The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033561	Acinetobacter nosocomialis strain 2010S01-197 chromosome, complete genome	4231974	521756	587087	4231974	tRNA,tail,integrase,protease	uncultured_Caudovirales_phage(33.33%)	46	520777:520793	570645:570661
520777:520793	attL	TACTTTTTCCTTAAAAG	NA	NA	NA	NA
AZC09086.1|521756_522185_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	50.0	6.4e-31
AZC09087.1|522191_522845_-	starvation protein A	NA	NA	NA	NA	NA
AZC09088.1|523016_523403_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AZC09089.1|523415_523844_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AZC09090.1|525023_525560_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AZC09091.1|525522_525837_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09092.1|526719_527163_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
AZC10753.1|527247_527922_-	LrgB family protein	NA	NA	NA	NA	NA
AZC09093.1|527932_528304_-	hypothetical protein	NA	NA	NA	NA	NA
AZC09094.1|529887_530649_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZC09095.1|530696_532322_-	phospholipase D family protein	NA	NA	NA	NA	NA
AZC09096.1|533489_533969_-	OmpA family protein	NA	NA	NA	NA	NA
AZC09097.1|535212_535716_-	YfiR family protein	NA	NA	NA	NA	NA
AZC09098.1|543267_544749_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09099.1|545038_545374_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
AZC09100.1|546904_547321_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AZC09101.1|547971_548466_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AZC09102.1|551338_551818_-	hypothetical protein	NA	NA	NA	NA	NA
AZC09103.1|551822_552125_-	hypothetical protein	NA	NA	NA	NA	NA
AZC09104.1|552159_552774_-	septation protein IspZ	NA	NA	NA	NA	NA
AZC09105.1|553676_554588_-	bestrophin	NA	NA	NA	NA	NA
AZC09106.1|556789_557755_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	32.7	2.2e-31
AZC09107.1|559715_560045_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AZC09108.1|563362_564400_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AZC09109.1|564822_565893_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	35.8	9.1e-42
AZC09110.1|565898_566198_-	hypothetical protein	NA	NA	NA	NA	NA
AZC09111.1|566972_567284_-	hypothetical protein	NA	NA	NA	NA	NA
AZC09112.1|567288_567558_-	hypothetical protein	NA	NA	NA	NA	NA
AZC09113.1|570376_570568_-	hypothetical protein	NA	NA	NA	NA	NA
AZC09114.1|570660_571002_+	XRE family transcriptional regulator	NA	A0A2H4J8M8	uncultured_Caudovirales_phage	43.8	5.5e-09
570645:570661	attR	CTTTTAAGGAAAAAGTA	NA	NA	NA	NA
AZC09115.1|571028_571982_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09116.1|572017_572233_-	hypothetical protein	NA	NA	NA	NA	NA
AZC09117.1|572349_573183_-	DUF2158 domain-containing protein	NA	Q8H9L9	Vibrio_phage	74.2	3.5e-33
AZC09118.1|573977_574388_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09119.1|574384_574567_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09120.1|576181_576625_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09121.1|576618_577146_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09122.1|577168_577813_+	SOS response-associated peptidase	NA	A0A218MNF5	uncultured_virus	55.5	5.4e-66
AZC09123.1|577922_578465_+	DNA polymerase V	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.9	1.7e-44
AZC09124.1|578421_579717_+	DNA polymerase V subunit UmuC	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	62.6	1.6e-157
AZC09125.1|580007_580208_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AZC09126.1|580572_581886_-	DNA primase	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	42.9	1.6e-96
AZC10754.1|584831_585032_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZC09127.1|584958_585312_-|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	50.0	4.1e-15
AZC09128.1|585380_585899_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	59.6	3.3e-53
AZC09129.1|585911_587087_-|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	67.6	3.2e-149
>prophage 2
CP033561	Acinetobacter nosocomialis strain 2010S01-197 chromosome, complete genome	4231974	1163200	1169250	4231974		Acinetobacter_phage(50.0%)	7	NA	NA
AZC09369.1|1163200_1164349_-	D-alanyl-D-alanine carboxypeptidase PBP5/6	NA	B6DZZ7	Stx2-converting_phage	36.8	2.0e-63
AZC09370.1|1165854_1166358_-	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	75.0	9.1e-69
AZC09371.1|1166332_1166542_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	3.7e-32
AZC09372.1|1166538_1167045_-	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	92.2	5.6e-82
AZC10786.1|1167317_1167938_-	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	65.1	5.6e-76
AZC09373.1|1168063_1168312_-	hypothetical protein	NA	NA	NA	NA	NA
AZC09374.1|1168311_1169250_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	83.7	4.3e-144
>prophage 3
CP033561	Acinetobacter nosocomialis strain 2010S01-197 chromosome, complete genome	4231974	1247253	1250885	4231974		Acinetobacter_phage(66.67%)	8	NA	NA
AZC09414.1|1247253_1247838_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	1.7e-111
AZC09415.1|1247952_1248222_-	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	97.8	5.6e-41
AZC09416.1|1248256_1249054_-	hypothetical protein	NA	A0A0E3M3Z6	Verrucomicrobia_phage	50.6	7.5e-65
AZC09417.1|1249050_1249353_-	hypothetical protein	NA	NA	NA	NA	NA
AZC09418.1|1249349_1249559_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	91.2	5.9e-30
AZC09419.1|1249555_1249993_-	DUF551 domain-containing protein	NA	A0A1B1P9F6	Acinetobacter_phage	76.6	9.2e-33
AZC09420.1|1250004_1250268_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10789.1|1250264_1250885_-	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	65.1	5.6e-76
>prophage 4
CP033561	Acinetobacter nosocomialis strain 2010S01-197 chromosome, complete genome	4231974	1254293	1264689	4231974	terminase	Acinetobacter_phage(81.82%)	19	NA	NA
AZC09424.1|1254293_1254521_-	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	96.9	1.9e-26
AZC09425.1|1255381_1255570_+	hypothetical protein	NA	NA	NA	NA	NA
AZC10791.1|1255588_1255888_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09426.1|1256830_1257604_+	hypothetical protein	NA	A0A2H4JAL8	uncultured_Caudovirales_phage	57.5	6.8e-71
AZC09427.1|1258340_1258628_+	hypothetical protein	NA	A0A1B1P9H6	Acinetobacter_phage	33.7	5.3e-05
AZC09428.1|1258788_1259004_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09429.1|1259183_1259387_+	hypothetical protein	NA	A0A1J0MGM9	Acinetobacter_phage	47.6	4.0e-07
AZC09430.1|1259447_1259786_+	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	39.2	2.5e-09
AZC09431.1|1260325_1260559_+	hypothetical protein	NA	A0A0P0J0G5	Acinetobacter_phage	79.7	1.1e-19
AZC09432.1|1260555_1260858_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09433.1|1260854_1261106_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09434.1|1261105_1261390_+	hypothetical protein	NA	K4I378	Acinetobacter_phage	61.1	1.5e-28
AZC09435.1|1261399_1261963_+	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	63.3	5.3e-57
AZC09436.1|1262089_1262332_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09437.1|1262469_1262655_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09438.1|1262825_1263110_+	hypothetical protein	NA	A0A0D4DC07	Acinetobacter_phage	80.2	3.0e-37
AZC09439.1|1263133_1263394_+	hypothetical protein	NA	NA	NA	NA	NA
AZC09440.1|1263446_1263929_+	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	67.5	5.3e-58
AZC09441.1|1264089_1264689_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	51.6	7.6e-38
>prophage 5
CP033561	Acinetobacter nosocomialis strain 2010S01-197 chromosome, complete genome	4231974	2760761	2823310	4231974	integrase,transposase,tRNA,terminase,head	Acinetobacter_phage(26.09%)	51	2765870:2765925	2806822:2806877
AZC10082.1|2760761_2761508_-	LPS export ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.0	8.6e-23
AZC10083.1|2761507_2762056_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AZC10084.1|2762039_2762588_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AZC10085.1|2762625_2763165_-	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
AZC10848.1|2763168_2764146_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A0A0Q3B9	Pectobacterium_bacteriophage	33.7	6.6e-23
AZC10086.1|2764437_2765781_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.7	2.0e-54
2765870:2765925	attL	ATAACCTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCAAAATT	NA	NA	NA	NA
AZC10087.1|2766134_2767148_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	40.3	1.0e-66
AZC10088.1|2767176_2767374_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	71.1	3.1e-12
AZC10849.1|2768138_2768510_-	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	52.0	1.2e-30
AZC10089.1|2770961_2771201_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10090.1|2778383_2778572_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10091.1|2778622_2778817_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10092.1|2781710_2782181_-	DUF2833 domain-containing protein	NA	W6MW30	Pseudomonas_phage	28.8	9.3e-15
AZC10093.1|2782177_2784214_-	hypothetical protein	NA	Q775D1	Bordetella_phage	39.6	1.4e-131
AZC10094.1|2784775_2785081_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10095.1|2785093_2785498_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10096.1|2785511_2786534_-	hypothetical protein	NA	Q775C7	Bordetella_phage	50.6	3.5e-91
AZC10097.1|2786545_2787199_-	hypothetical protein	NA	G9L6C4	Escherichia_phage	34.9	1.4e-13
AZC10850.1|2789183_2789474_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10098.1|2789546_2791169_-|terminase	terminase	terminase	Q775B9	Bordetella_phage	59.9	1.1e-184
AZC10099.1|2791152_2791422_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10100.1|2791418_2791859_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10101.1|2791885_2792602_-|terminase	terminase small subunit	terminase	A0A1Y0SUQ3	Pseudomonas_phage	45.9	2.6e-45
AZC10102.1|2792821_2793250_-	hypothetical protein	NA	A0A0P0HSP6	Acinetobacter_phage	73.4	2.8e-50
AZC10103.1|2794025_2794910_-	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
AZC10104.1|2794906_2795275_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10105.1|2795271_2796849_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	51.2	1.8e-134
AZC10106.1|2796845_2797067_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10107.1|2797115_2797481_-	transcriptional regulator	NA	J7I452	Acinetobacter_phage	81.2	7.4e-44
AZC10108.1|2797489_2797678_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10109.1|2797781_2798507_+	helix-turn-helix domain-containing protein	NA	A0A0P0I8E0	Acinetobacter_phage	49.6	3.1e-62
AZC10110.1|2798509_2798815_+	bZIP transcription factor	NA	NA	NA	NA	NA
AZC10111.1|2798979_2799354_+	hypothetical protein	NA	C5IHK2	Burkholderia_virus	35.6	8.7e-08
AZC10112.1|2799422_2800301_+	DUF2303 family protein	NA	I6NVL7	Burkholderia_virus	34.9	1.6e-28
AZC10851.1|2800430_2801003_+	hypothetical protein	NA	NA	NA	NA	NA
AZC10113.1|2801004_2801343_+	hypothetical protein	NA	NA	NA	NA	NA
AZC10114.1|2801351_2802332_+	recombinase	NA	A0A0A7RWR9	Clostridium_phage	35.7	1.4e-49
AZC10115.1|2804828_2805062_+	protein ninH	NA	NA	NA	NA	NA
AZC10116.1|2805733_2806030_+	hypothetical protein	NA	NA	NA	NA	NA
AZC10117.1|2809493_2810087_-	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
2806822:2806877	attR	ATAACCTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCAAAATT	NA	NA	NA	NA
AZC10118.1|2811147_2811912_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10119.1|2812255_2812579_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10120.1|2812627_2813734_-|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	65.5	1.2e-142
AZC10121.1|2815405_2816431_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.8	2.1e-51
AZC10122.1|2816488_2816608_+	hypothetical protein	NA	NA	NA	NA	NA
AZC10123.1|2817246_2817498_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10124.1|2817780_2818002_-	hypothetical protein	NA	NA	NA	NA	NA
AZC10125.1|2819296_2819512_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	4.5e-17
AZC10126.1|2820027_2820645_+	LysE family translocator	NA	NA	NA	NA	NA
AZC10127.1|2821298_2821688_-	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	72.8	4.8e-49
AZC10852.1|2823079_2823310_-|transposase	transposase	transposase	NA	NA	NA	NA
