The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031414	Mycolicibacterium neoaurum strain HGMS2 chromosome, complete genome	5421383	201790	212298	5421383		Tupanvirus(66.67%)	6	NA	NA
AXK73915.1|201790_202738_-	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	47.0	6.1e-74
AXK73916.1|202784_204104_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	36.8	4.5e-67
AXK73917.1|204725_209066_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	38.2	4.5e-47
AXK73918.1|209058_211092_+	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	22.4	4.0e-22
AXK73919.1|210940_211522_+	hypothetical protein	NA	A0A2K9L3I8	Tupanvirus	27.5	6.7e-07
AXK73920.1|211518_212298_+	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	28.7	6.5e-21
>prophage 2
CP031414	Mycolicibacterium neoaurum strain HGMS2 chromosome, complete genome	5421383	1237836	1251845	5421383	integrase,protease,capsid	Mycobacterium_phage(33.33%)	17	1231137:1231175	1246651:1246689
1231137:1231175	attL	GAGCGGGCGACGGGAATCGAACCCGCGTAGCTAGTTTGG	NA	NA	NA	NA
AXK78166.1|1237836_1238973_-|capsid	phage major capsid protein	capsid	A0A1B3B249	Gordonia_phage	52.0	2.5e-98
AXK74707.1|1239325_1239994_-	hypothetical protein	NA	G9FHH6	Rhodococcus_phage	49.2	7.9e-44
AXK74708.1|1239990_1240395_-	hypothetical protein	NA	NA	NA	NA	NA
AXK74709.1|1240595_1241075_-	hypothetical protein	NA	NA	NA	NA	NA
AXK74710.1|1241307_1241529_-	hypothetical protein	NA	NA	NA	NA	NA
AXK74711.1|1241615_1241861_-	hypothetical protein	NA	NA	NA	NA	NA
AXK74712.1|1241976_1242333_-	hypothetical protein	NA	NA	NA	NA	NA
AXK78167.1|1242647_1243562_-|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	52.6	5.7e-77
AXK74713.1|1243711_1244338_-	hypothetical protein	NA	NA	NA	NA	NA
AXK74714.1|1244477_1244702_-	DNA-binding protein	NA	NA	NA	NA	NA
AXK74715.1|1244952_1245402_+	hypothetical protein	NA	NA	NA	NA	NA
AXK74716.1|1245394_1246564_+|integrase	site-specific integrase	integrase	A0A1D8EX55	Mycobacterium_phage	62.9	7.7e-135
AXK74717.1|1246885_1248472_+	trigger factor	NA	NA	NA	NA	NA
1246651:1246689	attR	GAGCGGGCGACGGGAATCGAACCCGCGTAGCTAGTTTGG	NA	NA	NA	NA
AXK74718.1|1248573_1249182_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	49.1	8.3e-40
AXK74719.1|1249178_1249805_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
AXK74720.1|1250107_1250323_-	hypothetical protein	NA	NA	NA	NA	NA
AXK74721.1|1250564_1251845_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.6	1.5e-139
>prophage 3
CP031414	Mycolicibacterium neoaurum strain HGMS2 chromosome, complete genome	5421383	3166700	3173403	5421383		Lactococcus_phage(16.67%)	7	NA	NA
AXK76218.1|3166700_3168869_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	50.9	1.8e-206
AXK76219.1|3168835_3169282_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	35.0	5.9e-11
AXK76220.1|3169312_3169555_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	61.8	3.2e-19
AXK76221.1|3169984_3170521_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	32.0	4.3e-08
AXK76222.1|3170609_3171218_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXK78441.1|3171226_3172255_+	DNA polymerase IV	NA	I6RSM4	Salmonella_phage	24.1	4.2e-12
AXK76223.1|3172248_3173403_+	DUF2813 domain-containing protein	NA	A0A077SLJ9	Escherichia_phage	38.8	1.5e-58
