065715_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
AXL16654.1|1065711_1066620_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
AXL16655.1|1066815_1067583_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AXL16656.1|1067633_1068290_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
AXL16657.1|1068395_1070957_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	1444749	1457220	4599824	tail,transposase	Enterobacteria_phage(50.0%)	16	NA	NA
AXL16992.1|1444749_1444950_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AXL16993.1|1445081_1445387_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
AXL16994.1|1445386_1445749_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
AXL16995.1|1445739_1446276_-	HD family hydrolase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
AXL16996.1|1446403_1447228_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
AXL16997.1|1447293_1447656_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
AXL16998.1|1448378_1448873_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
AXL16999.1|1448872_1449148_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
AXL19948.1|1449197_1449716_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
AXL17000.1|1449742_1450183_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
AXL17001.1|1450154_1450499_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	86.2	3.1e-44
AXL17002.1|1450797_1452129_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
AXL17003.1|1452992_1454155_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AXL17004.1|1454303_1454666_-	glucose translocase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
AXL17005.1|1454818_1455976_-	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	100.0	5.7e-223
AXL17006.1|1456287_1457220_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
>prophage 3
CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	1705112	1714553	4599824		Enterobacteria_phage(85.71%)	10	NA	NA
AXL17229.1|1705112_1706039_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
AXL17230.1|1706043_1706775_+	ABC transporter permease	NA	NA	NA	NA	NA
AXL17231.1|1706755_1706863_-	hypothetical protein	NA	NA	NA	NA	NA
AXL17232.1|1706922_1707654_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AXL17233.1|1707875_1709561_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AXL17234.1|1709557_1710277_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXL17235.1|1710323_1710794_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AXL17236.1|1710833_1711295_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AXL17237.1|1711575_1713420_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.9	0.0e+00
AXL17238.1|1713416_1714553_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	2249735	2293064	4599824	lysis,protease,terminase,tail,integrase	Enterobacteria_phage(34.48%)	60	2257311:2257326	2283459:2283474
AXL17741.1|2249735_2250557_-|protease	serine protease	protease	NA	NA	NA	NA
AXL17742.1|2250656_2250740_-	hypothetical protein	NA	NA	NA	NA	NA
AXL17743.1|2250832_2251168_-	acid shock protein	NA	NA	NA	NA	NA
AXL17744.1|2251564_2252818_-	MFS transporter	NA	NA	NA	NA	NA
AXL17745.1|2252924_2253818_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXL17746.1|2253952_2255173_+	protein mlc	NA	NA	NA	NA	NA
AXL17747.1|2255297_2255993_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AXL17748.1|2255945_2257238_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2257311:2257326	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AXL17749.1|2257396_2258011_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AXL17750.1|2258053_2258908_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AXL17751.1|2258909_2259527_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AXL19983.1|2259537_2261961_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AXL17752.1|2262021_2264448_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
AXL17753.1|2264646_2264952_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AXL19984.1|2265059_2265770_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AXL17754.1|2265772_2266333_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AXL17755.1|2266367_2266709_-	DUF1283 family protein	NA	NA	NA	NA	NA
AXL17756.1|2266843_2267170_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AXL17757.1|2267206_2267395_+	hypothetical protein	NA	NA	NA	NA	NA
AXL17758.1|2267375_2268590_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AXL17759.1|2268601_2269621_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AXL17760.1|2269678_2269789_+	transporter	NA	NA	NA	NA	NA
AXL17761.1|2269808_2271005_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	59.2	7.9e-135
AXL17762.1|2272531_2272723_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXL17763.1|2272719_2272908_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AXL17764.1|2273475_2273694_-	hypothetical protein	NA	NA	NA	NA	NA
AXL17765.1|2273723_2273894_-	hypothetical protein	NA	NA	NA	NA	NA
AXL17766.1|2273853_2274009_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AXL17767.1|2274175_2274583_-	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
AXL17768.1|2274666_2274897_+	division inhibition gene dicB repressor	NA	NA	NA	NA	NA
AXL17769.1|2275387_2275510_+	plasmid mobilization protein	NA	NA	NA	NA	NA
AXL17770.1|2275779_2276112_-	protein FlxA	NA	NA	NA	NA	NA
AXL17771.1|2276314_2276620_-	hypothetical protein	NA	NA	NA	NA	NA
AXL17772.1|2276644_2276884_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AXL17773.1|2276883_2277171_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AXL17774.1|2277242_2277398_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AXL17775.1|2277614_2277866_+	hypothetical protein	NA	NA	NA	NA	NA
AXL17776.1|2277932_2278211_+	hypothetical protein	NA	NA	NA	NA	NA
AXL17777.1|2278212_2279262_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
AXL17778.1|2279275_2280028_+	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AXL17779.1|2280449_2280662_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AXL17780.1|2280962_2281178_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AXL17781.1|2281931_2282147_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AXL17782.1|2282151_2282463_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AXL17783.1|2282459_2282993_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AXL17784.1|2282989_2283487_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2283459:2283474	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AXL17785.1|2283849_2284062_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AXL17786.1|2284072_2284261_+	cold-shock protein	NA	NA	NA	NA	NA
AXL17787.1|2284407_2284563_+	hypothetical protein	NA	NA	NA	NA	NA
AXL17788.1|2284734_2284908_+	protein GnsB	NA	NA	NA	NA	NA
AXL17789.1|2285059_2285470_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AXL17790.1|2285527_2285761_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AXL17791.1|2285908_2286010_+	hypothetical protein	NA	NA	NA	NA	NA
AXL17792.1|2286149_2286719_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
AXL17793.1|2286669_2287632_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
AXL17794.1|2287631_2288207_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AXL17795.1|2288304_2288895_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AXL17796.1|2289211_2289445_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AXL17797.1|2290231_2291515_+	MFS transporter	NA	NA	NA	NA	NA
AXL17798.1|2291603_2293064_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 5
CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	2485620	2515951	4599824	tail,transposase,tRNA	Escherichia_phage(41.38%)	39	NA	NA
AXL17958.1|2485620_2486754_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
AXL17959.1|2486894_2487329_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AXL17960.1|2488289_2488523_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
AXL17961.1|2488839_2489430_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AXL17962.1|2489527_2490103_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
AXL17963.1|2490102_2493465_-|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
AXL19994.1|2493529_2493745_-	hypothetical protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
AXL17964.1|2493787_2494768_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AXL19995.1|2494806_2494926_-	ABC transporter	NA	NA	NA	NA	NA
AXL17965.1|2494900_2495155_-	hypothetical protein	NA	A5LH44	Enterobacteria_phage	95.8	7.4e-35
AXL17966.1|2496225_2496426_-	hypothetical protein	NA	NA	NA	NA	NA
AXL17967.1|2496533_2496893_-	hypothetical protein	NA	NA	NA	NA	NA
AXL17968.1|2496873_2497137_-	hypothetical protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
AXL17969.1|2497054_2497336_-	hypothetical protein	NA	NA	NA	NA	NA
AXL17970.1|2497274_2498732_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AXL17971.1|2498928_2499114_-	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AXL17972.1|2499784_2500531_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
AXL17973.1|2500537_2501395_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
AXL17974.1|2501407_2501830_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
AXL17975.1|2501852_2502149_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
AXL17976.1|2502272_2502749_+	Rac prophage repressor	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
AXL17977.1|2503012_2503192_+	hypothetical protein	NA	NA	NA	NA	NA
AXL17978.1|2503202_2503358_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AXL17979.1|2503354_2503843_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
AXL17980.1|2503877_2504156_-	hypothetical protein	NA	NA	NA	NA	NA
AXL17981.1|2504284_2504506_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
AXL19996.1|2504505_2504676_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AXL17982.1|2504750_2505026_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AXL17983.1|2505127_2507728_+	exodeoxyribonuclease 8	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
AXL17984.1|2507720_2508530_+	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AXL17985.1|2508586_2508781_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AXL17986.1|2508773_2508983_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AXL17987.1|2509061_2509277_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AXL17988.1|2509278_2510514_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AXL17989.1|2510565_2511501_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AXL17990.1|2511629_2513003_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AXL17991.1|2513032_2513206_-	hypothetical protein	NA	NA	NA	NA	NA
AXL17992.1|2513480_2514464_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AXL19997.1|2514718_2515951_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 6
CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	2707255	2721636	4599824	tail,integrase,portal,plate	Shigella_phage(30.0%)	24	2704631:2704644	2722662:2722675
2704631:2704644	attL	AAAATAAGATGAAT	NA	NA	NA	NA
AXL18173.1|2707255_2707987_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
AXL18174.1|2708207_2708612_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AXL18175.1|2709311_2709635_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
AXL18176.1|2709737_2709902_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
AXL18177.1|2710135_2710969_-	5-methylcytosine-specific restriction enzyme A	NA	NA	NA	NA	NA
AXL18178.1|2711075_2711630_-	DNA-invertase from lambdoid prophage e14	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
AXL20011.1|2711701_2712196_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
AXL18179.1|2712195_2712798_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
AXL18180.1|2712769_2713183_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
AXL18181.1|2713184_2713814_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
AXL18182.1|2713817_2714402_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	98.5	2.0e-112
AXL18183.1|2714392_2715184_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
AXL18184.1|2715110_2715584_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
AXL18185.1|2715583_2715766_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AXL18186.1|2715777_2717145_-	helix-turn-helix domain-containing protein	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
AXL18187.1|2717134_2717314_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AXL18188.1|2717489_2718047_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
AXL18189.1|2718090_2718291_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
AXL18190.1|2718381_2719056_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
AXL18191.1|2719230_2719539_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
AXL18192.1|2719476_2719818_-	hypothetical protein	NA	NA	NA	NA	NA
AXL18193.1|2719817_2720018_-	hypothetical protein	NA	U5P0J5	Shigella_phage	88.0	1.7e-18
AXL18194.1|2720282_2720528_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
AXL18195.1|2720508_2721636_+|integrase	integrase	integrase	O21925	Phage_21	61.5	7.2e-122
2722662:2722675	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 7
CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	3312318	3356681	4599824	lysis,protease,terminase,transposase,capsid,integrase	Enterobacteria_phage(57.69%)	54	3335393:3335439	3356695:3356741
AXL18731.1|3312318_3313431_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AXL18732.1|3313507_3313660_-	protein HokE	NA	NA	NA	NA	NA
AXL18733.1|3313951_3314101_-	hypothetical protein	NA	NA	NA	NA	NA
AXL18734.1|3314112_3315231_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AXL18735.1|3315296_3315545_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
AXL18736.1|3315609_3315978_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AXL18737.1|3316071_3316725_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AXL18738.1|3316832_3318080_+	miniconductance mechanosensitive channel YbdG	NA	NA	NA	NA	NA
AXL18739.1|3318160_3319537_-	phenylalanine-specific permease	NA	NA	NA	NA	NA
AXL18740.1|3319638_3322782_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
AXL18741.1|3322793_3324017_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
AXL18742.1|3324032_3324365_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone	NA	NA	NA	NA	NA
AXL18743.1|3324522_3325896_-	cation efflux system protein CusC	NA	NA	NA	NA	NA
AXL18744.1|3325850_3326006_-	copper transporter	NA	NA	NA	NA	NA
AXL18745.1|3326052_3326736_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AXL18746.1|3326725_3328168_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
AXL18747.1|3328317_3330555_+	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
AXL18748.1|3330541_3333514_+	bacteriophage N4 adsorption protein A	NA	NA	NA	NA	NA
AXL18749.1|3333514_3334405_+	DUF4434 family protein	NA	NA	NA	NA	NA
AXL18750.1|3334318_3334531_-	hypothetical protein	NA	NA	NA	NA	NA
AXL18751.1|3334587_3335349_+	porin thermoregulatory protein EnvY	NA	NA	NA	NA	NA
AXL18752.1|3335342_3335459_+	hypothetical protein	NA	NA	NA	NA	NA
3335393:3335439	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AXL18753.1|3335862_3336816_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AXL18754.1|3337065_3337815_-	transcriptional regulator	NA	NA	NA	NA	NA
AXL18755.1|3338717_3339344_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXL18756.1|3339288_3339426_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AXL18757.1|3339398_3340142_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
AXL18758.1|3340116_3340662_-	DNA-packaging protein NU1	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AXL18759.1|3340801_3340903_-	hypothetical protein	NA	NA	NA	NA	NA
AXL18760.1|3341050_3341245_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
AXL18761.1|3341409_3341616_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AXL18762.1|3341901_3342312_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
AXL18763.1|3342602_3342896_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
AXL18764.1|3342927_3343389_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	3.9e-74
AXL18765.1|3343385_3343883_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
AXL18766.1|3343882_3344098_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AXL18767.1|3344670_3345738_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
AXL18768.1|3345742_3346759_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AXL18769.1|3346796_3347015_-	hypothetical protein	NA	Q38586	Enterobacteria_phage	70.2	1.1e-13
AXL18770.1|3347156_3347540_-	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AXL18771.1|3347625_3347766_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AXL18772.1|3347762_3348125_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AXL18773.1|3348121_3348412_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
AXL18774.1|3348404_3348575_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AXL18775.1|3348574_3349030_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
AXL18776.1|3349026_3349128_-	hypothetical protein	NA	NA	NA	NA	NA
AXL18777.1|3349244_3350042_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXL18778.1|3350051_3350603_-	kinase inhibitor	NA	NA	NA	NA	NA
AXL18779.1|3351067_3352594_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
AXL18780.1|3352848_3353181_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AXL18781.1|3353491_3354654_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AXL18782.1|3354716_3354812_-	protein ren	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
AXL18783.1|3355134_3355398_+	hypothetical protein	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
AXL18784.1|3355517_3356681_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
3356695:3356741	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 8
CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	3528594	3583123	4599824	transposase	Shigella_phage(11.11%)	53	NA	NA
AXL18948.1|3528594_3529756_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AXL18949.1|3529784_3531245_-	autotransporter	NA	NA	NA	NA	NA
AXL18950.1|3531329_3531599_+	hypothetical protein	NA	NA	NA	NA	NA
AXL18951.1|3531768_3532743_+	delta-aminolevulinic acid dehydratase	NA	NA	NA	NA	NA
AXL18952.1|3532849_3533701_-	taurine dioxygenase	NA	NA	NA	NA	NA
AXL18953.1|3533697_3534525_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
AXL18954.1|3534521_3535289_-	taurine import ATP-binding protein TauB	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
AXL18955.1|3535301_3536264_-	taurine-binding periplasmic protein	NA	NA	NA	NA	NA
AXL18956.1|3536262_3536442_+	hypothetical protein	NA	NA	NA	NA	NA
AXL18957.1|3536879_3537437_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
AXL18958.1|3537560_3538757_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AXL18959.1|3538916_3540190_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AXL18960.1|3540208_3540652_+	transferase	NA	NA	NA	NA	NA
AXL18961.1|3540653_3541427_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
AXL18962.1|3541614_3541890_+	transcriptional regulator	NA	NA	NA	NA	NA
AXL18963.1|3541924_3543034_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
AXL18964.1|3543127_3543961_+	S-formylglutathione hydrolase FrmB	NA	NA	NA	NA	NA
AXL18965.1|3544184_3544724_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
AXL18966.1|3544825_3546037_-	3-(3-hydroxy-phenyl)propionate transporter	NA	NA	NA	NA	NA
AXL18967.1|3546614_3547628_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
AXL18968.1|3547624_3548575_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
AXL18969.1|3548571_3549381_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AXL18970.1|3549390_3550257_-	2-hydroxy-6-oxononadienedioate/2-hydroxy-6- oxononatrienedioate hydrolase	NA	NA	NA	NA	NA
AXL18971.1|3550274_3551219_-	2,3-dihydroxyphenylpropionate/2, 3-dihydroxicinnamic acid 1,2-dioxygenase	NA	NA	NA	NA	NA
AXL18972.1|3551220_3552885_-	3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
AXL18973.1|3552961_3553909_+	DNA-binding transcriptional activator MhpR	NA	NA	NA	NA	NA
AXL18974.1|3553985_3555068_+	lactose operon repressor	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
AXL18975.1|3555190_3558265_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
AXL18976.1|3560184_3561240_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
AXL18977.1|3561527_3562631_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AXL18978.1|3562642_3563896_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
AXL18979.1|3564467_3564809_-	toxin	NA	NA	NA	NA	NA
AXL18980.1|3564829_3565147_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AXL18981.1|3565165_3565387_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AXL18982.1|3565395_3565872_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AXL18983.1|3565887_3566346_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
AXL18984.1|3566443_3566683_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXL18985.1|3566759_3567227_-	hypothetical protein	NA	NA	NA	NA	NA
AXL20038.1|3567249_3567693_-	hypothetical protein	NA	NA	NA	NA	NA
AXL20039.1|3567692_3567920_-	hypothetical protein	NA	NA	NA	NA	NA
AXL18986.1|3568323_3569145_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
AXL18987.1|3569236_3570100_-	GTPase family protein	NA	NA	NA	NA	NA
AXL18988.1|3570428_3571322_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXL18989.1|3571417_3571786_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	7.2e-39
AXL18990.1|3571742_3572894_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
AXL18991.1|3573255_3573693_-	hypothetical protein	NA	NA	NA	NA	NA
AXL18992.1|3575092_3575203_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	4.5e-13
AXL18993.1|3575240_3576257_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AXL20040.1|3576464_3577868_+	S-methylmethionine permease	NA	NA	NA	NA	NA
AXL18994.1|3577854_3578787_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AXL18995.1|3578895_3579942_-	Fe(3+) ions import ATP-binding protein FbpC	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
AXL18996.1|3581524_3581875_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AXL18997.1|3581968_3583123_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
