The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029985	Sphingomonas sp. FARSPH chromosome, complete genome	3345474	311997	328875	3345474	tRNA	Methanothermobacter_phage(10.0%)	15	NA	NA
AXJ94370.1|311997_313230_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.6	1.4e-38
AXJ94371.1|313239_313683_+	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	57.7	1.1e-38
AXJ96782.1|313742_314081_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ94372.1|314088_314862_+	molybdopterin biosynthesis protein MoeB	NA	A0A291ATS8	Pandoravirus	35.7	9.6e-09
AXJ94373.1|314866_315736_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	47.5	1.4e-64
AXJ94374.1|315868_317005_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	NA	NA	NA	NA
AXJ94375.1|316988_318287_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HZW8	Acanthocystis_turfacea_Chlorella_virus	26.8	2.6e-22
AXJ94376.1|318371_319133_+	serine/threonine protein phosphatase	NA	V9QL63	Rhizobium_phage	33.2	1.8e-20
AXJ94377.1|319338_319563_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ94378.1|319787_320354_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXJ94379.1|320454_320661_-	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	50.8	1.3e-05
AXJ94380.1|320823_322251_+|tRNA	cysteine--tRNA ligase	tRNA	F1C984	Moumouvirus	28.5	2.5e-26
AXJ94381.1|322247_323186_+	D-2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	24.4	2.4e-06
AXJ94382.1|323314_324286_-	peptidase M48 family protein	NA	NA	NA	NA	NA
AXJ94383.1|324720_328875_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0K9	Chrysochromulina_ericina_virus	28.9	1.8e-24
>prophage 2
CP029985	Sphingomonas sp. FARSPH chromosome, complete genome	3345474	1589963	1653338	3345474	protease,capsid,portal,head,tail	Tupanvirus(14.29%)	54	NA	NA
AXJ95438.1|1589963_1590587_-|tail	phage tail protein	tail	E3T4R8	Cafeteria_roenbergensis_virus	42.6	6.1e-14
AXJ95439.1|1590863_1604945_+	hypothetical protein	NA	F8S0S2	Gordonia_phage	64.7	5.8e-11
AXJ95440.1|1605016_1605709_+	PAP2 family protein	NA	NA	NA	NA	NA
AXJ95441.1|1605705_1606704_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	33.6	2.0e-38
AXJ95442.1|1606775_1607321_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AXJ95443.1|1607367_1608255_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	36.6	2.7e-31
AXJ95444.1|1608329_1610033_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXJ95445.1|1610231_1611062_+	acetyltransferase	NA	NA	NA	NA	NA
AXJ95446.1|1611185_1611542_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXJ95447.1|1611579_1612158_-	nitroreductase	NA	NA	NA	NA	NA
AXJ95448.1|1612375_1613971_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	37.6	7.9e-74
AXJ96927.1|1614071_1615064_-	aldo/keto reductase	NA	NA	NA	NA	NA
AXJ95449.1|1615041_1616292_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AXJ95450.1|1616348_1617692_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXJ95451.1|1617691_1617916_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AXJ95452.1|1618202_1618970_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AXJ95453.1|1618957_1619575_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.4	7.1e-23
AXJ95454.1|1619794_1620970_+	site-specific DNA-methyltransferase	NA	A0A249XUJ2	Enterococcus_phage	30.6	1.0e-25
AXJ95455.1|1621107_1622163_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.6	2.0e-17
AXJ95456.1|1622266_1623151_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ95457.1|1623173_1624586_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXJ95458.1|1624766_1624871_+	aa3-type cytochrome c oxidase subunit IV	NA	NA	NA	NA	NA
AXJ95459.1|1624884_1626009_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit alpha	NA	NA	NA	NA	NA
AXJ95460.1|1626195_1626495_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AXJ95461.1|1626599_1628099_+	NAD synthetase	NA	NA	NA	NA	NA
AXJ95462.1|1628227_1629184_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXJ95463.1|1629339_1630080_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ95464.1|1630087_1631296_-	toxic anion resistance protein	NA	NA	NA	NA	NA
AXJ95465.1|1631612_1632509_-	EamA family transporter	NA	NA	NA	NA	NA
AXJ95466.1|1632524_1633094_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
AXJ95467.1|1633229_1635053_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	38.9	1.2e-22
AXJ95468.1|1635171_1637511_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXJ95469.1|1637841_1638192_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ96928.1|1638300_1638597_+	DUF3297 domain-containing protein	NA	NA	NA	NA	NA
AXJ95470.1|1638652_1638988_-	transcriptional regulator	NA	NA	NA	NA	NA
AXJ95471.1|1639101_1640013_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.6	1.0e-25
AXJ95472.1|1640867_1642730_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	30.7	6.4e-67
AXJ95473.1|1642812_1643376_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXJ96929.1|1643469_1643901_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ95474.1|1643989_1644961_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
AXJ95475.1|1645074_1645257_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ95476.1|1645341_1645662_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ95477.1|1645641_1646325_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ95478.1|1646578_1647112_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ95479.1|1647111_1648473_+	ATP-binding protein	NA	A0A1V0DY66	Dinoroseobacter_phage	38.6	2.2e-61
AXJ95480.1|1648558_1649668_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	35.5	8.8e-48
AXJ95481.1|1649664_1649955_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ96930.1|1649951_1650329_+|head,protease	HK97 family phage prohead protease	head,protease	NA	NA	NA	NA
AXJ95482.1|1650360_1651356_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	48.3	1.1e-78
AXJ95483.1|1651424_1651946_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ95484.1|1651960_1652341_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ96931.1|1652395_1652803_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
AXJ95485.1|1652799_1653138_+	gene transfer agent family protein	NA	NA	NA	NA	NA
AXJ95486.1|1653140_1653338_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
>prophage 1
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	0	6521	265221	transposase	uncultured_virus(100.0%)	6	NA	NA
AXJ97176.1|946_1543_-	methyltransferase	NA	NA	NA	NA	NA
AXJ97177.1|1539_2193_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
AXJ97178.1|2189_3176_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXJ97390.1|3172_4177_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AXJ97179.1|4406_4547_+	transthyretin family protein	NA	NA	NA	NA	NA
AXJ97180.1|5321_6521_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	1.6e-42
>prophage 2
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	9776	12770	265221		Enterococcus_phage(100.0%)	1	NA	NA
AXJ97184.1|9776_12770_-	hypothetical protein	NA	A0A1G5S9X8	Enterococcus_phage	25.4	5.0e-05
>prophage 3
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	21513	22662	265221		Yersinia_phage(100.0%)	1	NA	NA
AXJ97391.1|21513_22662_-	chromosome partitioning protein	NA	Q7Y3Y6	Yersinia_phage	32.3	8.9e-43
>prophage 4
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	49217	51698	265221		uncultured_virus(100.0%)	1	NA	NA
AXJ97222.1|49217_51698_+	haloacid dehalogenase	NA	A0A218MNH6	uncultured_virus	36.7	8.2e-86
>prophage 5
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	57179	58202	265221		Tupanvirus(100.0%)	1	NA	NA
AXJ97229.1|57179_58202_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	28.0	2.6e-30
>prophage 6
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	61813	62308	265221		Pandoravirus(100.0%)	1	NA	NA
AXJ97233.1|61813_62308_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	36.6	2.1e-09
>prophage 7
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	67283	69176	265221	transposase	Stx2-converting_phage(100.0%)	2	NA	NA
AXJ97235.1|67283_67631_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	60.7	4.7e-32
AXJ97394.1|67742_69176_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	1.2e-129
>prophage 8
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	85041	88859	265221		Bacillus_virus(50.0%)	3	NA	NA
AXJ97251.1|85041_85497_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	33.1	8.7e-10
AXJ97252.1|85611_86361_-	HAD family hydrolase	NA	NA	NA	NA	NA
AXJ97253.1|86357_88859_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.0	2.9e-123
>prophage 9
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	108509	109067	265221		Lactococcus_phage(100.0%)	1	NA	NA
AXJ97400.1|108509_109067_-	hypothetical protein	NA	A0A059NT77	Lactococcus_phage	35.0	2.1e-26
>prophage 10
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	133925	142771	265221	transposase	Burkholderia_phage(33.33%)	7	NA	NA
AXJ97291.1|133925_134546_-	transposon DNA-invertase	NA	E5FFF9	Burkholderia_phage	49.2	1.3e-37
AXJ97292.1|134671_137563_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	38.6	3.5e-189
AXJ97293.1|137596_138013_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AXJ97294.1|138086_139334_-	cytochrome P450	NA	NA	NA	NA	NA
AXJ97295.1|139546_140068_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97296.1|140120_140504_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AXJ97403.1|140500_142771_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.4	8.9e-87
>prophage 11
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	162764	163532	265221		Salicola_phage(100.0%)	1	NA	NA
AXJ97316.1|162764_163532_-	glutaredoxin family protein	NA	A0A248SKD6	Salicola_phage	39.3	2.2e-05
>prophage 12
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	176117	176762	265221		Shigella_phage(100.0%)	1	NA	NA
AXJ97407.1|176117_176762_-	transposon DNA-invertase	NA	A0A0C4UR34	Shigella_phage	55.6	3.6e-33
>prophage 13
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	182442	190980	265221	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
AXJ97335.1|182442_185640_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	21.9	1.1e-55
AXJ97409.1|185624_187058_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	1.2e-129
AXJ97336.1|187169_187517_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	60.7	4.7e-32
AXJ97337.1|187513_187939_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97338.1|188097_188808_-	VIT family protein	NA	NA	NA	NA	NA
AXJ97410.1|188972_189980_-	sensor histidine kinase	NA	NA	NA	NA	NA
AXJ97339.1|190293_190980_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	29.6	4.4e-21
>prophage 14
CP029986	Sphingomonas sp. FARSPH plasmid p01, complete sequence	265221	210103	262533	265221	transposase	Leptospira_phage(21.43%)	43	NA	NA
AXJ97356.1|210103_210451_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	60.7	4.7e-32
AXJ97412.1|210562_211996_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	1.2e-129
AXJ97357.1|212647_213818_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	27.1	7.5e-13
AXJ97358.1|213912_214620_-	phosphoesterase PA-phosphatase	NA	NA	NA	NA	NA
AXJ97359.1|214607_215201_-	DedA family protein	NA	NA	NA	NA	NA
AXJ97413.1|215356_216337_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXJ97360.1|216336_219483_+	AcrB/AcrD/AcrF family protein	NA	S5VL66	Leptospira_phage	19.3	3.3e-15
AXJ97361.1|219479_220859_+	TolC family protein	NA	NA	NA	NA	NA
AXJ97362.1|220868_221543_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.9	7.3e-29
AXJ97414.1|221542_222901_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXJ97363.1|223023_223554_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXJ97364.1|223615_224566_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97365.1|224468_226883_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXJ97366.1|226854_227367_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97367.1|228125_228881_+	DUF2334 domain-containing protein	NA	NA	NA	NA	NA
AXJ97368.1|228884_230045_+	glycosyltransferase	NA	NA	NA	NA	NA
AXJ97369.1|230194_231013_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97370.1|231009_231513_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97371.1|231515_232322_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97415.1|232346_233546_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	1.6e-42
AXJ97372.1|233545_234001_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97373.1|233936_235196_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97374.1|235311_235593_+	peptidase M4	NA	NA	NA	NA	NA
AXJ97416.1|235601_236279_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.1	1.1e-27
AXJ97375.1|236271_237615_+	histidine kinase	NA	NA	NA	NA	NA
AXJ97376.1|237611_238958_+	TolC family protein	NA	NA	NA	NA	NA
AXJ97377.1|238945_239980_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXJ97378.1|239976_243024_+	AcrB/AcrD/AcrF family protein	NA	S5VL66	Leptospira_phage	27.1	6.9e-18
AXJ97379.1|243020_243812_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.0	3.7e-24
AXJ97380.1|243790_244291_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97417.1|244556_245519_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
AXJ97381.1|245647_245917_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	44.8	3.2e-12
AXJ97382.1|246350_246800_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97383.1|247024_247246_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97384.1|247277_250211_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	34.3	2.1e-149
AXJ97418.1|250357_250954_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	45.2	2.3e-34
AXJ97385.1|251182_251806_+	carbonic anhydrase	NA	NA	NA	NA	NA
AXJ97419.1|251802_253386_-	MFS transporter	NA	NA	NA	NA	NA
AXJ97386.1|254166_255852_-	chloride channel protein	NA	NA	NA	NA	NA
AXJ97387.1|255992_256403_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXJ97388.1|256477_257059_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97389.1|259189_260545_-|transposase	IS1380-like element ISKpn23 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.9	5.9e-46
AXJ97420.1|261333_262533_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	1.6e-42
>prophage 1
CP029987	Sphingomonas sp. FARSPH plasmid p02, complete sequence	78167	0	1617	78167		Enterobacteria_phage(100.0%)	1	NA	NA
AXJ97423.1|738_1617_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	59.8	1.4e-96
>prophage 2
CP029987	Sphingomonas sp. FARSPH plasmid p02, complete sequence	78167	8638	9760	78167		Tupanvirus(100.0%)	1	NA	NA
AXJ97428.1|8638_9760_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.4	8.7e-11
>prophage 3
CP029987	Sphingomonas sp. FARSPH plasmid p02, complete sequence	78167	20386	21358	78167		Aeropyrum_coil-shaped_virus(100.0%)	1	NA	NA
AXJ97438.1|20386_21358_-	sugar dehydratase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	29.5	2.3e-23
>prophage 4
CP029987	Sphingomonas sp. FARSPH plasmid p02, complete sequence	78167	31168	32122	78167		Tupanvirus(100.0%)	1	NA	NA
AXJ97477.1|31168_32122_+	SDR family NAD-dependent epimerase/dehydratase	NA	A0A2K9KZK0	Tupanvirus	49.4	7.3e-83
>prophage 5
CP029987	Sphingomonas sp. FARSPH plasmid p02, complete sequence	78167	39618	40347	78167		Moumouvirus(100.0%)	1	NA	NA
AXJ97452.1|39618_40347_+	SAM-dependent methyltransferase	NA	M1PB85	Moumouvirus	30.0	2.5e-14
>prophage 6
CP029987	Sphingomonas sp. FARSPH plasmid p02, complete sequence	78167	44122	46204	78167		Synechococcus_phage(50.0%)	2	NA	NA
AXJ97454.1|44122_45187_+	GDP-mannose 4,6-dehydratase	NA	A0A0E3G468	Synechococcus_phage	64.5	4.2e-124
AXJ97455.1|45271_46204_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	49.7	7.3e-88
>prophage 7
CP029987	Sphingomonas sp. FARSPH plasmid p02, complete sequence	78167	49728	51957	78167		Streptococcus_phage(100.0%)	1	NA	NA
AXJ97459.1|49728_51957_+	exopolysaccharide biosynthesis protein	NA	A0A1X9I5D6	Streptococcus_phage	28.6	2.6e-14
>prophage 8
CP029987	Sphingomonas sp. FARSPH plasmid p02, complete sequence	78167	60291	77970	78167	transposase	Paenibacillus_phage(22.22%)	16	NA	NA
AXJ97479.1|60291_60852_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	33.6	1.2e-08
AXJ97463.1|60802_61228_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97464.1|61224_61572_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	60.7	4.7e-32
AXJ97465.1|62462_65324_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	38.2	2.8e-178
AXJ97466.1|65449_66070_+	transposon DNA-invertase	NA	E5FFF9	Burkholderia_phage	49.2	1.3e-37
AXJ97467.1|66254_67394_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97468.1|68602_69363_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	33.9	2.5e-09
AXJ97469.1|69540_70917_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXJ97470.1|71475_71661_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97471.1|71951_72239_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97480.1|72235_72898_-	ParA family protein	NA	D4HTX7	Vibrio_phage	27.5	1.1e-10
AXJ97472.1|73137_73983_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXJ97481.1|74531_75434_-	RepA family protein	NA	A0A0K1LLD0	Rhodobacter_phage	30.6	3.1e-27
AXJ97473.1|75810_76158_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97474.1|76343_76910_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	42.4	4.5e-32
AXJ97475.1|76920_77970_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.6	8.5e-93
>prophage 1
CP029988	Sphingomonas sp. FARSPH plasmid p03, complete sequence	72676	0	72464	72676	transposase,integrase	Escherichia_phage(19.05%)	67	788:847	66335:67154
788:847	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AXJ97483.1|839_1544_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXJ97541.1|1946_2177_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97484.1|3498_3756_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97485.1|3887_4280_-	hypothetical protein	NA	L7TKV8	Rhizobium_phage	32.8	8.6e-06
AXJ97486.1|4829_5153_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97487.1|5408_5621_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97488.1|5850_7317_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AXJ97489.1|7420_7906_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97490.1|7910_9752_-|integrase	integrase	integrase	NA	NA	NA	NA
AXJ97491.1|9748_11497_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97492.1|11489_12641_-|transposase	transposase	transposase	NA	NA	NA	NA
AXJ97493.1|13313_13505_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97494.1|13849_14191_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97495.1|14190_14439_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97496.1|14441_14639_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97497.1|14635_15055_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97498.1|15023_15347_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97499.1|15403_16357_-	antirestriction protein	NA	A0A1V0EEV1	Caulobacter_phage	44.1	3.6e-58
AXJ97542.1|16681_17002_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97543.1|17160_17718_-	thermonuclease family protein	NA	NA	NA	NA	NA
AXJ97544.1|17756_18443_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97500.1|18739_19027_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97501.1|19213_19894_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97502.1|19890_20265_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97545.1|20349_20673_+	type VI secretion protein	NA	NA	NA	NA	NA
AXJ97503.1|20701_23056_+	transporter	NA	NA	NA	NA	NA
AXJ97546.1|23117_23786_+	type IV secretion system protein VirB5	NA	NA	NA	NA	NA
AXJ97504.1|23782_24094_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97505.1|24126_25170_+	type IV secretion system protein VirB6	NA	NA	NA	NA	NA
AXJ97506.1|25554_26247_+	virB8 family protein	NA	NA	NA	NA	NA
AXJ97507.1|26243_27095_+	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
AXJ97508.1|27096_28290_+	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
AXJ97509.1|28286_29300_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AXJ97510.1|29271_31083_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
AXJ97511.1|31123_31828_+	DNA primase	NA	NA	NA	NA	NA
AXJ97512.1|31824_32994_-	relaxase	NA	NA	NA	NA	NA
AXJ97513.1|32993_33518_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97514.1|33738_34653_-	chromosome partitioning protein ParB	NA	A0A240F4U0	Ochrobactrum_phage	33.1	1.4e-06
AXJ97515.1|34655_35390_-	ParA family protein	NA	B0ZSI1	Halomonas_phage	23.0	3.2e-06
AXJ97516.1|35888_36572_-	chromosome partitioning protein	NA	A0A0A8IL09	Aurantimonas_phage	43.4	1.7e-41
AXJ97517.1|36752_37076_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AXJ97518.1|37408_37894_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97519.1|37871_38738_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	40.6	6.7e-27
AXJ97520.1|41266_44272_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	46.8	3.0e-252
AXJ97521.1|44280_44898_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	53.0	6.2e-43
AXJ97522.1|46031_46226_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97523.1|46567_47629_+	plasmid replication initiator	NA	A0A0K1Y6J9	Rhodobacter_phage	47.4	2.4e-79
AXJ97524.1|47884_48130_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	59.7	3.0e-17
AXJ97525.1|48194_49568_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97526.1|49568_50138_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	46.7	3.7e-34
AXJ97527.1|50277_53253_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	1.1e-196
AXJ97547.1|53284_53404_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97528.1|54141_55326_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXJ97529.1|55330_58543_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.1	8.0e-41
AXJ97530.1|58535_60011_+	RND transporter	NA	NA	NA	NA	NA
AXJ97531.1|60007_60652_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AXJ97548.1|60645_61485_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXJ97532.1|62877_63492_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
AXJ97533.1|63556_64685_+|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
AXJ97534.1|64792_65596_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AXJ97535.1|66386_67091_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXJ97536.1|67198_68059_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
66335:67154	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
AXJ97537.1|68071_68365_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ97538.1|68396_69555_+|transposase	IS3-like element ISKpn11 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	32.3	1.5e-18
AXJ97539.1|70079_70631_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ97540.1|70698_71459_-|transposase	IS5-like element ISKpn12 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	2.0e-11
AXJ97549.1|71759_72464_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
