The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025838	Streptococcus pneumoniae strain SPN XDR SMC1710-32 chromosome, complete genome	2057144	7088	16738	2057144		Streptococcus_phage(55.56%)	14	NA	NA
AXJ89366.1|7088_8558_-	DNA primase	NA	Q9AZI5	Lactococcus_phage	34.5	6.8e-64
AXJ89367.1|8610_9471_-	hypothetical protein	NA	A0A1X9I6L2	Streptococcus_phage	74.5	6.5e-123
AXJ87480.1|9610_9886_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	56.8	5.6e-20
AXJ87481.1|9878_10220_-	DNA-binding protein	NA	NA	NA	NA	NA
AXJ87482.1|10200_10494_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ87483.1|10490_10706_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ87484.1|10707_10908_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ89368.1|10904_11300_-	hypothetical protein	NA	A7J274	Streptococcus_phage	34.8	1.3e-06
AXJ87485.1|11808_12435_-	hypothetical protein	NA	R9QNB1	Lactococcus_phage	40.8	6.1e-30
AXJ87486.1|12524_12758_-	XRE family transcriptional regulator	NA	Q38329	Lactococcus_phage	50.0	6.4e-09
AXJ87487.1|12914_13871_+	XRE family transcriptional regulator	NA	A0A060QNS7	Streptococcus_phage	41.0	5.5e-14
AXJ87488.1|14019_15024_+	DNA-binding protein	NA	Q331X4	Clostridium_botulinum_C_phage	28.9	3.4e-14
AXJ87489.1|15023_15476_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AXJ87490.1|15571_16738_+	tyrosine recombinase XerS	NA	A0A1X9I5Y5	Streptococcus_phage	51.5	5.9e-103
>prophage 2
CP025838	Streptococcus pneumoniae strain SPN XDR SMC1710-32 chromosome, complete genome	2057144	58910	70366	2057144		Cyanophage(33.33%)	8	NA	NA
AXJ87524.1|58910_61064_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.2	4.2e-46
AXJ87525.1|61076_62426_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AXJ87526.1|62553_63303_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SE76	Cyanophage	40.1	3.7e-42
AXJ89372.1|63304_63448_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
AXJ87527.1|63504_67230_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.6	3.6e-37
AXJ87528.1|67322_68765_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.7e-55
AXJ87529.1|68801_69824_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.9	1.2e-64
AXJ87530.1|69820_70366_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	7.4e-24
>prophage 4
CP025838	Streptococcus pneumoniae strain SPN XDR SMC1710-32 chromosome, complete genome	2057144	789981	851755	2057144	tRNA,protease,integrase,transposase	Streptococcus_phage(45.83%)	54	812113:812162	846580:846629
AXJ88196.1|789981_791196_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AXJ88197.1|791330_792155_+	esterase	NA	NA	NA	NA	NA
AXJ88198.1|792167_793334_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AXJ88199.1|793841_795335_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	31.7	4.0e-35
AXJ88200.1|795347_796271_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AXJ88201.1|796362_796599_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AXJ88202.1|796595_797009_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	38.5	3.1e-14
AXJ88203.1|797126_798092_+|integrase	integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.6	1.4e-33
AXJ88204.1|798125_799169_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AXJ88205.1|799198_802549_+	DUF4145 domain-containing protein	NA	A0A2I7RGD1	Vibrio_phage	25.2	9.6e-13
AXJ88206.1|803054_803525_-	arginine repressor	NA	NA	NA	NA	NA
AXJ88207.1|803541_805815_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
AXJ88208.1|806133_809262_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	32.8	3.1e-114
AXJ88209.1|809344_810352_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AXJ88210.1|810410_811916_+	pyruvate kinase	NA	NA	NA	NA	NA
812113:812162	attL	CCTGCGGCTAGCTTCCTAGTTTGCTCTTTGATTTTCATTGAGTATGAAAT	NA	NA	NA	NA
AXJ88211.1|812225_812474_-|integrase	integrase	integrase	A0A1S5S8R9	Streptococcus_phage	52.1	1.7e-12
AXJ88212.1|813021_813276_-	phage repressor protein	NA	B3GVX0	Streptococcus_phage	61.2	3.3e-19
AXJ88213.1|813711_814584_+	DUF4300 domain-containing protein	NA	NA	NA	NA	NA
AXJ88214.1|815216_815528_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ88215.1|815531_816248_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXJ88216.1|816369_817626_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	97.1	4.5e-234
AXJ88217.1|817798_818614_-	TIGR03943 family protein	NA	NA	NA	NA	NA
AXJ88218.1|818610_819516_-	permease	NA	NA	NA	NA	NA
AXJ88219.1|819516_819648_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ88220.1|819972_822102_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AXJ88221.1|822088_822538_+	SprT family protein	NA	NA	NA	NA	NA
AXJ88222.1|822566_822869_+	PspC domain-containing protein	NA	NA	NA	NA	NA
AXJ88223.1|823222_823414_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ88224.1|823841_824600_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	7.7e-27
AXJ88225.1|824601_826590_+	ABC transporter permease	NA	NA	NA	NA	NA
AXJ88226.1|827300_828296_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.4e-33
AXJ88227.1|828528_828711_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ88228.1|829002_830478_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
AXJ88229.1|831413_832274_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	30.0	1.0e-11
AXJ88230.1|833528_834656_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
AXJ88231.1|834652_835738_+	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	47.5	1.6e-89
AXJ88232.1|835747_836623_+	N-carbamoylputrescine amidase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	50.0	1.9e-77
AXJ88233.1|836803_837613_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AXJ88234.1|837884_838106_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ88235.1|838159_838831_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXJ88236.1|839072_839981_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.7	3.1e-06
AXJ88237.1|839977_840439_+	signal peptidase II	NA	NA	NA	NA	NA
AXJ88238.1|840428_841316_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.5	3.8e-09
AXJ88239.1|841318_843202_+	MBL fold metallo-hydrolase	NA	I2E8W4	Clostridium_phage	25.2	1.7e-14
AXJ88240.1|843281_844412_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.4	1.1e-114
AXJ88241.1|844421_845684_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	64.8	5.0e-140
AXJ88242.1|845687_846485_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	50.9	1.1e-60
AXJ88243.1|846706_847345_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	68.1	1.7e-75
846580:846629	attR	CCTGCGGCTAGCTTCCTAGTTTGCTCTTTGATTTTCATTGAGTATGAAAT	NA	NA	NA	NA
AXJ88244.1|847341_848232_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	51.4	1.4e-72
AXJ88245.1|848271_848589_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.0	2.9e-28
AXJ88246.1|848591_849461_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.7	3.8e-115
AXJ88247.1|849687_850206_+	cytoplasmic protein	NA	NA	NA	NA	NA
AXJ88248.1|850314_850962_+	hypothetical protein	NA	A0A2P0VK56	Streptococcus_phage	33.7	7.0e-13
AXJ88249.1|850950_851755_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP025838	Streptococcus pneumoniae strain SPN XDR SMC1710-32 chromosome, complete genome	2057144	1065367	1126351	2057144	bacteriocin,protease,transposase,holin,tRNA	Bacillus_virus(14.29%)	53	NA	NA
AXJ88437.1|1065367_1065670_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXJ88438.1|1065910_1066789_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	A0A1V0SF38	Hokovirus	24.3	4.3e-05
AXJ88439.1|1066798_1068073_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
AXJ88440.1|1069576_1070374_-	formate-nitrite transporter	NA	NA	NA	NA	NA
AXJ88441.1|1070617_1071361_-	sortase	NA	NA	NA	NA	NA
AXJ88442.1|1071360_1073829_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.5	4.6e-105
AXJ88443.1|1074022_1075009_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AXJ88444.1|1075345_1076041_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	44.0	5.4e-19
AXJ88445.1|1076087_1076351_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	50.0	9.4e-17
AXJ88446.1|1076343_1076646_-	antitoxin	NA	NA	NA	NA	NA
AXJ88447.1|1076779_1078036_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	96.7	6.6e-233
AXJ88448.1|1078099_1078909_-	MBL fold metallo-hydrolase	NA	A0A0C5AFC1	Paenibacillus_phage	39.0	1.8e-34
AXJ88449.1|1078910_1080260_-	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	34.0	5.2e-34
AXJ88450.1|1080252_1080957_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.8	2.8e-39
AXJ88451.1|1081012_1082188_-	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	29.8	8.8e-22
AXJ88452.1|1082515_1084186_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AXJ89404.1|1084415_1085105_+	phosphopantothenate--cysteine ligase	NA	Q9HH70	Methanothermobacter_phage	31.6	6.5e-17
AXJ88453.1|1085116_1085668_+	phosphopantothenoylcysteine decarboxylase	NA	A0A1V0S7W6	Shearwaterpox_virus	36.1	3.1e-25
AXJ88454.1|1085651_1086215_+	ECF transporter S component	NA	NA	NA	NA	NA
AXJ88455.1|1086496_1087024_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ88456.1|1087035_1087551_+	transcription repressor NadR	NA	NA	NA	NA	NA
AXJ88457.1|1087547_1088015_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
AXJ88458.1|1088087_1088576_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXJ88459.1|1088541_1089105_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXJ88460.1|1089114_1091103_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AXJ88461.1|1091179_1092133_-|protease	CPBP family intramembrane metalloprotease domain-containing protein	protease	NA	NA	NA	NA
AXJ88462.1|1092305_1094471_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXJ88463.1|1094470_1095211_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	5.3e-33
AXJ88464.1|1095359_1096847_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	32.9	2.2e-70
AXJ88465.1|1096890_1098111_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AXJ88466.1|1098114_1098933_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AXJ88467.1|1098932_1099727_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AXJ88468.1|1099723_1103263_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AXJ88469.1|1103253_1103952_-	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	35.2	2.2e-28
AXJ88470.1|1104269_1105256_-	guanosine monophosphate reductase	NA	G3MBI2	Bacillus_virus	72.2	1.4e-137
AXJ88471.1|1105430_1106774_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AXJ88472.1|1106733_1108668_-	endonuclease	NA	K4I1H4	Acidithiobacillus_phage	33.1	1.2e-15
AXJ88473.1|1109718_1110078_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AXJ88474.1|1110081_1110351_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AXJ88475.1|1111395_1112490_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	37.5	9.1e-05
AXJ88476.1|1112508_1113165_-	MmcQ family protein	NA	NA	NA	NA	NA
AXJ88477.1|1113208_1113841_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXJ88478.1|1113933_1114293_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AXJ88479.1|1114398_1116486_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.3	2.5e-104
AXJ88480.1|1116653_1117697_-	TIGR00341 family protein	NA	NA	NA	NA	NA
AXJ88481.1|1118581_1119430_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.5	4.2e-34
AXJ88482.1|1119525_1120215_-|holin	CTP--phosphocholine cytidylyltransferase	holin	G3MA50	Bacillus_virus	48.6	9.5e-08
AXJ88483.1|1120226_1121117_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AXJ88484.1|1121094_1121964_-|holin	choline kinase	holin	NA	NA	NA	NA
AXJ88485.1|1121980_1123003_-	ribitol-5-phosphate dehydrogenase	NA	NA	NA	NA	NA
AXJ88486.1|1123007_1123715_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AXJ88487.1|1124050_1125538_+	virulence factor MviN	NA	NA	NA	NA	NA
AXJ88488.1|1125547_1126351_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	27.1	4.0e-10
>prophage 6
CP025838	Streptococcus pneumoniae strain SPN XDR SMC1710-32 chromosome, complete genome	2057144	1159658	1188469	2057144	protease,integrase,transposase	Streptococcus_phage(88.0%)	34	1152858:1152872	1190461:1190475
1152858:1152872	attL	TGCAGCTGAAAAAGC	NA	NA	NA	NA
AXJ88520.1|1159658_1159973_+	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
AXJ88521.1|1159988_1160375_+	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
AXJ88522.1|1160403_1161789_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
AXJ88523.1|1161965_1163384_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	1.5e-233
AXJ88524.1|1163432_1163516_+	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
AXJ88525.1|1163640_1164378_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	3.1e-134
AXJ88526.1|1164382_1164514_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	100.0	7.9e-17
AXJ88527.1|1164634_1165882_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.9	3.9e-12
AXJ88528.1|1166061_1166283_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
AXJ88529.1|1166399_1166897_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
AXJ88530.1|1166871_1167378_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
AXJ88531.1|1167361_1169809_+	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
AXJ88532.1|1169811_1171989_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	99.9	0.0e+00
AXJ88533.1|1171985_1172987_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
AXJ88534.1|1172983_1173871_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	93.9	1.4e-157
AXJ88535.1|1174145_1174232_+	tetracycline resistance protein	NA	NA	NA	NA	NA
AXJ88536.1|1174247_1176167_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	97.3	0.0e+00
AXJ88537.1|1176267_1176453_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
AXJ88538.1|1177065_1177149_+	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
AXJ88539.1|1177273_1178011_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	1.4e-134
AXJ88540.1|1178015_1178147_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	90.7	8.2e-14
AXJ88541.1|1178365_1178920_+	resolvase	NA	A0A0F7LA37	Escherichia_phage	52.1	2.3e-36
AXJ88542.1|1178923_1181842_+|transposase	DDE transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.1	1.1e-169
AXJ89408.1|1182341_1182413_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ88543.1|1182641_1183064_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
AXJ88544.1|1183060_1183291_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
AXJ88545.1|1183516_1183768_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ88546.1|1183751_1183955_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
AXJ88547.1|1184036_1185254_+|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
AXJ88548.1|1185468_1186056_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXJ88549.1|1186058_1186292_-	transcriptional regulator	NA	NA	NA	NA	NA
AXJ88550.1|1186304_1186685_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ88551.1|1186677_1187127_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ88552.1|1187110_1188469_-	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	56.3	3.9e-130
1190461:1190475	attR	GCTTTTTCAGCTGCA	NA	NA	NA	NA
>prophage 7
CP025838	Streptococcus pneumoniae strain SPN XDR SMC1710-32 chromosome, complete genome	2057144	1283418	1289197	2057144		Streptococcus_phage(50.0%)	9	NA	NA
AXJ88647.1|1283418_1284030_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.4	4.9e-16
AXJ88648.1|1284074_1284803_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AXJ88649.1|1284841_1285753_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.5	5.9e-90
AXJ88650.1|1285818_1286055_-	DUF4059 domain-containing protein	NA	NA	NA	NA	NA
AXJ88651.1|1286120_1286864_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	40.5	4.7e-29
AXJ88652.1|1286863_1287664_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXJ88653.1|1287821_1288178_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	57.3	1.2e-33
AXJ88654.1|1288190_1288703_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	55.6	1.3e-46
AXJ88655.1|1288702_1289197_-	N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	52.1	1.9e-42
>prophage 8
CP025838	Streptococcus pneumoniae strain SPN XDR SMC1710-32 chromosome, complete genome	2057144	1352678	1425506	2057144	terminase,head,protease,holin,tRNA,tail,integrase	Streptococcus_phage(90.16%)	86	1360173:1360205	1433254:1433286
AXJ88715.1|1352678_1353428_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AXJ88716.1|1353481_1353841_-	RNA-binding protein	NA	NA	NA	NA	NA
AXJ88717.1|1353842_1355243_-	Cof-type HAD-IIB family hydrolase	NA	A0A1V0S9I2	Catovirus	44.6	2.0e-25
AXJ88718.1|1355537_1355777_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
AXJ88719.1|1355808_1356279_-	single-stranded DNA-binding protein	NA	A0A286QQM5	Streptococcus_phage	71.2	9.2e-55
AXJ88720.1|1356290_1356581_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
AXJ88721.1|1358453_1359641_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AXJ89413.1|1359637_1360069_-	peptidase	NA	NA	NA	NA	NA
AXJ88722.1|1360161_1360356_+	hypothetical protein	NA	NA	NA	NA	NA
1360173:1360205	attL	AATACTCTTCGAAAATCTCTTCAAACCACGTCA	NA	NA	NA	NA
AXJ88723.1|1360446_1360995_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
AXJ88724.1|1361272_1362001_-	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	39.0	2.0e-40
AXJ88725.1|1362079_1362259_-	DUF3953 domain-containing protein	NA	NA	NA	NA	NA
AXJ88726.1|1362410_1364006_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ88727.1|1364017_1364428_-	peptide deformylase	NA	A0A2I7R224	Vibrio_phage	33.1	1.3e-09
AXJ88728.1|1364543_1365335_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
AXJ88729.1|1365347_1368044_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.5	3.1e-70
AXJ88730.1|1368347_1369532_+	cation-efflux pump	NA	NA	NA	NA	NA
AXJ88731.1|1369674_1371546_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.1	1.1e-55
AXJ88732.1|1371542_1372742_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	32.6	6.9e-38
AXJ88733.1|1372738_1373506_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AXJ88734.1|1373771_1374620_-	fatty acid-binding protein DegV	NA	NA	NA	NA	NA
AXJ88735.1|1374621_1375008_-	DUF1149 domain-containing protein	NA	NA	NA	NA	NA
AXJ88736.1|1375069_1376422_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXJ88737.1|1376445_1377225_-	YbbR-like domain-containing protein	NA	NA	NA	NA	NA
AXJ88738.1|1377211_1378069_-	TIGR00159 family protein	NA	NA	NA	NA	NA
AXJ88739.1|1377986_1378160_-	hypothetical protein	NA	NA	NA	NA	NA
AXJ88740.1|1378204_1379173_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	100.0	2.8e-66
AXJ88741.1|1379299_1379527_+	hypothetical protein	NA	NA	NA	NA	NA
AXJ88742.1|1379425_1380382_-	autolysin	NA	A0A1S5SBM2	Streptococcus_phage	99.4	1.5e-144
AXJ88743.1|1380381_1380717_-|holin	phage holin	holin	A0A126GGL9	Streptococcus_phage	99.1	3.4e-51
AXJ88744.1|1380720_1381020_-	hypothetical protein	NA	A0A1S5SC89	Streptococcus_phage	100.0	1.4e-45
AXJ88745.1|1381029_1381380_-	hypothetical protein	NA	A0A060QMT7	Streptococcus_phage	100.0	4.7e-64
AXJ88746.1|1381382_1381586_-	hypothetical protein	NA	X2KU40	Streptococcus_phage	100.0	1.1e-25
AXJ88747.1|1388127_1388478_-	hypothetical protein	NA	A0A141E0R8	Streptococcus_phage	99.1	9.8e-62
AXJ88748.1|1388486_1392080_-	hypothetical protein	NA	A0A141E0R9	Streptococcus_phage	98.6	0.0e+00
AXJ88749.1|1392066_1392417_-	hypothetical protein	NA	A0A060QN56	Streptococcus_phage	100.0	2.1e-56
AXJ88750.1|1392455_1392836_-	hypothetical protein	NA	A0A1S5SF40	Streptococcus_phage	100.0	9.3e-66
AXJ88751.1|1392840_1393254_-|tail	phage tail protein	tail	A0A1S5SF61	Streptococcus_phage	99.3	3.3e-72
AXJ88752.1|1393256_1393625_-	hypothetical protein	NA	A0A1S5SFB8	Streptococcus_phage	100.0	1.2e-65
AXJ88753.1|1393621_1394137_-	hypothetical protein	NA	A0A141E0I0	Streptococcus_phage	100.0	9.3e-93
AXJ89414.1|1394111_1394414_-	hypothetical protein	NA	X2KU30	Streptococcus_phage	100.0	2.0e-42
AXJ88754.1|1394430_1394742_-|head,tail	phage head-tail adapter protein	head,tail	A0A1S5S8S7	Streptococcus_phage	99.0	7.2e-48
AXJ88755.1|1394743_1394932_-	hypothetical protein	NA	A0A141DZN7	Streptococcus_phage	100.0	1.4e-27
AXJ88756.1|1394941_1395967_-	sugar-binding protein	NA	A0A1S5S8Q2	Streptococcus_phage	99.7	7.3e-190
AXJ88757.1|1395989_1396514_-	DUF4355 domain-containing protein	NA	E8ZDV2	Streptococcus_phage	98.9	1.7e-73
AXJ88758.1|1396995_1397409_-	HD domain-containing protein	NA	A0A1S5SBR9	Streptococcus_phage	100.0	5.4e-67
AXJ88759.1|1397405_1397615_-	hypothetical protein	NA	A0A1S5SB88	Streptococcus_phage	100.0	3.3e-33
AXJ88760.1|1397616_1399200_-|head	phage head morphogenesis protein	head	A0A1S5SDJ1	Streptococcus_phage	99.2	5.1e-299
AXJ88761.1|1400642_1401941_-|terminase	PBSX family phage terminase large subunit	terminase	A0A141E1F1	Streptococcus_phage	99.3	7.2e-259
AXJ88762.1|1401918_1402431_-|terminase	terminase small subunit	terminase	A0A060QNR7	Streptococcus_phage	99.4	1.5e-87
AXJ88763.1|1403700_1404123_-	DUF1492 domain-containing protein	NA	A0A141E1Y4	Streptococcus_phage	100.0	6.3e-71
AXJ88764.1|1404240_1404558_-	3-dehydroquinate synthase	NA	A0A1S5SDY8	Streptococcus_phage	98.1	1.4e-51
AXJ88765.1|1404619_1405147_-	DUF1642 domain-containing protein	NA	A0A1S5SE80	Streptococcus_phage	96.0	2.4e-96
AXJ88766.1|1405148_1405463_-	hypothetical protein	NA	A0A1S5SDB3	Streptococcus_phage	98.1	1.5e-56
AXJ88767.1|1405613_1405952_-	hypothetical protein	NA	A0A1S5SDI1	Streptococcus_phage	100.0	5.6e-62
AXJ88768.1|1406396_1407740_-	helicase	NA	A0A1S5SAS5	Streptococcus_phage	99.3	7.7e-256
AXJ88769.1|1407742_1408564_-	DNA primase	NA	A0A1S5SDK7	Streptococcus_phage	99.3	6.5e-157
AXJ88770.1|1408736_1409240_-	hypothetical protein	NA	A0A126GGP3	Streptococcus_phage	98.8	2.9e-91
AXJ88771.1|1409259_1410036_-	NTP-binding protein	NA	A0A141DZQ7	Streptococcus_phage	100.0	8.7e-143
AXJ88772.1|1410035_1410353_-	hypothetical protein	NA	X2KPG0	Streptococcus_phage	100.0	2.0e-53
AXJ88773.1|1410371_1411565_-	type III restriction endonuclease subunit R	NA	X2KU10	Streptococcus_phage	99.7	5.3e-232
AXJ88774.1|1411527_1412013_-	hypothetical protein	NA	X2KUD4	Streptococcus_phage	98.8	1.4e-87
AXJ88775.1|1412012_1412372_-	hypothetical protein	NA	A0A1S5SB89	Streptococcus_phage	99.2	2.3e-58
AXJ88776.1|1412371_1412854_-	hypothetical protein	NA	A0A1S5S7W2	Streptococcus_phage	100.0	1.4e-79
AXJ88777.1|1412846_1413569_-	HNH endonuclease	NA	A0A141E0V1	Streptococcus_phage	98.8	3.3e-136
AXJ88778.1|1413582_1413813_-	hypothetical protein	NA	X2KU06	Streptococcus_phage	100.0	2.2e-33
AXJ88779.1|1413813_1414155_-	hypothetical protein	NA	A0A1S5S7X8	Streptococcus_phage	100.0	1.4e-57
AXJ88780.1|1414166_1414358_-	hypothetical protein	NA	A0A1S5SDN5	Streptococcus_phage	100.0	2.3e-28
AXJ88781.1|1414354_1414549_-	hypothetical protein	NA	X2KSX0	Streptococcus_phage	100.0	1.8e-09
AXJ88782.1|1414545_1414818_-	hypothetical protein	NA	A0A1S5SDW9	Streptococcus_phage	100.0	8.8e-42
AXJ88783.1|1415158_1415350_+	hypothetical protein	NA	X2KSW6	Streptococcus_phage	98.4	1.5e-27
AXJ88784.1|1415303_1415510_-	hypothetical protein	NA	A0A141E1R6	Streptococcus_phage	100.0	4.0e-31
AXJ88785.1|1415532_1415724_-	DNA-binding protein	NA	A0A141DZR9	Streptococcus_phage	100.0	3.0e-28
AXJ88786.1|1415788_1416028_+	hypothetical protein	NA	A0A141DZS0	Streptococcus_phage	100.0	4.7e-39
AXJ88787.1|1416251_1416341_+	type I addiction module toxin, Fst family	NA	NA	NA	NA	NA
AXJ88788.1|1416563_1416656_+	type I addiction module toxin, Fst family	NA	NA	NA	NA	NA
AXJ88789.1|1417053_1417407_+	XRE family transcriptional regulator	NA	A0A1S5SEQ8	Streptococcus_phage	99.1	7.1e-60
AXJ88790.1|1417408_1418503_+	hypothetical protein	NA	A0A1S5SFA1	Streptococcus_phage	100.0	3.5e-206
AXJ88791.1|1418725_1419106_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	99.2	1.1e-66
AXJ88792.1|1419247_1420375_+|integrase	site-specific integrase	integrase	A0A1S5SEM0	Streptococcus_phage	100.0	4.5e-209
AXJ88793.1|1420462_1421374_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	99.7	1.5e-154
AXJ88794.1|1421370_1422348_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	100.0	1.2e-184
AXJ88795.1|1422344_1423235_-	RNase adaptor protein RapZ	NA	NA	NA	NA	NA
AXJ88796.1|1423286_1423667_-	RidA family protein	NA	NA	NA	NA	NA
AXJ88797.1|1423677_1424265_-	GTP-binding protein	NA	NA	NA	NA	NA
AXJ88798.1|1424273_1425506_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.0	1.4e-131
1433254:1433286	attR	TGACGTGGTTTGAAGAGATTTTCGAAGAGTATT	NA	NA	NA	NA
>prophage 9
CP025838	Streptococcus pneumoniae strain SPN XDR SMC1710-32 chromosome, complete genome	2057144	2034013	2042766	2057144		Streptococcus_phage(33.33%)	9	NA	NA
AXJ89346.1|2034013_2034853_-	energy-coupling factor transporter ATPase	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.3e-16
AXJ89347.1|2034837_2035665_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.9	2.1e-22
AXJ89348.1|2035661_2036207_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AXJ89349.1|2036217_2037048_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXJ89350.1|2037080_2038364_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	30.7	5.5e-17
AXJ89351.1|2038360_2039611_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	42.1	8.6e-92
AXJ89352.1|2039769_2040138_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	56.0	4.5e-17
AXJ89353.1|2040140_2041238_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AXJ89354.1|2041287_2042766_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	4.9e-94
